Screening and application of CRISPR system inhibitor CP-724714

Abstract

The invention relates to screening and application of a CRISPR (clustered regularly interspaced short palindromic repeats) system inhibitor CP-724714. The SSA repair efficiency can be conveniently detected in various eukaryotes by utilizing a dual-luciferase mediated SSA report system, taking mutated firefly luciferase to represent SSA efficiency and taking renilla luciferase as an internal reference, and meanwhile, the endonuclease efficiency of corresponding nuclease is obtained. The small molecule compound CP-724714 capable of inhibiting a CRISPR system is found through high-throughput screening of a dual-luciferase-mediated SSA report system, and the CRISPR working time can be shortened, so that an effective solution is provided for reducing the off-target efficiency of CRISPR, and the application prospect is wide.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to the screening and application of CRISPR system inhibitor CP-724714. Background Art

[0002] The CRISPR gene editing system (Clustered Regularly Interspaced Short Palindromic Repeats) is a gene editing technology widely used in biology and medicine. It originated from the immune system of bacteria to resist the invasion of viruses, and has been transformed by scientists into a powerful gene editing tool that can make precise modifications at specific locations in DNA. The core mechanism of CRISPR technology relies on two key elements: CRISPR sequences: These are a set of repeated sequences in bacterial DNA, each of which is interspersed with DNA fragments from past viruses, which act as a memory. When bacteria encounter the same virus again, the CRISPR sequence guides an enzyme called Cas (CRISPR-associated) protein to cut the invader's DNA. Cas9 protein: An enzyme that can precisely cut DNA. Scientists combine Cas9 protein with a short sequence called guide RNA (gRNA), which can pair with the target sequence in DNA to guide Cas9 protein to reach and cut a specific DNA location. Through this mechanism, CRISPR-Cas9 can precisely cut DNA in living cells, thereby achieving gene deletion, insertion or replacement. The CRISPR system is widely used. In the field of gene therapy, CRISPR technology is expected to cure genetic diseases such as sickle cell anemia, cystic fibrosis, Duchenne muscular dystrophy, etc. By editing the patient's genes, the mutant genes can be repaired or replaced to restore their normal functions. In the agricultural field, CRISPR is also used in agriculture to help develop excellent crops that are resistant to pests and diseases and drought. For example, by editing plant genes, their nutritional value can be increased or their yields can be increased. In the field of basic biological research, CRISPR is widely used in basic fields such as studying gene function, gene regulation, and developmental processes. Researchers can use CRISPR to knock out or activate specific genes to study their effects. However, the CRISPR system also faces a series of challenges and ethical issues: off-target problems, ethical issues, ecological issues, etc., among which off-target problems are the main technical problems faced by the CRISPR system.

[0003] The off-target effect of the CRISPR system refers to the fact that CRISPR gene editing technology may accidentally cut or modify other unrelated DNA sequences in addition to the target DNA sequence when targeted gene editing. Although CRISPR technology is generally highly specific, off-target effects are still a problem that needs to be paid attention to and solved, especially in clinical treatment and large-scale gene editing applications. The generation of off-target effects is usually related to the design and mechanism of the CRISPR system, especially the interaction between gRNA and Cas enzyme. Specific reasons include: 1. Similarity between guide RNA and non-target sequence: gRNA is the key to guiding Cas9 enzyme to recognize target DNA, and its sequence is usually complementary to the target DNA sequence. If the design of gRNA is not precise enough, it may also have a certain similarity with non-target DNA sequence, which causes Cas9 enzyme to mistakenly cut these non-target regions. The binding of gRNA to non-target DNA does not require a perfect match. As long as there is a certain degree of complementarity, Cas9 enzyme may also cut DNA at these locations. 2. Recognition characteristics of Cas enzyme: Cas9 enzyme recognizes the target DNA sequence by binding to gRNA, but its cutting ability does not only depend on the complete pairing of gRNA and DNA sequence. Cas9 has a certain spatial and sequence tolerance in the DNA double strand, which means that it may recognize and cut DNA regions similar to the target sequence. 3. The influence of cell repair mechanism: When cells deal with DNA double-strand breaks, they will repair them through different repair mechanisms (such as non-homologous end joining NHEJ or homologous recombination HDR). If errors occur during the repair process, unexpected mutations or genetic changes may occur, and even target gene editing may fail. At present, there are mainly the following strategies to reduce off-target effects: 1. Optimize the design of guide RNA, try to avoid the similarity between gRNA and non-target sequences during design, and improve the specificity of gRNA. Algorithmic tools can be used to predict and select gRNAs that are most likely to have low off-target effects. 2. Use highly specific Cas enzymes, use optimized or improved Cas enzymes such as Cpf1 (Cas12a), which show lower off-target effects during cutting. In addition, some studies are also developing Cas9 variants with higher accuracy (such as high-specificity Cas9 (eSpCas9) and HypaCas9) to reduce off-target risks. 3. Use prime editing technology. Prime editing is a new type of gene editing technology that is more precise than traditional CRISPR / Cas9 and can achieve gene editing without double-strand breaks, thereby greatly reducing the occurrence of off-target effects. 4. Use a lower concentration of Cas enzyme. Using a lower concentration of Cas enzyme can reduce the chance of off-target cutting, because the lower the activity of the enzyme, the higher the precision of the cutting.5. Improving the repair mechanism and using homologous recombination repair (HDR) rather than non-homologous end joining (NHEJ) can reduce inaccurate gene repair, thereby reducing the possibility of off-target mutations. Reducing the off-target effects of the CRISPR system is of great clinical significance. In clinical treatment, especially in the treatment of genetic diseases or cancer, off-target effects may bring unforeseen risks. Off-target effects may not only lead to treatment failure, but also cause side effects such as cancer. Therefore, how to effectively reduce and control off-target effects is a key issue in the current application of CRISPR technology in clinical treatment. Summary of the invention

[0004] Small molecules have many advantages as inhibitors or promoters of CRISPR systems. In order to screen small molecules that inhibit or promote CRISPR systems with high throughput, the present invention designs and constructs a dual-luciferase-mediated SSA reporter system. DNA double-strand breaks (DSBs) damage is a fatal damage to cells. Cells have evolved a series of DNA double-strand break damage repair methods, including non-homologous end joining repair (NHEJ), homologous recombination repair (HR), single-strand annealing repair (SSA), etc. Among them, when there are long repetitive sequences at both ends of the DNA double-strand break damage point, the intestinal repetitive sequences at both ends of the double-strand break point can be repaired by single-strand annealing through the single-strand annealing repair (SSA) pathway. Combining site-specific nucleases and SSA repair mechanisms, constructing an SSA reporter system can detect the SSA repair efficiency of cells and the enzymatic activity of site-specific nucleases. The dual-luciferase reporter gene detection system is a reporter system that uses luciferin as a substrate to detect the activity of luciferase. It includes two luciferases: Firefly Luciferase and Renilla luciferase. Using Renilla luciferase as an internal reference can eliminate interfering factors such as cell number, state, and transfection efficiency between different groups, and the detection results are more accurate. The dual-luciferase-mediated SSA reporter system has broad development and application prospects.

[0005] With the continuous advancement of technology, the application scope of CRISPR is rapidly expanding. In the future, CRISPR may play an important role in a wider range of fields, especially in personalized medicine and precision treatment. However, how to balance technological innovation with ethical and safety issues remains a challenge that scientific research and society must face together. The present invention uses a dual-luciferase-mediated SSA reporter system for high-throughput screening to find small molecule compounds that can inhibit the CRISPR system, which can shorten the working time of CRISPR, thereby providing an effective solution for reducing the off-target efficiency of CRISPR, and has broad application prospects.

[0006] The structural formula of CP-724714 is as follows Figure 1 , chemical formula is C 27 H 27 N5O3, CAS number 383432-38-0, chemical name 2-methoxy-N-[(E)-3-[4-[3-methyl-4-(6-methylpyridin-3-yl)oxyanilino]quin azolin-6-yl]prop-2-enyl]acetamide.

[0007] The present invention provides the use of CP-724714, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof in any of the following:

[0008] A1) Inhibit the gene editing efficiency of the CRISPR system in vitro and / or reduce the off-target rate of the CRISPR system;

[0009] A2) preparing inhibitors of CRISPR system gene editing efficiency or reagents for reducing the off-target rate of CRISPR system;

[0010] A3) preparing drugs that inhibit the gene editing efficiency of the CRISPR system and / or reduce the off-target rate of the CRISPR system;

[0011] A4) Prepare reagents that inhibit the gene editing efficiency of the CRISPR system and / or reduce the off-target rate of the CRISPR system.

[0012] Furthermore, the dosage of CP-724714 is 10 μM.

[0013] The present invention also provides a method for inhibiting the gene editing efficiency of the CRISPR system in vitro and / or reducing the off-target rate of the CRISPR system, wherein cells are gene-edited in the presence of a gene editing inhibitor, wherein the gene editing inhibitor comprises compound CP-724714, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof.

[0014] Furthermore, the gene editing inhibitor is contacted with the gene-edited cells before, during and / or after the cells are gene-edited.

[0015] Furthermore, a nucleotide sequence encoding a Cas9 nuclease is introduced into the cell, wherein the Cas9 nuclease is capable of generating double-strand breaks in the target DNA, thereby inducing gene editing of the target DNA; and the cell is cultured in the presence of a gene editing inhibitor.

[0016] Furthermore, the method is non-diagnostic and non-therapeutic.

[0017] Furthermore, the dosage of CP-724714 is 10 μM.

[0018] The present invention also provides a composition, characterized in that it comprises:

[0019] (i) a first agent, wherein the first agent is a gene editing inhibitor, wherein the gene editing inhibitor comprises CP-724714, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof; and

[0020] (ii) a second reagent, wherein the second reagent is a reagent for CRISPR gene editing;

[0021] Furthermore, the second reagent includes one or more of the following:

[0022] B1) Cas9 nuclease, a coding sequence of Cas9 nuclease, or a vector expressing Cas9 nuclease, or a combination thereof;

[0023] B2) tracrRNA and / or a vector for producing the tracrRNA;

[0024] B3) crRNA and / or a vector for producing the crRNA;

[0025] B4) Template for homology-directed repair, single-stranded nucleotide sequence or plasmid vector.

[0026] Furthermore, the target gene for CRISPR gene editing is selected from the following group: FANCF, RNF2 or a combination thereof.

[0027] Furthermore, the dosage of CP-724714 is 10 μM.

[0028] In another preferred embodiment, the CRISPR system gene editing includes type II CRISPR system gene editing and gene editing based on the CRISPR-Cas9 system;

[0029] In another preferred embodiment, the gene editing includes in vivo gene editing, in vitro gene editing, or a combination thereof;

[0030] In another preferred embodiment, the sample targeted by the gene editing is selected from the following group: cells, tissues, organs, or a combination thereof;

[0031] In another preferred embodiment, the sample is from animals, plants, microorganisms (including bacteria and viruses);

[0032] In another preferred embodiment, the sample is from a human or a non-human mammal;

[0033] In another preferred embodiment, the cells include primary cells and passaged cells;

[0034] In another preferred embodiment, the cells include somatic cells, germ cells, and stem cells;

[0035] In another preferred embodiment, the stem cells include: totipotent stem cells, pluripotent stem cells, and multipotent stem cells;

[0036] In another preferred embodiment, the stem cells are induced pluripotent stem cells (hiPSC);

[0037] In another preferred embodiment, the cells include: embryonic stem cells, adipose stem cells, hematopoietic stem cells, immune cells (such as T cells, NK cells);

[0038] The present invention also provides a method for constructing a dual luciferase-mediated SSA reporter system, comprising the following steps:

[0039] (1) Construction of the SSA reporter system basic vector, named T-CMV-SSA-luciferase;

[0040] (2) constructing the SSA reporter vector T-CMV-SSA-luciferase-X: first synthesizing a single-stranded oligonucleotide pair containing a site-specific nuclease target site, and then cloning it into the vector T-CMV-SSA-luciferase obtained in step (1) to successfully construct;

[0041] (3) The vector T-CMV-SSA-luciferase-X, the nuclease expression vector Y and the Renilla luciferase expression vector pRL-TK constructed in step (2) were transfected into cells at a molar ratio of 1:1:1, as the experimental group. The vector T-CMV-SSA-luciferase-X and the Renilla luciferase expression vector pRL-TK were transfected into cells at a molar ratio of 1:1, as the control group. 48 hours after transfection, the relative luciferase activity (firefly luciferase activity / Renilla luciferase activity) of the experimental group and the control group was measured using a dual luciferase activity detection kit according to the instructions to obtain the SSA repair efficiency of the experimental group and the control group, and at the same time, the endonuclease efficiency of the corresponding nuclease was obtained.

[0042] Further, step (1) comprises: cloning a firefly luciferase mutant gene driven by a CMV promoter into a T vector, wherein the firefly luciferase coding sequence is divided into two parts, the first part N-terminal contains 1188 base pairs and has a stop codon at the end, and the second part C-terminal contains 1336 base pairs, and the two parts of the firefly luciferase coding sequence have an overlapping region of 871 base pairs, and a DNA sequence containing multiple restriction endonuclease sites is inserted between the two overlapping regions, named T-CMV-SSA-luciferase, and its nucleotide sequence is shown in SEQ ID NO.1;

[0043] Preferably, (1-1) the N-terminus of the firefly luciferase gene comprises a 1188 base pair nucleotide sequence such as SEQ ID NO.3;

[0044] Preferably, (1-2) the C-terminus of the firefly luciferase gene comprises a 1336 base pair nucleotide sequence such as SEQ ID NO.4;

[0045] Preferably, (1-3) the two parts of the firefly luciferase coding sequence have an overlapping region of 871 base pairs, and the nucleotide sequence is as shown in SEQ ID NO.5;

[0046] Preferably, a DNA sequence containing multiple restriction endonuclease sites is inserted between the overlapping regions of 871 base pairs between the two parts of the firefly luciferase coding sequences (1-4), and the nucleotide sequence is as shown in SEQ ID NO.6;

[0047] Preferably, (1-5) connects the nucleic acid sequences of (1-4) together, adds CMV promoter and SC40 poly A, and constructs an SSA reporter vector T-CMV-SSA-luciferase-X, the nucleotide sequence of which is as shown in SEQ ID NO.1.

[0048] Further, step (2) comprises:

[0049] (2-1) designing a site-specific endonuclease target site and synthesizing a single-stranded oligonucleotide pair containing the target site;

[0050] (2-2) cloning the single-stranded oligonucleotide library obtained in step (2-1) into the vector T-CMV-SSA-luciferase obtained in step (1) to construct a gene knockout vector library T-CMV-SSA-luciferase-X;

[0051] Preferably, in step (2-1), the single-stranded oligonucleotide pair at the target site has the following rule: the single-stranded oligonucleotide pair comprises two single-stranded oligonucleotides, the first of which is 'CCGG(N) n ', the second one is 'AGCT(N) n ', where the two single-stranded oligonucleotides (N) n The first single-stranded oligonucleotide (N) is complementary. n is the site-specific endonuclease target site, N represents the base A, T, G or C, and n represents a number;

[0052] Preferably, in step (2-2), the single-stranded oligonucleotide library synthesized in step (2-1) is cloned into the SSA reporter system basic vector T-CMV-SSA-luciferase obtained in step (1) by using single-stranded oligonucleotide pair annealing technology and enzyme ligation technology to construct the SSA reporter vector T-CMV-SSA-luciferase-X;

[0053] Preferably, in step (3), the transfection method is liposome transfection, electroporation, etc. 48 hours after transfection, the relative luciferase activity (firefly luciferase activity / sea renilla luciferase activity) of the experimental group and the control group is measured using a dual luciferase activity detection kit according to the instructions, and the SSA repair efficiency of the experimental group and the control group can be obtained, and the endonuclease efficiency of the corresponding nuclease can be obtained at the same time;

[0054] Preferably, in step (3), the eukaryotic host cell comprises HEK293 cells (human embryonic kidney cells 293).

[0055] The present invention also provides a dual-luciferase-mediated SSA reporter system constructed by any of the above methods.

[0056] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0057] The beneficial effects of the present invention are:

[0058] At present, the commonly used SSA reporter system is mainly based on fluorescent protein reporter genes. The expression level of fluorescent protein in cells is different. Under different cell types or experimental conditions, the expression level of fluorescent protein may be inconsistent. Overexpression of fluorescent protein may interfere with the normal physiological function of cells. Quantitative detection of fluorescent protein requires expensive flow cytometers, which are complicated to operate. The present invention utilizes a dual luciferase-mediated SSA reporter system, characterizes SSA efficiency with mutant firefly luciferase, and uses sea renilla luciferase as an internal reference. It can be more convenient to detect SSA repair efficiency in a variety of eukaryotic organisms, and simultaneously obtain the endonuclease efficiency of the corresponding nuclease. The present invention utilizes a dual luciferase-mediated SSA reporter system, first constructs the SSA reporter system basic vector T-CMV-SSA-luciferase, and then integrates the target site of the site-specific nuclease into the vector T-CMV-SSA-luciferase, and constructs the SSA reporter vector T-CMV-SSA-luciferase-X.

[0059] The present invention screens out the small molecule inhibitor CP-724714 that inhibits the gene editing activity of the CRISPR system from a large number of small molecules based on the SSA reporter system. CP-724714 can inhibit the gene editing efficiency of the CRISPR system in mammalian cells. The CP-724714 inhibitor and its analogs can inhibit the gene editing efficiency of the CRISPR system in a spatiotemporal specific manner, have application value in reducing the off-target efficiency of the CRISPR system, and have important value for the safe application of the CRISPR system in the fields of medicine, agriculture, biotechnology, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0061] Figure 1 The structural formula is CP-724714.

[0062] Figure 2 It is a map of the vector T-CMV-SSA-luciferase, which contains: CMV, CMV promoter; firefly luciferase gene mutant; sv40 PA, sv40 polyA; Target site, site-specific nuclease targeting site.

[0063] Figure 3 Working principle of SSA repair for the firefly luciferase reporter vector.

[0064] Figure 4 Efficiency of the dual-luciferase-mediated SSA reporter system.

[0065] Figure 5 The figure is a flowchart of the screening.

[0066] Figure 6 Screening scatter plot for the first round.

[0067] Figure 7 Screening scatter plots for the second round.

[0068] Figure 8 CP-724714 inhibits the gene editing activity of the CRISPR system.

[0069] Fig. 9 High-throughput sequencing was used to verify that CP-724714 inhibited the gene editing activity of the CRISPR system. DETAILED DESCRIPTION

[0070] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0071] HEK 293FT (human embryonic kidney 293 cell line) used in this example is a cell line commonly used in biological experiments.

[0072] Example 1 Construction of dual luciferase-mediated SSA reporter system

[0073] The workflow of the dual-luciferase-mediated SSA reporter system is as follows: Figure 3 As shown, specifically:

[0074] 1. Construction of the basic vector T-CMV-SSA-luciferase of the SSA reporter system. The DNA sequence is shown in SEQ ID NO.1 and the vector map is shown in Figure 2 The specific steps include:

[0075] The firefly luciferase mutant gene driven by the CMV promoter is cloned into a T vector. The firefly luciferase coding sequence is divided into two parts, the first part N-terminal contains 1188 base pairs (as shown in SEQ ID NO.3) and has a stop codon at the end, and the second part C-terminal contains 1336 base pairs (as shown in SEQ ID NO.4). In addition, the two parts of the firefly luciferase coding sequence have an overlapping region of 871 base pairs (as shown in SEQ ID NO.5), and a DNA sequence containing multiple restriction endonuclease sites is inserted between the two overlapping regions (as shown in SEQ ID NO.6). The above nucleic acid sequences are connected together to obtain T-CMV-SSA-luciferase.

[0076] 2. Based on the working principle of site-specific endonuclease, a single-stranded oligonucleotide pair containing the target site of the site-specific endonuclease is designed and synthesized.

[0077] 1) According to the working principle of site-specific endonuclease and the basic vector of SSA reporter system T-CMV-SSA-luciferase, the single-stranded oligonucleotide pair of the site-specific endonuclease target site is designed according to the following rules: the single-stranded oligonucleotide pair contains two single-stranded oligonucleotides, the first one is 'CCGG(N) n ', the second one is 'AGCT(N) n ', where the two single-stranded oligonucleotides (N) n The first single-stranded oligonucleotide (N) is complementary. n It is the site-specific endonuclease target site, N represents the base A, T, G or C, and n represents a number.

[0078] 2) Synthesize single-stranded oligonucleotide pairs that target site-specific endonucleases.

[0079] 3. The single-stranded oligonucleotide pair of the site-specific endonuclease target site synthesized in step 2 was connected to the backbone vector described in step 1 to successfully construct the SSA reporter vector, named T-CMV-SSA-luciferase-X.

[0080] 4. Co-transfect HEK293FT with the SSA reporter vector T-CMV-SSA-luciferase-X, site-specific endonuclease expression vector Y and Renilla luciferase expression vector pRL-TK (nucleotide sequence as shown in SEQ ID NO.2) described in step 3. The specific technical scheme is as follows:

[0081] 1) Prepare HEK 293FT for experiments.

[0082] 2) HEK 293FT cells were evenly divided into two groups, one for the control group and the other for the experimental group, with 3 cells in each group.

[0083] 3) The cells were transfected with vector T-CMV-SSA-luciferase-X, nuclease expression vector Y and Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1:1 as the experimental group. The cells were transfected with vector T-CMV-SSA-luciferase-X and Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1 as the control group.

[0084] 5. 48 hours after transfection, the relative luciferase activity (firefly luciferase activity / sea renilla luciferase activity) of the experimental group and the control group was measured using the dual luciferase activity detection kit according to the instructions. The SSA repair efficiency of the experimental group and the control group can be obtained, and the endonuclease efficiency of the corresponding nuclease can be obtained at the same time. Figure 4 .

[0085] Example 2 Screening and application of CRISPR system inhibitor CP-724714

[0086] 1. Screening of CRISPR system inhibitor CP-724714.

[0087] (1) The dual-luciferase-mediated SSA reporter system constructed according to Example 1 can be used for high-throughput screening of CRISPR system promoters or inhibitors.

[0088] (2) The small molecule inhibitor CP-724714 that can inhibit the CRISPR system was found from 9930 small molecules through screening using the dual luciferase-mediated SSA reporter system described in Example 1.

[0089] The screening experiment was as follows: HEK 293FT cells were transfected with the dual luciferase-mediated SSA reporter system vector T-CMV-SSA-luciferase-B3 (the sequence of the target site B3 was GGAACACTACATGCTGCTTGAGG), the nuclease expression vector PX330-B3 (CRISPR system vector, the backbone was pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230, the sgRNA sequence was GGAACACTACATGCTGCTTG) and the Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1:1 as the experimental group. HEK 293FT cells were transfected with the vector T-CMV-SSA-luciferase-B3 and the Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1 as the control group. Six hours after transfection, the transfected cells were seeded into 96-well black plates (approximately 3,000 cells per well), and one compound was added to each well in advance (a total of 9930 small molecules, working concentration 10 μM). The CRISPR system will cut the DNA double helix of the SSA reporter gene vector at the target site and activate the DNA double-strand break (DSBs) repair pathway. Since the two sides of the DSBs overlap by about 871 bp, the DSBs will be repaired by single-strand annealing (SSA) and the firefly luciferase gene will be repaired. 48 hours after transfection, the dual luciferase (firefly luciferase and Renilla luciferase) activity was detected by the Promega GloMax-Multi instrument. In our platform, the genome editing efficiency of CRISPR / Cas9 is calculated based on the relative luciferase activity (relative luciferase activity = firefly luciferase activity / Renilla luciferase activity) ( Figure 5 ).

[0090] In the first round of screening, 9,930 small molecules were tested by our platform, and 640 compounds were screened as potential candidates that may affect the efficiency of CRISPR / Cas9 genome editing. Among them, 400 small molecules are potential inhibitors of the CRISPR system, while 240 small molecules are potential accelerators of the CRISPR system ( Figure 6 These 640 compounds were then screened in a second round using the same platform ( Figure 7 ) and finally screened out the small molecule inhibitor CP-724714 ( Figure 8 ).

[0091] 2. Verify the efficiency of CP-724714 in inhibiting the CRISPR system in eukaryotic cells.

[0092] (1) According to the working principle of CRISPR spCas9, the human genome targeting site FANCF was designed. The nucleotide sequence of the targeting site is as follows: FANCF target site, GGAATCCCTTCTGCAG CACCTGG.

[0093] (2) Construction of CRISPR gene editing vector: Using the pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene No. 42230) vector as the backbone, a CRISPR / Cas9 system gene editing vector of the target site described in step (1) above was constructed and named pX330-FANCF.

[0094] (3) The HEK 293FT cells were evenly divided into two parts and inoculated into the cell culture well plate, one well was the experimental group and the other well was the control group. The vector constructed in (2) was transfected into HEK 293FT by liposome transfection method. Two wells were transfected, one experimental group and one control group. Six hours after transfection, CP-724714 was added to the experimental group at a dose of 10 μM, and the control group was added with the corresponding solvent (Dimethyl sulfoxide, DMSO). 48 hours after transfection, the two groups of cells were collected and the genome was extracted. Primers were designed to amplify the sgRNA fragments of the two groups of cells, and high-throughput sequencing was used to analyze the effect of adding CP-724714 on the efficiency of CRISPR gene editing.

[0095] The two groups of cells transfected with pX330-FANCF were used to amplify the sgRNA fragment of FANCF. The primer sequences are as follows:

[0096] Amplification of sgRNA fragment primers of FANCF (CP-724714 added) in the experimental group

[0097] Forward primer, F-F7: 5- TAGGTTGCTTGG TCCCAGGTGCTGACGTAG

[0098] Reverse primer, F-R3:5- CGCAATGAGGG AGATGTTCCAATCAGTACGCAG

[0099] Primers for amplifying the sgRNA fragment of the control group FANCF (without CP-724714)

[0100] Forward primer, F-F8: 5- CAGGAACCAGGA TCCCAGGTGCTGACGTAG

[0101] Reverse primer, F-R8: 5- GGTGAGCAAGC AGATGTTCCAATCAGTACGCAG

[0102] The underlined part of the primer is the barcode used to distinguish different PCR products.

[0103] (4) High-throughput sequencing data were analyzed to compare the CRISPR gene editing efficiency after adding CP-724714 (the editing efficiency of the group without CP-724714 was 100%). The results are as follows: Fig. 9 As shown, the results showed that after adding CP-724714, the CRISPR gene editing efficiency was reduced to 93.0%, confirming that it has the effect of inhibiting the gene editing efficiency of the CRISPR system. Therefore, it can be used to inhibit the gene editing efficiency of the CRISPR system in a spatiotemporal specific manner, thereby reducing the off-target efficiency of the CRISPR system.

[0104] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Use of CP-724714, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof in any of the following: A1) Inhibit the gene editing efficiency of the CRISPR system in vitro and / or reduce the off-target rate of the CRISPR system; A2) preparing inhibitors of CRISPR system gene editing efficiency or reagents for reducing the off-target rate of CRISPR system; A3) preparing drugs that inhibit the gene editing efficiency of the CRISPR system and / or reduce the off-target rate of the CRISPR system; A4) Prepare reagents that inhibit the gene editing efficiency of the CRISPR system and / or reduce the off-target rate of the CRISPR system.

2. The use according to claim 1, characterized in that: The dose of CP-724714 was 10 μM.

3. A method for inhibiting the gene editing efficiency of the CRISPR system and / or reducing the off-target rate of the CRISPR system in vitro, characterized in that: Performing gene editing on cells in the presence of a gene editing inhibitor, wherein the gene editing inhibitor comprises compound CP-724714, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof; Preferably, the gene editing inhibitor is contacted with the gene-edited cell before, during and / or after the cell is gene-edited; Preferably, a nucleotide sequence encoding a Cas9 nuclease is introduced into the cell, wherein the Cas9 nuclease is capable of generating a double-strand break in the target DNA, thereby inducing gene editing of the target DNA; and the cell is cultured in the presence of a gene editing inhibitor.

4. The method according to claim 3, characterized in that The dose of CP-724714 was 10 μM.

5. A composition, characterized in that include: (i) a first agent, wherein the first agent is a gene editing inhibitor, wherein the gene editing inhibitor comprises CP-724714, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof; and (ii) a second reagent, wherein the second reagent is a reagent for CRISPR gene editing; Preferably, the second reagent comprises one or more of the following: B1) Cas9 nuclease, a coding sequence of Cas9 nuclease, or a vector expressing Cas9 nuclease, or a combination thereof; B2) tracrRNA and / or a vector for producing the tracrRNA; B3) crRNA and / or a vector for producing the crRNA; B4) a template for homology-directed repair, a single-stranded nucleotide sequence or a plasmid vector; More preferably, the target gene for CRISPR gene editing is selected from the group consisting of FANCF, RNF2 or a combination thereof.

6. The composition according to claim 5, characterized in that The dose of CP-724714 was 10 μM.

7. A method for constructing a dual luciferase-mediated SSA reporter system, characterized in that: The following steps are involved: (1) Construction of the basic vector of the SSA reporter system, named T-CMV-SSA-luciferase; (2) constructing the SSA reporter vector T-CMV-SSA-luciferase-X: first synthesizing a single-stranded oligonucleotide pair containing a site-specific nuclease target site, and then cloning it into the vector T-CMV-SSA-luciferase obtained in step (1) to successfully construct; (3) The vector T-CMV-SSA-luciferase-X, the nuclease expression vector Y and the sea renilla luciferase expression vector pRL-TK constructed in step (2) were transfected into cells at a molar ratio of 1:1:1, as the experimental group; the vector T-CMV-SSA-luciferase-X and the sea renilla luciferase expression vector pRL-TK were transfected into cells at a molar ratio of 1:1, as the control group. 48 hours after transfection, the relative luciferase activities of the experimental group and the control group were measured to obtain the SSA repair efficiency of the experimental group and the control group, and the nuclease endonuclease efficiency of the corresponding nuclease was obtained.

8. The method according to claim 7, characterized in that Step (1) comprises: cloning a firefly luciferase mutant gene driven by a CMV promoter into a T vector, wherein the firefly luciferase coding sequence is divided into two parts, the first part having an N-terminal portion containing 1188 base pairs and a termination codon at the end, and the second part having a C-terminal portion containing 1336 base pairs, and the two parts of the firefly luciferase coding sequence have an overlapping region of 871 base pairs, and a DNA sequence containing multiple restriction endonuclease sites is inserted between the two overlapping regions, named T-CMV-SSA-luciferase, and the nucleotide sequence thereof is shown in SEQ ID NO.1; Preferably, (1-1) the N-terminus of the firefly luciferase gene comprises a 1188 base pair nucleotide sequence such as SEQ ID NO.3; Preferably, (1-2) the C-terminus of the firefly luciferase gene comprises a 1336 base pair nucleotide sequence such as SEQ ID NO.4; Preferably, (1-3) the two parts of the firefly luciferase coding sequence have an overlapping region of 871 base pairs, and the nucleotide sequence is as shown in SEQ ID NO.5; Preferably, a DNA sequence containing multiple restriction endonuclease sites is inserted between the overlapping regions of 871 base pairs between the two parts of the firefly luciferase coding sequences (1-4), and the nucleotide sequence is as shown in SEQ ID NO.6; Preferably, (1-5) connects the nucleic acid sequences of (1-4) together, adds CMV promoter and SC40 poly A, and constructs an SSA reporter vector T-CMV-SSA-luciferase-X, the nucleotide sequence of which is as shown in SEQ ID NO.

1.

9. The method according to any one of claims 7-8, characterized in that: Step (2) comprises: (2-1) designing a site-specific endonuclease target site and synthesizing a single-stranded oligonucleotide pair containing the target site; (2-2) cloning the single-stranded oligonucleotide library obtained in step (2-1) into the vector T-CMV-SSA-luciferase obtained in step (1) to construct a gene knockout vector library T-CMV-SSA-luciferase-X; Preferably, in step (2-1), the single-stranded oligonucleotide pair at the target site has the following rules: the single-stranded oligonucleotide pair comprises two single-stranded oligonucleotides, the first of which is 'CCGG(N) n ', the second one is 'AGCT(N) n ', where the two single-stranded oligonucleotides (N) n The first single-stranded oligonucleotide (N) is complementary. n is the site-specific endonuclease target site, N represents the base A, T, G or C, and n represents a number; Preferably, in step (2-2), the single-stranded oligonucleotide library synthesized in step (2-1) is cloned into the SSA reporter system basic vector T-CMV-SSA-luciferase obtained in step (1) by using single-stranded oligonucleotide pair annealing technology and enzyme ligation technology to construct the SSA reporter vector T-CMV-SSA-luciferase-X; Preferably, in step (3), 48 hours after transfection, the relative luciferase activity of the experimental group and the control group is measured to obtain the SSA repair efficiency of the experimental group and the control group, and the endonuclease efficiency of the corresponding nuclease is obtained; Preferably, in step (3), the eukaryotic host cell comprises HEK293 cells (human embryonic kidney cells 293).

10. The dual luciferase-mediated SSA reporter system constructed by the method according to any one of claims 7 to 9.

Images