Sesbania cannabina Nramp5 gene and application thereof in cadmium hyperaccumulation

Abstract

The invention discloses a sesbania Nramp5 gene and application thereof in cadmium hyperaccumulation, and belongs to the technical field of genetic engineering. According to the invention, the sesbania ScNramp5 gene is cloned for the first time, and the ScNramp5 gene is expressed in yeast to preliminarily determine that the sesbania ScNramp5 has the capacity of transporting and absorbing enriched cadmium. Furthermore, after the ScNramp5 gene is overexpressed in the rice, the cadmium content of the root part of the overexpressed ScNramp5 rice is obviously higher than that of the wild type rice, the change of the cadmium content of the overground part is not obvious, and the result shows that the ScNramp5 can efficiently enrich cadmium and only enrich cadmium in the root part. Important theoretical basis and gene resources are provided for repairing cadmium-polluted soil by utilizing plants and improving cadmium tolerance of crops.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, specifically to Sesbania sesbania Nramp5 Cloning of genes and their functional applications in hyperaccumulation of cadmium. Background Art

[0002] Cadmium is highly toxic, easily mobile, and difficult to degrade. After entering the human body through the food chain, it will accumulate in organs such as the kidney and liver, causing a variety of serious diseases such as renal failure and osteoporosis, posing a huge threat to human health. When agricultural soil is contaminated by cadmium, crop growth is hindered and the quality of agricultural products declines, which not only affects agricultural production efficiency but also endangers food safety. Plant resistance and accumulation of cadmium require precise regulation by genes. In-depth exploration of the cadmium absorption and accumulation mechanism of hyperaccumulators through molecular biological methods is of great value and significance for the future restoration of cadmium-contaminated soil, prevention of cadmium from entering the food chain, and crop breeding and improvement.

[0003] As a green manure, Sesbania cannabina has the characteristics of salt tolerance, waterlogging tolerance and strong adaptability. It plays a significant role in improving soil fertility, improving soil structure, inhibiting weed growth, reducing soil erosion and promoting soil microbial activity, which is of great significance to the sustainable development of agriculture. Arabidopsis and rice are commonly used model organisms in biological research. Although there are some studies on model plants, Nramp5 However, there are significant differences between Sesbania sesbania and model plants in terms of genetic background, ecological adaptability, etc., and the research conclusions of model plants cannot be simply applied to Sesbania sesbania.

[0004] There is no Tian Jing yet Nramp5 There is a lack of reports on the functional studies of Sesbania truncatula Nramp5 Detailed analysis of gene sequence, structure and expression pattern is not enough to deeply understand the molecular regulatory network in the process of cadmium absorption. Nramp5 The absorption mechanism of cadmium will help to further explore the potential of Sesbania sesbania in the remediation of cadmium-contaminated soils, and will also provide a new perspective for understanding the heavy metal tolerance mechanism of plants. Summary of the invention

[0005] In view of the above prior art, the present invention provides a Nramp5 Genes and their application in cadmium hyperaccumulation, fully considering the significant differences between Sesbania sesbania and model plants in genetic background, ecological adaptability, etc., accurately interpreting the Nramp5 functions and mechanisms.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: In a first aspect, the present invention provides a ScNramp5 Gene, ScNramp5 The gene is derived from Sesbania truncatula, and its nucleotide sequence is shown in SEQ ID NO.1, which is as follows: SEQ ID NO.1:

[0007] Said ScNramp5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2, and is as follows: SEQ ID NO.2: .

[0008] In a second aspect, the present invention provides ScNramp5 Use of a gene in any of the following (1)-(4): (1) Regulating the plant's ability to accumulate cadmium; (2) Regulating plant cadmium tolerance; (3) Cultivate new plant varieties for the remediation of cadmium-contaminated soils; (4) Construct a biosensor that responds to cadmium concentration.

[0009] The performance of regulating the cadmium accumulation ability of plants is as follows: ScNramp5 The gene can be efficiently expressed in the root system, thereby regulating the plant to efficiently accumulate cadmium.

[0010] The present invention verifies through experiments that overexpression ScNramp5The cadmium content in the root part of the plant was significantly higher than that in the wild type, while the cadmium content in the aboveground part did not change significantly, indicating that ScNramp5 Able to express efficiently in the root system.

[0011] The cadmium concentration-responsive biosensor is constructed by ScNramp5 The gene is coupled with a reporter gene to construct a cadmium concentration-responsive biosensor for real-time monitoring of cadmium pollution in the environment or food.

[0012] The reporter gene is: chloramphenicol acetyltransferase gene (cat), luciferase gene (luc), β-glucuronidase gene (gus), secretory alkaline phosphatase gene (seap) or green fluorescent protein gene (gfp).

[0013] In a third aspect, the present invention provides ScNramp5 The use of the protein encoded by the gene in any of the following (1)-(3): (1) Regulating the ability of plants to accumulate cadmium (2) Regulating plant cadmium tolerance; (3) Cultivate new plant varieties for remediation of cadmium-contaminated soil.

[0014] In a fourth aspect, the present invention provides a ScNramp5 The use of a recombinant gene expression vector or a genetically engineered bacterium in any of the following (1) to (4): (1) Regulating the ability of plants to accumulate cadmium (2) Regulating plant cadmium tolerance; (3) Cultivate new plant varieties for the remediation of cadmium-contaminated soils; (4) Construct a biosensor that responds to cadmium concentration.

[0015] In a fifth aspect, the present invention provides a method for improving the cadmium accumulation capacity of plants, comprising the following steps: ScNramp5 Gene or enhancement ScNramp5 The activity of gene-encoded proteins can improve the plant's ability to accumulate cadmium.

[0016] In a sixth aspect, the present invention provides a method for cultivating a plant variety with high cadmium accumulation, wherein the method comprises: ScNramp5 The recombinant expression vector or genetically engineered bacteria of the gene is transformed into the plant body, positive clones are screened, and transgenic plant varieties with high cadmium enrichment are obtained.

[0017] In a seventh aspect, the present invention provides a method for repairing cadmium-contaminated soil, by planting cultivated cadmium-high-accumulating plant varieties on cadmium-contaminated soil, harvesting the plants after they have accumulated cadmium, and centrally processing them, thereby achieving repair of the cadmium-contaminated soil.

[0018] Beneficial effects of the present invention: Sesbania truncatula ScNramp5 Gene, by ScNramp5 Gene expression in yeast, preliminarily identified Sesbania truncatula ScNramp5 It has the ability to transport and absorb cadmium. ScNramp5 After the gene was overexpressed in rice, it was found that the overexpression ScNramp5 The cadmium content in the root part of rice was significantly higher than that in the wild type, while the cadmium content in the aboveground part did not change significantly. ScNramp5 It can be efficiently expressed in the root system, thereby efficiently enriching cadmium. The present invention uses molecular biological methods to explore the super-rich cadmium in sesbania. ScNramp5 Gene, verified ScNramp5 The function of cadmium enrichment and transport provides an important theoretical basis and genetic resources for the use of plants to repair cadmium-contaminated soil and improve crop cadmium tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 for ScNramp5 -Colocalization of GFP fusion protein and plasma membrane marker FM4-64; from left to right: ScNramp5 -Green fluorescence of GFP, red fluorescence of FM4-64, bright field and merged microscopy images; Bar=25 μm.

[0020] Figure 2 For transformation of pDR196 empty vector (Ctrl) and ScNramp5 Detection of Cd content in yeast Δycf1 cells; data are mean ± SD, n = 5.

[0021] Figure 3 for ScNramp5 Expression analysis of overexpression rice lines; gene expression was detected by RT-qPCR analysis, OsActin was used as an internal reference gene, and 2 -ΔΔCT Relative expression levels are shown, and the statistical results are the mean ± standard error of three biological replicates. The wild-type RT-qPCR detection result is 1.

[0022] Figure 4 for ScNramp5 Characterization of cadmium absorption and accumulation capacity of transgenic rice materials; Figure 4 A in ScNramp5 Phenotype of overexpressing transgenic rice plants under 0.5 μM CdCl2 treatment, bar = 10 cm; Figure 4 B is 0.5 μM CdCl2 treatment ScNramp5Cd contents in the root and shoot of overexpressing transgenic rice plants. Data are mean ± SD, n = 5. DETAILED DESCRIPTION

[0023] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0024] As mentioned above, soil heavy metal pollution is currently severe, although Arabidopsis and rice model plants have been Nramp5 However, there are significant differences between Sesbania sesbania and model plants in terms of genetic background and ecological adaptability. Simply applying the research conclusions of model plants to Sesbania sesbania may lead to Nramp5 Misinterpretation of function and mechanism.

[0025] Existing research on heavy metal absorption in Sesbania sesbania mainly stays at the macroscopic physiological level. Nramp5 There is little research on the molecular mechanisms of gene cloning, expression regulation, and protein function. Nramp5 Detailed analysis of gene sequence, structure and expression pattern makes it difficult to deeply understand the molecular regulatory network in the process of cadmium absorption. At the same time, existing studies lack systematicity and comprehensiveness in experimental design. The experimental conditions between different studies vary greatly, resulting in poor comparability of research results and the inability to form a complete and unified theoretical system of cadmium absorption and tolerance mechanism in Sesbania sesbania. Nramp5 In terms of applied research, an effective technology system for remediation of cadmium-contaminated soil based on this gene has not yet been established, and there is still a large gap from practical application.

[0026] The present invention aims to overcome the limitations of directly borrowing from model plant research, fully consider the significant differences between Sesbania sesbania and model plants in genetic background, ecological adaptability, etc., and pay special attention to the effects of Sesbania sesbania on the absorption and transport process of heavy metal ions, so as to accurately interpret the Nramp5 At the same time, we are committed to making up for the shortcomings of our own research on Sesbania tiannan and conducting in-depth research on Sesbania tiannan. Nramp5 The study of gene cloning, expression regulation, protein function and other molecular mechanisms, detailed analysis of the gene sequence and expression pattern, and verified the sesbania truncatula through yeast and transgenic overexpression rice Nramp5 Function of cadmium absorption and transport.

[0027] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.

[0028] Embodiment 1: ScNramp5 Gene cloning and vector construction (1) Log in to the NCBI website to search for different species Nramp5 The protein of the gene or the amino acid sequence encoded by the cDNA was subjected to multiple sequence alignment to determine the appropriate conserved region, and the primer sequences shown in SEQ ID NO.3-SEQ ID NO.4 were designed using the primer design software Primer5.0.

[0029] F:ATGGCAAGCCTGCAACAA (SEQ ID NO.3); R:TTATTGTGGTAGTGGGAT (SEQ ID NO. 4).

[0030] (2) Extract RNA from Tianjing (Lujing No. 5) and reverse transcribe it into cDNA. Using cDNA as a template and the primer sequences shown in SEQ ID NO.3-SEQ ID NO.4, the reaction system shown in Table 1 was followed by pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing and extension at 58°C for 2 min, 35 cycles, and full extension at 72°C for 5 min, and then maintained at 10°C for 3 min. ScNramp5 Gene PCR amplification.

[0031] Table 1: Reaction system The PCR amplified product was detected by 0.8% agarose gel electrophoresis and sequenced. ScNramp5 The gene is 1650 bp and the nucleotide sequence is shown in SEQ ID NO.1.

[0032] (3) ScNramp5 Construction of gene vector: ScNramp5 The gene PCR product was separated by agarose gel electrophoresis and then recovered by gel cutting. The purified fragment was connected to the pMD19-T intermediate vector according to the enzyme ligation reaction system shown in Table 2, and then transferred into E. coli DH5α competent cells. After being spread on LB solid medium containing 50μg / mL Amp and grown for 12h-16h, positive colonies were picked for sequencing. The ones with correct sequencing were the ones containing ScNramp5 The recombinant plasmid containing the full-length gene sequence is named ScNramp5 -P. Add 30% glycerol to the bacterial solution with the correct sequencing volume ratio and store it at -70°C for future use.

[0033] Table 2: Enzyme-linked reaction system Embodiment 2: ScNramp5 Subcellular localization Constructed with Example 1 ScNramp5 -P was used as a template to amplify the gene using the primer sequences shown in SEQ ID NO.5-SEQ ID NO.6 ScNramp5 , restriction sites, and connected with 1305-GFP vector to obtain recombinant plasmid ScNramp5 -GFP; F: CACCATTTACGAACGATAGGAGCTCggtaccatggcaagcctgcaacaacaagc (SEQ IDNO.5); R: GCCCTTGCTCACCATCTGCAGGTCGACTTGTGGTAGTGGGATATCAGCTAAATC (SEQ ID NO. 6).

[0034] Aseptically grown rice seedlings (Nipponbare) were prepared, their protoplasts were isolated, and DNA was transformed by PEG. The fluorescence signal of the protoplasts was observed using a ZEISS LSM710nlo confocal laser scanning microscope (63× oil objective). The excitation light / emission light wavelengths used to observe GFP and YFP fluorescence signals were 488 nm / 506~538 nm, respectively, and the wavelength parameters for observing RFP signals were 561 nm / 575-630 nm, respectively. The results showed that ScNramp5 The subcellular localization results of the GFP fusion protein in rice protoplasts showed that it was plasma membrane type ( Figure 1 ).

[0035] Embodiment 3: ScNramp5 Application in cadmium-sensitive yeast strain Δycf1 (1) ScNramp5 -P was used as a template to amplify the gene using the primer sequences shown in SEQ ID NO.7-SEQ ID NO.8 ScNramp5 , EcoR1 and Xho1 restriction sites, and connected with the pEASY-Blunt intermediate vector to obtain the recombinant plasmid ScNramp5 -PEA1; F: GAATTC ATGGCAAGCCTGCAACAA EcoR1 (SEQ ID NO.7); R:CTCGAGTTATTGTGGTAGTGGGAT Xho1 (SEQ ID NO. 8).

[0036] (2) The recombinant plasmid obtained in step (1) ScNramp5 -PEA1 was inserted into the pDR196 yeast expression vector to construct the expression vector pDR196- ScNramp5 ; (3) Pick a single Δycf1 colony from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium. Incubate at 30°C, 225 rpm, and shake for 18-20 h (overnight) until the OD 600 =0.8-1.0. Take 1 ml of bacterial solution to a 1.5 ml centrifuge tube, incubate at room temperature, 4000 rpm, 5 min, discard the supernatant, resuspend the bacteria with 1 ml of sterile water, blow evenly, centrifuge to collect the bacteria, and discard the supernatant. Resuspend the bacteria with 1 ml0.1 M LiAc, mix, blow evenly, centrifuge again to collect the bacteria, and discard the supernatant. Finally, add 100μl of 0.1 M LiAc to each 1.5 ml centrifuge tube to resuspend the bacteria for later use. Add the following reagents to each 1.5 ml centrifuge tube in sequence: 1 μg target plasmid (pDR196- ScNramp5 ), 500 μl 50% PEG3350 Mix, 5 μl DTT, and then oscillate vigorously for about 1 min until completely mixed. Then place the 1.5 ml centrifuge tube in a 30℃ metal bath and incubate for 30 min, vortexing vigorously every 10 min. Then heat shock at 42℃ for 20 min, immediately place on ice for 5 min, and then recover at 30℃ for 30 min. Centrifuge to collect bacteria, room temperature, 4000rpm, 5 min, discard the supernatant. Use 200 μl sterile water to suspend the bacteria for each transformation, mix as gently as possible, and apply SD-U solid plates (purchased from Beijing Coolbo Technology Co., Ltd.). After culturing at 30℃ for 4 days, randomly pick single clones for colony PCR verification.

[0037] 4) Determination of cadmium content in yeast: The Δycf1 strain (ctrl) transformed with pDR196 empty vector in the logarithmic growth phase and the Δycf1 strain (ctrl) transformed with pDR196- ScNramp5 The yeast Δycf1 strain ( ScNramp5 ) to liquid SD-U medium (purchased from Beijing Coolaibo Technology Co., Ltd.), the initial OD 600nm =0.2, 30℃ 200 rpm culture for 12 h, add 10 μM CdCl2, continue to culture for 2 h, harvest yeast cells by centrifugation at 4000 rpm at 4℃, wash 3 times with 10 μΜ EDTA (pH=8.0) at 4℃, then wash 3 times with ddH2O, freeze-dry, digest with 5ml high-grade pure concentrated HNO3 in a microwave digester, and determine the cadmium content by ICP-MS. The test results showed that the transformed pDR196- ScNramp5 The cadmium content in the yeast Δycf1 strain was significantly higher than that in the strain transformed with the pDR196 empty vector, which preliminarily determined that Sesbania truncatula ScNramp5 Has the ability to absorb and enrich cadmium ( Figure 2 ).

[0038] Example 4: Overexpression ScNramp5 Application in rice (1) ScNramp5 -P as a template, and the primer sequences shown in SEQ ID NO.9-SEQ ID NO.10 were used to amplify the gene ScNramp5 , BamH I and Kpn I restriction sites, and connected with the pEASY-Blunt intermediate vector to obtain the recombinant plasmid ScNramp5 -PEA2; ScNramp5 -PEA2-F:GAATTCATGGCAAGCCTGCAACAA (SEQ ID NO.9); ScNramp5 -PEA2-R: CTCGAGTTATTGTGGTAGTGGGAT (SEQ ID NO. 10).

[0039] (2) The recombinant plasmid obtained in step (1) ScNramp5 -PEA2 was inserted into pTCK303 vector to construct expression vector pTCK303- ScNramp5 ; (3) The expression vector pTCK303- ScNramp5 Transformed into Agrobacterium, the obtained plasmid was transformed with pTCK303- ScNramp5 When Agrobacterium tumefaciens infected with plasmids and positive clones were screened, ScNramp5 The vector used for the overexpression rice transgenic material carries the GUS reporter gene driven by the 35s strong promoter. The transgenic positive seedlings were first stained with GUS to obtain the transgenic positive seedlings. Then RNA was further extracted from the positive seedlings and reverse transcribed to obtain cDNA. Then the obtained cDNA was used as a template to express the rice OsActin The gene was used as an internal reference and RT-qPCR was used to ScNramp5 The overexpression effect of Figure 3 ),choose ScNramp5 Overexpression lines (OX1, OX2, and OX3) were used for subsequent experiments.

[0040] OsActin F: CAACACCCCTGCTATGTACG (SEQ ID NO. 11); OsActin R: CATCACCAGAGTCCAACACAA (SEQ ID NO. 12).

[0041] ScNramp5F:ATTGGCACAGCCTTTGCC (SEQ ID NO.13); ScNramp5 R: TTTTAATACATCAGAAGC (SEQ ID NO. 14).

[0042] (4) WT (Nipponbare) and ScNramp5 Rice seeds of overexpression lines (OX1, OX2, OX3) were surface sterilized and germinated in 1 / 2 MS medium. After 7 days of germination, uniform-sized and vigorously growing seedlings were selected and transferred to 10 liters of International Rice Research Institute (IRRI) nutrient solution (0.3mM KH2PO4, 0.35mM K2SO4, 1.0mM CaCl2, 1.0mM MgSO4_7H2O, 0.5mM Na2SiO3, 20.0μM Fe-EDTA, 9.0μM MnCl2, 0.39μM (NH4)6Mo7O4_2H2O, 20.0μMH3BO3, 0.77μM ZnSO4 and 0.32μM CuSO4; pH 5.5). The nutrient solution was changed every other day. After 15 days of cultivation, it was treated with 0.5 μM CdCl2 for 5 days. Perform phenotypic observations and take photos of the phenotypic results. Figure 4 As shown in A.

[0043] The samples were then dried at 60±2°C to a constant weight and weighed to determine the dry weight. The cadmium content was determined by digesting 5 ml of high-grade pure concentrated HNO3 in a microwave digester, and the cadmium content in the aboveground part and root system of rice seedlings was determined by ICP-MS. ScNramp5 The results of Cd content detection in the root and shoot of overexpressing transgenic rice plants are as follows: Figure 4 As shown in B. The test results showed that compared with the wild type, the overexpression ScNramp5 The cadmium content in the root part of the plant was significantly higher than that in the wild type, while the cadmium content in the aboveground part did not change significantly. ScNramp5 It can efficiently enrich cadmium. ScNramp5 The recombinant expression vector of the gene is transformed into the plant body to obtain the overexpression ScNramp5 Genetically modified plants can be used as new plant varieties for remediation of cadmium-contaminated soil.

[0044] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification made within the spirit and principle of the present application shall be deemed to be appropriate. Equivalent replacements, improvements, etc. should all be included in the protection scope of this application.

Claims

1. A ScNramp5 A gene characterized by Said ScNramp5 The gene is derived from Sesbania sesbania, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. ScNramp5 The protein encoded by the gene is characterized in that Said ScNramp5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. ScNramp5 Use of a gene in any of the following (1)-(3): (1) Regulating the plant's ability to accumulate cadmium; (2) Regulating plant cadmium tolerance; (3) Cultivate new plant varieties for remediation of cadmium-contaminated soil.

4. The use according to claim 3, characterized in that: Through overexpression ScNramp5 Gene or enhancement ScNramp5 The activity of gene-encoded proteins can improve the plant's ability to accumulate cadmium.

5. The use according to claim 3, characterized in that: The performance of regulating the cadmium accumulation ability of plants is as follows: ScNramp5 The gene can be efficiently expressed in the root system, thereby regulating the plant to efficiently accumulate cadmium.

6. The use according to claim 3, characterized in that: The new plant variety for cadmium-contaminated soil remediation is cultivated by ScNramp5 Recombinant expression vector of gene or containing ScNramp5 The gene is transformed into plants by genetically engineered bacteria and positive clones are obtained by screening.

Images