Screening and application of CRISPR (clustered regularly interspaced short palindromic repeats) system accelerant Clofarabine

Abstract

The invention relates to screening and application of a CRISPR (clustered regularly interspaced short palindromic repeats) system accelerant Clofarabine. According to the method, firstly, a dual-luciferase mediated SSA report system is constructed, the system is utilized for screening to obtain a small molecule Clofarabine for promoting the gene editing efficiency of the CRISPR system, it is further proved that the Clofarabine can promote the gene editing efficiency of the CRISPR system in mammalian cells, the gene editing efficiency of the CRISPR system in more cells can be improved, and the CRISPR system can be used for promoting the gene editing efficiency of the CRISPR system in mammalian cells. The CRISPR system has important industrial value in application of the CRISPR system in the fields of medical treatment, agriculture, biotechnology and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to the screening and application of a CRISPR system promoter Clofarabine. Background Art

[0002] The CRISPR gene editing system is a revolutionary gene editing technology. Its full name is "Clustered Regularly Interspaced Short Palindromic Repeats" (CRISPR). It was originally discovered in the bacterial immune system and was later modified by scientists to accurately edit the genomes of animals, plants and humans. The CRISPR system mainly consists of two parts: gRNA and Cas enzyme. Basic working principle: First, design a section of RNA complementary to the target gene sequence (usually called guide RNA, gRNA). This section of RNA will guide the Cas9 enzyme to accurately find and bind to a specific location on the DNA. Under the guidance of the guide RNA, the Cas9 enzyme recognizes and cuts the target DNA sequence to form a double-strand break. The cell will try to repair the break, and scientists can use this repair process to guide specific gene editing: the main repair method is non-homologous end joining (NHEJ), which often leads to insertion or deletion mutations in the gene sequence, thereby inactivating the gene, thereby achieving gene editing. Compared with other gene editing systems, the CRISPR system has outstanding advantages: one is high efficiency and precision. Compared with traditional gene editing methods (such as ZFN, TALEN, etc.), CRISPR technology is simple to operate, low cost, and can accurately target and edit specific genes. The second is flexibility: it can edit multiple genes at the same time (multi-gene editing) to achieve more complex gene operations. The CRISPR system is widely used. In the field of medical research and treatment: CRISPR is used for gene mutation research, gene function analysis, and gene therapy (such as treatment of genetic diseases, cancer immunotherapy, etc.). For example, CRISPR technology has been used in experiments to treat genetic diseases such as sickle cell anemia. In the field of agriculture: CRISPR can be used for crop improvement, enhance resistance to pests and diseases, and resistance to adversity, increase yield and nutritional value. By accurately editing crop genes, the transmission of heterozygous genes that may occur in traditional breeding methods can be reduced. In the field of basic biological research: CRISPR is widely used to establish gene knockout or gene overexpression mouse models and cell models to study the function of genes and their role in diseases. However, the application of CRISPR gene editing system also has some challenges and problems: including ethical issues, legal issues, off-target effects and low editing efficiency, among which low editing efficiency is the most important technical issue affecting the application of CRISPR.

[0003] In some cell types, the editing efficiency of CRISPR / Cas9 is low. In particular, in some cell types that are difficult to transfect or transduce, the expression of Cas9 protein is insufficient, resulting in a lower success rate of gene editing. For example, in some primary cells, stem cells or certain tissues of mammals, Cas9 protein is not fully expressed or difficult to enter the nucleus, limiting its gene editing effect. In order to improve the editing efficiency of CRISPR / Cas9, there are currently a variety of optimization strategies, mainly including the following: 1. Optimization of Cas9 protein: By modifying the structural domain of Cas9 protein and enhancing its DNA recognition and cutting activity, a variety of improved Cas9 proteins (such as eSpCas9, HF-Cas9, etc.) have been developed. These proteins can reduce off-target effects while ensuring efficient cutting. 2. Optimization of gRNA: Researchers have improved the editing efficiency of the system by optimizing the design of gRNA, such as increasing the stability of gRNA and changing the binding affinity of gRNA to Cas9 protein. In addition, the study also explored the use of chemically modified gRNA, such as using 2'-O-methylated gRNA to enhance its stability and function. 3. Innovation in delivery technology: In order to solve the problem of Cas9 protein and gRNA delivery, researchers have proposed a variety of delivery vectors, such as viral vectors, liposomes and nanoparticles, which can effectively deliver CRISPR components to target cells. Although there are some methods in the existing technology to optimize the CRISPR system, there are still many problems that need to be solved. Summary of the invention

[0004] Small molecules have many advantages as promoters of CRISPR systems. In order to screen small molecules that promote CRISPR systems with high throughput, the present invention designs and constructs a dual-luciferase-mediated SSA reporter system. DNA double-strand breaks (DSBs) damage is a fatal damage to cells. Cells have evolved a series of DNA double-strand break damage repair methods, including non-homologous end joining repair (NHEJ), homologous recombination repair (HR), single strand annealing repair (SSA), etc. Among them, when there are long repetitive sequences at both ends of the DNA double-strand break damage point, the long repetitive sequences at both ends of the double-strand break point can be repaired by single-strand annealing through the single-strand repair (SSA) pathway. Combining site-specific nuclease and SSA repair mechanism, constructing an SSA reporter system can detect the SSA repair efficiency of cells and the enzymatic activity of site-specific nuclease. The dual-luciferase reporter gene detection system is a reporter system that uses luciferin as a substrate to detect the activity of luciferase. It includes two luciferases: Firefly Luciferase and Renilla luciferase. Using Renilla luciferase as an internal reference can eliminate interfering factors such as cell number, status, transfection efficiency, etc. between different groups. The test results are more accurate. Therefore, the dual-luciferase-mediated SSA reporter system has broad development and application prospects.

[0005] The present invention uses a dual-luciferase-mediated SSA reporter system high-throughput screening to find a small molecule compound Clofarabine that can promote CRISPR, which can improve the gene editing efficiency of the CRISPR system. Through the technology of the present invention, the wide application of CRISPR technology in the fields of medicine, agriculture, basic research, etc. can be further promoted, especially in clinical gene therapy and large-scale agricultural improvement. It has important application potential.

[0006] The structural formula of Clofarabine is Figure 1 As shown, the chemical formula is C 10 H 11 CIF 5 O 3, CAS number is 123318-82-1, and Clofarabine’s alias is (2R,3R,4S,5R)-5-(6-amino-2-chloropurin-9-yl)-4-fluoro-2-(hydroxymethyl)oxolan-3-ol,2-chloro-2′-arabino-fluoro-2′-deoxyadenosine.

[0007] The present invention provides the use of Clofarabine, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof in any of the following:

[0008] A1) Promote the gene editing efficiency of CRISPR system in vitro;

[0009] A2) preparing a CRISPR system gene editing efficiency enhancer;

[0010] A3) Preparation of drugs to enhance the efficiency of gene editing in the CRISPR system;

[0011] A4) Prepare reagents to improve the gene editing efficiency of the CRISPR system.

[0012] It is further noted that the dosage of Clofarabine is 10 μM.

[0013] The present invention also provides a method for promoting the gene editing efficiency of the CRISPR system in vitro, wherein cells are gene-edited in the presence of a gene editing promoter, thereby promoting gene editing in the cells, wherein the gene editing promoter is the compound Clofarabine, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof.

[0014] Furthermore, the method is non-diagnostic and non-therapeutic.

[0015] Furthermore, before, during and / or after gene editing of the cells, the gene editing promoter is contacted with the gene-edited cells.

[0016] Furthermore, the dosage of Clofarabine is 10 μM.

[0017] Furthermore, a nucleotide sequence encoding a Cas9 nuclease is introduced into the cell, wherein the Cas9 nuclease is capable of producing double-strand breaks in the target DNA, thereby inducing gene editing of the target DNA; and the cell is cultured in the presence of a gene editing promoter.

[0018] The present invention also provides a composition comprising:

[0019] (i) a first agent, wherein the first agent is a gene editing accelerator, and the gene editing accelerator is Clofarabine, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof; and

[0020] (ii) a second reagent, wherein the second reagent is a reagent for CRISPR gene editing;

[0021] Furthermore, the second reagent includes one or more of the following:

[0022] B1) Cas9 nuclease, a coding sequence of Cas9 nuclease, or a vector expressing Cas9 nuclease, or a combination thereof;

[0023] B2) tracrRNA and / or a vector for producing the tracrRNA;

[0024] B3) crRNA and / or a vector for producing the crRNA;

[0025] B4) Template for homology-directed repair, single-stranded nucleotide sequence or plasmid vector.

[0026] Furthermore, the target gene for CRISPR gene editing is selected from the following group: FANCF, VEGFA, RNF2 or a combination thereof.

[0027] Furthermore, the dosage of Clofarabine is 10 μM.

[0028] In another preferred embodiment, the CRISPR system gene editing includes type II CRISPR system gene editing and gene editing based on the CRISPR-Cas9 system;

[0029] In another preferred embodiment, the gene editing includes in vivo gene editing, in vitro gene editing, or a combination thereof;

[0030] In another preferred embodiment, the sample targeted by the gene editing is selected from the following group: cells, tissues, organs, or a combination thereof;

[0031] In another preferred embodiment, the sample is from animals, plants, microorganisms (including bacteria and viruses);

[0032] In another preferred embodiment, the sample is from a human or a non-human mammal;

[0033] In another preferred embodiment, the cells include primary cells and passaged cells;

[0034] In another preferred embodiment, the cells include somatic cells, germ cells, and stem cells;

[0035] In another preferred embodiment, the stem cells include: totipotent stem cells, pluripotent stem cells, and multipotent stem cells;

[0036] In another preferred embodiment, the stem cells are induced pluripotent stem cells (hiPSC);

[0037] In another preferred embodiment, the cells include: embryonic stem cells, adipose stem cells, hematopoietic stem cells, immune cells (such as T cells, NK cells);

[0038] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0039] The beneficial effects of the present invention are:

[0040] The present invention utilizes a dual luciferase-mediated SSA reporter system, first constructs an SSA reporter system basic vector T-CMV-SSA-luciferase, and then integrates a target site of a site-specific nuclease into the vector T-CMV-SSA-luciferase to construct an SSA reporter vector T-CMV-SSA-luciferase-X.

[0041] The currently commonly used SSA reporter system is mainly based on fluorescent protein reporter genes. The expression level of fluorescent protein in cells varies. The expression level of fluorescent protein may be inconsistent under different cell types or experimental conditions. Overexpression of fluorescent protein may interfere with the normal physiological function of cells. Quantitative detection of fluorescent protein requires expensive flow cytometers, which are complicated to operate. The present invention utilizes a dual-luciferase-mediated SSA reporter system, characterizes the SSA efficiency with mutant firefly luciferase, and uses sea renilla luciferase as an internal reference. It can be more convenient to detect the SSA repair efficiency in a variety of eukaryotic organisms, and simultaneously obtain the endonuclease efficiency of the corresponding nuclease.

[0042] The present invention further screened and obtained Clofarabine, a small molecule promoter that promotes the gene editing activity of the CRISPR system. Clofarabine can promote the gene editing efficiency of the CRISPR system in mammalian cells. Clofarabine promoter and its analogs can promote the gene editing efficiency of the CRISPR system, can improve the gene editing efficiency of the CRISPR system in more cells, and have important value for the safe application of the CRISPR system in the fields of medicine, agriculture, biotechnology, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0044] Figure 1 This is the structural formula of Clofarabine.

[0045] Figure 2 It is a map of the vector T-CMV-SSA-luciferase, which contains: CMV, CMV promoter; firefly luciferase gene mutant; sv40 PA, sv40 polyA; Target site, site-specific nuclease targeting site.

[0046] Figure 3 Working principle of SSA repair for the firefly luciferase reporter vector.

[0047] Figure 4 Efficiency of the dual-luciferase-mediated SSA reporter system.

[0048] Figure 5 The figure is a flowchart of the screening.

[0049] Figure 6 Screening scatter plot for the first round.

[0050] Figure 7 Screening scatter plots for the second round.

[0051] Figure 8 Clofarabine improves the efficiency of gene editing by the CRISPR system.

[0052] Fig. 9 Clofarabine was used for high-throughput sequencing to verify the efficiency of CRISPR system gene editing. DETAILED DESCRIPTION

[0053] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0054] HEK 293FT (human embryonic kidney 293 cell line) used in this example is a cell line commonly used in biological experiments.

[0055] Example 1 Construction of dual luciferase-mediated SSA reporter system

[0056] The workflow of the dual-luciferase-mediated SSA reporter system is as follows: Figure 3 shown.

[0057] 1. Construction of the basic vector T-CMV-SSA-luciferase of the SSA reporter system. The DNA sequence is shown in SEQ ID NO.1 and the vector map is shown in Figure 2 The specific method is as follows:

[0058] The firefly luciferase mutant gene driven by the CMV promoter is cloned into a T vector. The firefly luciferase coding sequence is divided into two parts, the first part N-terminal contains 1188 base pairs (as shown in SEQ ID NO.3) and has a stop codon at the end, and the second part C-terminal contains 1336 base pairs (as shown in SEQ ID NO.4). In addition, the two parts of the firefly luciferase coding sequence have an overlapping region of 871 base pairs (as shown in SEQ ID NO.5), and a DNA sequence containing multiple restriction endonuclease sites is inserted between the two overlapping regions (as shown in SEQ ID NO.6). The above nucleic acid sequences are connected together to obtain T-CMV-SSA-luciferase.

[0059] 2. Based on the working principle of site-specific endonuclease, a single-stranded oligonucleotide pair containing the target site of the site-specific endonuclease is designed and synthesized.

[0060] 1) According to the working principle of site-specific endonuclease and the basic vector of SSA reporter system T-CMV-SSA-luciferase, the single-stranded oligonucleotide pair of the site-specific endonuclease target site is designed according to the following rules: the single-stranded oligonucleotide pair contains two single-stranded oligonucleotides, the first one is 'CCGG(N) n ', the second one is 'AGCT(N) n ', where the two single-stranded oligonucleotides (N) n The first single-stranded oligonucleotide (N) is complementary. n It is the site-specific endonuclease target site, N represents the base A, T, G or C, and n represents a number.

[0061] 2) Synthesize single-stranded oligonucleotide pairs that target site-specific endonucleases.

[0062] 3. The single-stranded oligonucleotide pair of the site-specific endonuclease target site synthesized in step 2 was connected to the backbone vector described in step 1 to successfully construct the SSA reporter vector, named T-CMV-SSA-luciferase-X.

[0063] 4. Co-transfect HEK293FT (such as liposome transfection, electroporation, etc.) with the SSA reporter vector T-CMV-SSA-luciferase-X, site-specific endonuclease expression vector Y and Renilla luciferase expression vector pRL-TK (nucleotide sequence as shown in SEQ ID NO.2) described in step 3. The specific technical scheme is as follows:

[0064] 1) Prepare HEK 293FT for experiments.

[0065] 2) HEK 293FT cells were evenly divided into two groups, one for the control group and the other for the experimental group, with 3 cells in each group.

[0066] 3) The cells were transfected with vector T-CMV-SSA-luciferase-X, nuclease expression vector Y and Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1:1 as the experimental group. The cells were transfected with vector T-CMV-SSA-luciferase-X and Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1 as the control group.

[0067] 5. 48 hours after transfection, the relative luciferase activity (firefly luciferase activity / sea renilla luciferase activity) of the experimental group and the control group was measured using the dual luciferase activity detection kit according to the instructions. The SSA repair efficiency of the experimental group and the control group can be obtained, and the endonuclease efficiency of the corresponding nuclease can be obtained at the same time. Figure 4 .

[0068] Example 2 Screening and application of CRISPR system promoter Clofarabine

[0069] 1. Screening of Clofarabine, a CRISPR system promoter.

[0070] (1) The dual-luciferase-mediated SSA reporter system constructed according to Example 1 was used for high-throughput screening of CRISPR system promoters or inhibitors.

[0071] (2) From 9930 small molecules, the dual luciferase-mediated SSA reporter system described in Example 1 was used to screen and find the small molecule Clofarabine that can promote the CRISPR system. Its structural formula is as follows: Figure 1 shown.

[0072] The screening experiment was as follows: HEK 293FT cells were transfected with the dual luciferase-mediated SSA reporter system vector T-CMV-SSA-luciferase-B3 (the sequence of the target site B3 was GGAACACTACATGCTGCTTGAGG), the nuclease expression vector PX330-B3 (CRISPR system vector, the backbone was pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230, the sgRNA sequence was GGAACACTACATGCTGCTTG) and the Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1:1 as the experimental group. HEK 293FT cells were transfected with the vector T-CMV-SSA-luciferase-B3 and the Renilla luciferase expression vector pRL-TK at a molar ratio of 1:1 as the control group. Six hours after transfection, the transfected cells were seeded into 96-well black plates (approximately 3,000 cells per well), and one compound was added to each well in advance (a total of 9930 small molecules, working concentration 10 μM). The CRISPR system will cut the DNA double helix of the SSA reporter gene vector at the target site and activate the DNA double-strand break (DSBs) repair pathway. Since the two sides of the DSBs overlap by about 871 bp, the DSBs will be repaired by single-strand annealing (SSA) and the firefly luciferase gene will be repaired. 48 hours after transfection, the dual luciferase (firefly luciferase and Renilla luciferase) activity was detected by the Promega GloMax-Multi instrument. In our platform, the genome editing efficiency of CRISPR / Cas9 is calculated based on the relative luciferase activity (relative luciferase activity = firefly luciferase activity / Renilla luciferase activity) ( Figure 5 ).

[0073] In the first round of screening, 9,930 small molecules were tested by the platform, and 640 compounds were screened as potential candidates that may affect the efficiency of CRISPR / Cas9 genome editing. Among them, 400 small molecules are potential inhibitors of the CRISPR system, while 240 small molecules are potential accelerators of the CRISPR system ( Figure 6 These 640 compounds were then screened in a second round using the same platform ( Figure 7 ), and finally screened out Clofarabine ( Figure 8 ).

[0074] 2. Verify the efficiency of Clofarabine in promoting the CRISPR system in eukaryotic cells.

[0075] (1) According to the working principle of spCas9, the VEGFA site of the human genome was designed to target the target site. The nucleotide sequence of the target site is as follows: VEGFA target site, GTCATCTTAGTCATTACCTGAGG.

[0076] (2) Construction of CRISPR gene editing vector: Using the pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene No. 42230) vector as the backbone, a CRISPR / Cas9 system gene editing vector of the target site described in step (1) above was constructed and named pX330-VEGFA.

[0077] (3) The HEK 293FT cells were evenly divided into two parts and inoculated into the cell culture well plate, one well was the experimental group and the other well was the control group. The vector constructed in (2) was transfected into HEK 293FT by liposome transfection method, one experimental group and one control group. Six hours after transfection, Clofarabine was added to the experimental group, 10 μM, and the control group was added with the corresponding solvent (Dimethylsulfoxide, DMSO). 48 hours after transfection, the six groups of cells were collected and the genome was extracted. Primers were designed to amplify the sgRNA fragments of the two groups of cells, and high-throughput sequencing was used to analyze the effect of adding Clofarabine on the efficiency of CRISPR gene editing.

[0078] The two groups of cells transfected with pX330-VEGFA were used to amplify the sgRNA fragment of VEGFA. The primer sequences are as follows:

[0079] Primers for sgRNA fragments of VEGFA (with Clofarabine added) in the amplification experimental group

[0080] Forward primer, VV-F5:5- GGTTTGCACATG CAGCCCCAGCTACCACC

[0081] Reverse primer, VV-R7:5- AGTTCATACGGC TCCTCCGAAGCGAGAACA

[0082] Primers for amplifying the sgRNA fragment of the control group VEGFA (without Clofarabine)

[0083] Forward primer, VV-F8:5- CAGGAACCAGGA CAGCCCCAGCTACCACC

[0084] Reverse primer, VV-R8:5- GGTGAGCAAGCA TCCTCCGAAGCGAGAACA

[0085] The underlined part of the primer is the barcode used to distinguish different PCR products.

[0086] (4) High-throughput sequencing data were analyzed to compare the gene editing efficiency of the CRISPR system after the addition of Clofarabine (the editing efficiency of the group without Clofarabine was 100%). The results are as follows: Fig. 9 As shown, the results showed that the gene editing efficiency of the CRISPR system increased to 214.4% after the addition of Clofarabine, confirming that it has the effect of promoting the gene editing efficiency of the CRISPR system.

[0087] That is, the present invention screened and verified that Clofarabine can promote the gene editing efficiency of the CRISPR system. Therefore, Clofarabine promoter and its analogs can be used to promote the gene editing efficiency of the CRISPR system, which is of great value to the application of the CRISPR system in multiple fields such as medicine, agriculture, and biotechnology.

[0088] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Use of Clofarabine, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof in any of the following: A1) Promote the gene editing efficiency of CRISPR system in vitro; A2) preparing a CRISPR system gene editing efficiency enhancer; A3) Preparation of drugs to enhance the efficiency of gene editing in the CRISPR system; A4) Prepare reagents to improve the gene editing efficiency of the CRISPR system.

2. The use according to claim 1, characterized in that: The dose of Clofarabine was 10 μM.

3. A method for promoting the gene editing efficiency of the CRISPR system in vitro, characterized in that: In the presence of a gene editing promoter, gene editing is performed on cells to promote gene editing in the cells, wherein the gene editing promoter is the compound Clofarabine, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof.

4. The method according to claim 3 is characterized in that the gene editing promoter is contacted with the gene-edited cells before, during and / or after the cells are gene-edited.

5. The method according to any one of claims 3-4, characterized in that: Introducing a nucleotide sequence encoding a Cas9 nuclease into a cell, wherein the Cas9 nuclease is capable of generating a double-strand break in a target DNA, thereby inducing gene editing of the target DNA; and culturing the cell in the presence of a gene editing promoter.

6. The method according to any one of claims 3-4, characterized in that: The dose of Clofarabine was 10 μM.

7. A composition, characterized in that include: (i) a first agent, wherein the first agent is a gene editing accelerator, and the gene editing accelerator is Clofarabine, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemate thereof, or a solvate thereof; and (ii) a second reagent, wherein the second reagent is a reagent for CRISPR gene editing.

8. The composition according to claim 7, characterized in that The second reagent includes one or more of the following: B1) Cas9 nuclease, a coding sequence of Cas9 nuclease, or a vector expressing Cas9 nuclease, or a combination thereof; B2) tracrRNA and / or a vector for producing the tracrRNA; B3) crRNA and / or a vector for producing the crRNA; B4) Template for homology-directed repair, single-stranded nucleotide sequence or plasmid vector.

9. The composition according to claim 8, characterized in that The target gene for CRISPR gene editing is selected from the group consisting of FANCF, VEGFA, RNF2 or a combination thereof.

10. The composition according to any one of claims 7 to 9, characterized in that The dose of Clofarabine was 10 μM.

Images