Preparation method and application of KIT gene modified non-human animal

Abstract

The invention relates to a genetically modified non-human animal, in particular to a genetically modified non-human animal expressing a mutated KIT protein. The invention further provides a preparation method of the non-human animal and application of the non-human animal in the field of biological medicine.

Description

Technical Field

[0001] The present application relates to genetically modified non-human animals, preparation methods and applications, and specifically, to genetically modified non-human animals expressing a mutated KIT protein, preparation methods and applications in the biomedical field. Background Art

[0002] Experimental animal disease models are indispensable research tools for studying the causes and pathogenesis of human diseases, developing prevention and treatment technologies, and developing drugs. Among them, immunodeficient animals are easily receptive to xenogeneic cells or tissues due to their lack of immunity, and have been widely used in tissue or cell animal research, tumor drugs, and the treatment mechanism of other diseases. Studies have shown that as recipient mice, the commonly used immunodeficient animals are ranked as follows: NOD-Prkdc scid IL-2rγ nul Mouse>NOD-Rag 1 - / - -IL2rg - / - (NRG)〉Rag 2 - / - -IL2rg - / - (RG)〉NOD / scid〉nude mice showed that NOD-Prkdc scid IL-2rγ nul Mice are currently the best transplant recipient mice (Ito R et al. Cell Mol Immunol. 2012 May; 9(3): 208-14).

[0003] However, NOD-Prkdc scid IL-2rγ null The mouse still has defects, although due to the severe reduction of the immune function of the mouse body, it has almost no rejection reaction to human cells and tissues, a small number of cells can form tumors (depending on the cell line or cell type), and there is no leakage of B lymphocytes. It is the most suitable tool mouse for human cell or tissue transplantation and has been widely used in the development of new animal models. However, irradiation myeloablation is required before the immune system is reconstructed. This procedure requires a radiation source and will produce a variety of side effects on mice, including necrosis and apoptosis of the hematopoietic system, gastrointestinal tract, muscle and nervous tissue, which can cause mice to become emaciated, infected or even die, thus affecting the results of drug efficacy evaluation. If the mouse host hematopoietic stem cells are missing, irradiation myeloablation can be avoided, which will improve the effect of drug efficacy evaluation while reducing modeling time and cost.

[0004] KIT and its ligand SCF participate in the conduction of multiple cell signals, such as the Jak / STAT signaling pathway, the PL3K pathway, the Ras / Raf / MEK / ERK signaling pathway, etc., thus playing an important role in melanogenesis, gametogenesis, and the survival, proliferation, and differentiation of hematopoietic system cells. The KIT / SCF signaling pathway is regulated by KIT. KIT gene mutations can cause various phenotypic characteristics in a variety of organisms, including albinism, anemia, homozygous death, hearing loss, etc. These phenotypes can be attributed to the proliferation or migration loss of the corresponding stem cell population during development, and different KIT mutants have different effects on cell differentiation. In mice, when KIT mutations are homozygous, they often have lethal or semi-lethal effects on mice. Studies have shown that KIT mutations can affect the development of host hematopoietic stem cells and produce varying degrees of anemia. Therefore, KIT is essential for normal hematopoiesis in the blood system.

[0005] Since immunodeficient model animals are important tools and guarantees for clinical tumor treatment research, in addition to being used for human cell transplantation and growth, they can also be used in combination with mice carrying various cytokine genes for the development of new animal models and drug efficacy testing applications. Summary of the invention

[0006] The present invention aims to overcome the deficiencies in the prior art and provide a mouse with a KIT gene mutation associated with hematopoietic stem cells in mouse cells. The mouse has a single genetic background, stable and reliable experimental results, and can perform human hematopoietic stem cell immune system reconstruction without irradiation and myeloablation.

[0007] In a first aspect, the present invention provides a KIT gene-modified non-human animal or a method for preparing the same, wherein the non-human animal expresses a mutated KIT protein.

[0008] Preferably, the genome of the non-human animal comprises a nucleotide sequence encoding a mutated KIT protein.

[0009] Further preferably, the nucleotide sequence encoding the mutated KIT protein may be a cDNA, CDS or genomic DNA sequence.

[0010] The mutant KIT protein comprises one or more amino acid mutations introduced into the intracellular region of the non-human animal KIT protein.

[0011] Preferably, the mutated KIT protein affects downstream signal transduction.

[0012] The downstream signal transduction includes the transduction of multiple cell signals in which KIT and its ligand SCF participate together, such as the Jak / STAT signaling pathway, the PL3K pathway, the Ras / Raf / MEK / ERK signaling pathway, etc. It plays an important role in the processes of melanogenesis, gametogenesis, and the survival, proliferation, and differentiation of hematopoietic system cells.

[0013] Further preferably, the proliferation and differentiation of hematopoietic stem cells in the non-human animal are inhibited.

[0014] More preferably, the non-human animal lacks hematopoietic stem cells.

[0015] The hematopoietic stem cells described in the present invention are derived from peripheral blood, bone marrow, umbilical cord blood or placenta. Preferably, the hematopoietic stem cells are derived from bone marrow.

[0016] Preferably, the mutated KIT protein comprises an extracellular region, a transmembrane region, a signal peptide and an intracellular region, wherein the intracellular region comprises one or more amino acid mutations.

[0017] Preferably, the mutated KIT protein comprises an endogenous extracellular region, an endogenous transmembrane region, an endogenous signal peptide and a mutated intracellular region.

[0018] Preferably, the mutant KIT protein comprises an amino acid sequence in which the amino acid at position 831 of SEQ ID NO: 10 is mutated, preferably comprising a mutation of valine (V) to methionine (M) at position 831 of SEQ ID NO: 10. In a specific embodiment of the present invention, the mutant KIT protein comprises a mutation from G to A at position 75813222 of NCBI accession number NC_000071.7.

[0019] In a specific embodiment of the present invention, the mutated KIT protein is V831M.

[0020] In a specific embodiment of the present invention, the mutated KIT protein is selected from one of the following groups:

[0021] (A) all or part of the amino acid sequence shown in SEQ ID NO: 2;

[0022] (B) has a degree of identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:10;

[0023] (C) the nucleic acid sequence encoding the mutant KIT protein hybridizes with the nucleotide sequence encoding the protein shown in SEQ ID NO: 2 under stringent conditions;

[0024] (D) differs from the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or,

[0025] (E) having the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 10, including substitution, deletion and / or insertion of one or more amino acid residues.

[0026] Preferably, the KIT gene sequence encoding the mutated KIT protein comprises one or more mutations introduced into exon 18 of the non-human animal KIT gene, preferably comprising a mutation at position 2552 of NM_021099.3.

[0027] More preferably, position 2552 of NM_021099.3 is mutated from G to A.

[0028] In a specific embodiment of the present invention, the mRNA transcribed from the KIT gene sequence encoding the mutated KIT protein is selected from one of the following groups:

[0029] (a) encoding the above-mentioned mutant KIT protein;

[0030] (b) part or all of the sequence shown in SEQ ID NO: 1;

[0031] (c) a degree of identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to the nucleotide sequence set forth in SEQ ID NO: 1;

[0032] (d) hybridizes to the nucleotide sequence shown in SEQ ID NO: 1 under stringent conditions;

[0033] (e) differs from the nucleotide sequence of SEQ ID NO: 1 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; or,

[0034] (f) having the nucleotide sequence shown in SEQ ID NO: 1, including substitution, deletion and / or insertion of one or more nucleotides.

[0035] Wherein, the KIT gene encoding the mutated KIT protein is homozygous or heterozygous.

[0036] Preferably, the KIT gene encoding the mutated KIT protein further comprises a specific inducer or repressor. Further preferably, the specific inducer or repressor may be a conventional substance that can be induced or repressed. In a specific embodiment of the present invention, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0037] Preferably, in the KIT gene-modified non-human animal, at least one chromosome contains the KIT gene encoding the mutated KIT protein.

[0038] Preferably, in the KIT gene-modified non-human animal, at least one cell expresses a mutated KIT protein.

[0039] In a second aspect of the present invention, a method for preparing a KIT gene-modified non-human animal is provided, comprising replacing a nucleotide sequence encoding an endogenous KIT region at an endogenous KIT locus of a non-human animal with a nucleotide sequence of a KIT corresponding region containing a coding mutation. Alternatively, the method comprises replacing a nucleotide sequence encoding an endogenous KIT region at an endogenous KIT locus of a non-human animal with a nucleotide sequence of a KIT corresponding region containing a coding mutation.

[0040] Preferably, the mutated KIT corresponding region is at least 10, 100, 105, 106, 107, 110, 200, 300, 400, 500, 600, 700, 800, 900 or 975 consecutive amino acid sequences including the amino acid mutation at position 831 (preferably V831M) of SEQ ID NO: 10. Further preferably, it is the intracellular region including the amino acid mutation at position 831 (preferably V831M) of SEQ ID NO: 10.

[0041] In a specific embodiment of the present invention, the mutated KIT corresponding region includes SEQ ID NO: 2 or positions 827-932 thereof, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 2 or positions 827-932 thereof.

[0042] Preferably, the replaced endogenous KIT region includes at least 10, 100, 105, 106, 107, 110, 200, 300, 400, 500, 600, 700, 800, 900 or 975 consecutive amino acid sequences of position 831 of SEQ ID NO: 10. Further preferably, it includes the intracellular region of SEQ ID NO: 10.

[0043] In a specific embodiment of the present invention, the endogenous KIT region that is replaced includes SEQ ID NO: 10 or positions 827-932 thereof, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 10 or positions 827-932 thereof.

[0044] In a specific embodiment of the present invention, the preparation method comprises replacing the nucleotide sequence encoding the amino acid sequence shown at positions 827-932 of SEQ ID NO: 10 at the endogenous KIT locus of a non-human animal with a nucleotide sequence encoding the amino acid sequence shown at positions 827-932 of SEQ ID NO: 2.

[0045] In a specific embodiment of the present invention, the preparation method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 10 with a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 at the endogenous KIT locus of a non-human animal.

[0046] In a specific embodiment of the present invention, the preparation method comprises replacing the nucleotide sequence encoding the intracellular region at the endogenous KIT locus of a non-human animal with a nucleotide sequence encoding the amino acid sequence shown at positions 827-932 of SEQ ID NO: 2.

[0047] The nucleotide sequence comprising the KIT corresponding region encoding the mutation may be a cDNA, CDS or genomic DNA sequence.

[0048] The nucleotide sequence of the KIT corresponding region comprising the coding mutation comprises exon 18. Preferably, the nucleotide sequence of the KIT corresponding region comprising the coding mutation comprises all of exons 18 to 20. It is further preferred that the nucleotide sequence further comprises at least 100 bp (e.g., at least 100, 200, 300, 400, 466, 500, 600, 700, 800, 900) of consecutive nucleotides of introns 17 to 18 and / or at least 100 bp (e.g., at least 100, 200, 300, 400, 500, 600, 645, 700, 800, 900) of consecutive nucleotides of introns 20 to 21.

[0049] In a specific embodiment of the present invention, the nucleotide sequence of the KIT corresponding region comprising the mutation comprises SEQ ID NO: 3, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 3.

[0050] The nucleotide sequence encoding the endogenous KIT region to be replaced comprises exon 18. Preferably, the nucleotide sequence encoding the endogenous KIT region to be replaced comprises all of exons 18 to 20. It is further preferred that it further comprises at least 100 bp (e.g., at least 100, 200, 300, 400, 466, 500, 600, 700, 800, 900) of consecutive nucleotides in introns 17 to 18 and / or at least 100 bp (e.g., at least 100, 200, 300, 400, 500, 600, 645, 700, 800, 900) of consecutive nucleotides in introns 20 to 21.

[0051] In a specific embodiment of the present invention, the nucleotide sequence encoding the endogenous KIT region that is replaced comprises the nucleotide sequence at positions 2540-2857 with NCBI accession number NM_021099.3.

[0052] In a specific embodiment of the present invention, at the endogenous KIT locus of the non-human animal, the nucleotide sequence comprising SEQ ID NO: 3 is used to replace the corresponding endogenous region of the non-human animal.

[0053] In a specific embodiment of the present invention, at the endogenous KIT locus of the non-human animal, the endogenous exons 18-20 of the non-human animal are replaced with a nucleotide sequence comprising SEQ ID NO: 3.

[0054] In a specific embodiment of the present invention, at the endogenous KIT locus of the non-human animal, the nucleotide sequence comprising SEQ ID NO: 3 is used to replace at least 100 bp of continuous nucleotides in endogenous exons 18-20 and introns 17-18 and at least 100 bp of continuous nucleotides in introns 20-21 of the non-human animal.

[0055] In a specific embodiment of the present invention, at the endogenous KIT locus of the non-human animal, the nucleotide sequence at positions 2540-2857 of the endogenous non-human animal comprising NCBI accession number NM_021099.3 is replaced with a nucleotide sequence comprising SEQ ID NO: 3.

[0056] In a specific embodiment of the present invention, at the endogenous KIT locus of a non-human animal, the nucleotide sequence comprising SEQ ID NO: 3 is used to replace the nucleotide sequence at positions 75812744 to 75814630 of the endogenous non-human animal comprising NCBI accession number NC_000071.7.

[0057] In a specific embodiment of the present invention, at the endogenous KIT locus of a non-human animal, the corresponding endogenous region of the non-human animal is replaced with a nucleotide sequence comprising SEQ ID NO: 1 or a nucleotide sequence encoding SEQ ID NO: 2.

[0058] In a specific embodiment of the present invention, at the endogenous KIT locus of the non-human animal, the endogenous exons 1-21 of the non-human animal are replaced with a nucleotide sequence comprising SEQ ID NO: 1 or a nucleotide sequence encoding SEQ ID NO: 2.

[0059] In a specific embodiment of the present invention, the endogenous KIT gene of the non-human animal is replaced with a nucleotide sequence comprising SEQ ID NO: 1 or a nucleotide sequence encoding SEQ ID NO: 2 at the endogenous KIT gene locus of the non-human animal.

[0060] In a specific embodiment of the present invention, at the endogenous KIT locus of the non-human animal, the endogenous nucleotide sequence encoding SEQ ID NO: 10 of the non-human animal is replaced with a nucleotide sequence comprising SEQ ID NO: 1 or a nucleotide sequence encoding SEQ ID NO: 2.

[0061] Preferably, the nucleotide sequence comprising the mutated KIT corresponding region is operably linked to an endogenous regulatory element, such as a promoter and / or UTR.

[0062] Preferably, the non-human animal does not express wild-type KIT protein.

[0063] Preferably, the non-human animal is homozygous or heterozygous for exon 18 of the endogenous KIT gene.

[0064] Preferably, gene editing technology is used to construct a non-human animal modified with the KIT gene.

[0065] Preferably, the non-human animal is a non-human mammal, such as a monkey, a rodent (preferably a mouse or a rat).

[0066] Preferably, the non-human animal is immunodeficient, such as an immunodeficient rat or mouse.

[0067] In a specific embodiment of the present invention, the non-human animal is a NOD / scid mouse, a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - Mouse, Rag 2 - / - -IL2rg - / - mice, nude mice or B-NDG mice.

[0068] In a specific embodiment of the present invention, the mRNA transcribed from the mutated KIT gene in the genome of the non-human animal comprises SEQ ID NO: 1 or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to SEQ ID NO: 1.

[0069] The non-human animal may also include other genetic modifications.

[0070] Preferably, the non-human animal genome also includes a mutation in the endogenous Prkdc gene and / or a disruption (eg, knockout) of the IL-2rg gene.

[0071] Preferably, the non-human animal also expresses a human or chimeric protein, and the human or chimeric protein includes at least one of B2M, HLA-A, SIRPA, ALB, FcRn, IL15, F3, MSLN, CSF1, THPO, IL7, IL6, GPC3, MGMT3, SCF, CD47, IL2, FLT3LG, TROP2, HER3, ICOS, NKP46, HER2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4.

[0072] Preferably, the non-human animal is prepared by introducing one or more mutations into the endogenous KIT locus of the non-human animal. Further preferably, the non-human animal is prepared by introducing one or more mutations into exon 18 of the endogenous KIT locus of the non-human animal.

[0073] In a specific embodiment of the present invention, the non-human animal is prepared by introducing one or more point mutations into exon 18 of the KIT locus of the non-human animal using sgRNA and / or a targeting vector.

[0074] The target site sequence targeted by the sgRNA is shown in SEQ ID NO: 11-12.

[0075] The targeting vector comprises the nucleotide sequence shown in SEQ ID NO: 3. Preferably, the targeting vector further comprises a 5' arm and / or a 3' arm. The 5' arm of the targeting vector is all or part of the sequence shown in SEQ ID NO: 4 or 6. The 3' arm of the targeting vector is all or part of the sequence shown in SEQ ID NO: 5 or 7.

[0076] In a specific embodiment of the present invention, the preparation method comprises the following preparation steps:

[0077] 1) Mixing the in vitro transcription product of the targeting vector and / or sgRNA vector and Cas9 mRNA, and injecting the mixture into non-human animal cells, wherein the cells are fertilized oocytes or embryonic stem cells;

[0078] 2) culturing the cells in step 1) in a culture medium;

[0079] 3) transplanting the cultured cells into the fallopian tube of a recipient female non-human mammal, and allowing the cells to develop in the uterus of the female non-human mammal; wherein the non-human mammal is a pseudo-pregnant female;

[0080] 4) Identifying germline transmission of the genetically modified non-human mammal in the offspring of the pregnant female of step 3).

[0081] Preferably, the fertilized egg is derived from any non-human mammal; further preferably, the fertilized egg cell is derived from a rodent; even more preferably, the fertilized egg is selected from C57BL / 6 fertilized egg, FVB / N fertilized egg, 129 fertilized egg, BALB / c fertilized egg, DBA / 1 fertilized egg, DBA / 2 fertilized egg or B-NDG fertilized egg.

[0082] Preferably, the embryonic stem cells are derived from any non-human mammal. Further preferably, the embryonic stem cells are derived from rodents. Even further preferably, the embryonic stem cells are selected from C57BL / 6 embryonic stem cells, FVB / N embryonic stem cells, 129 embryonic stem cells, BALB / c embryonic stem cells, DBA / 1 embryonic stem cells or DBA / 2 embryonic stem cells.

[0083] The third aspect of the present invention provides a KIT gene-modified non-human animal or its offspring obtained by the above-mentioned preparation method.

[0084] In a fourth aspect, the present invention provides a targeting vector, wherein the targeting vector comprises a donor sequence, wherein the donor sequence comprises a nucleotide sequence encoding SEQ ID NO: 2 or positions 827-932 thereof.

[0085] Preferably, the donor sequence comprises the nucleotide sequence shown in SEQ ID NO:3.

[0086] Preferably, the nucleotide sequence length of the targeting vector can exceed about 0.8 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 15 kb, 16 kb, 18 kb, 19 kb or 20 kb.

[0087] Preferably, the targeting vector further comprises a 5' arm and / or a 3' arm. The 5' arm has at least 90% identical nucleotides to the NCBI accession number NC_000071.7. The 3' arm has at least 90% identical nucleotides to the NCBI accession number NC_000071.7.

[0088] Preferably, the 5' arm of the targeting vector is all or part of the sequence shown in SEQ ID NO: 4 or 6.

[0089] Preferably, the 3' arm of the targeting vector is all or part of the sequence shown in SEQ ID NO: 5 or 7.

[0090] In a specific embodiment of the present invention, the targeting vector comprises a) a DNA fragment homologous to the 5' end of the switch region to be changed, i.e., the 5' arm, which is selected from 100-10,000 nucleotides in length of the genomic DNA of the KIT gene; b) an inserted or replaced donor sequence; c) a second DNA fragment homologous to the 3' end of the switch region to be changed, i.e., the 3' arm, which is selected from 100-10,000 nucleotides in length of the genomic DNA of the KIT gene.

[0091] Preferably, the targeting vector further comprises a selectable marker gene. Further preferably, the marker gene is a gene encoding a negative selection marker. Even further preferably, the gene encoding the negative selection marker is a gene encoding a diphtheria toxin A subunit (DTA).

[0092] Preferably, the targeting vector further comprises a resistance gene for positive clone screening. Further preferably, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo.

[0093] Preferably, the targeting vector further comprises a specific recombination system. Further preferably, the specific recombination system is an Frt recombination site (a conventional LoxP recombination system may also be selected). There are two specific recombination systems, which are respectively installed on both sides of the resistance gene.

[0094] Preferably, the switch region to be changed is located in exon 18 of the KIT gene, and more preferably in exons 18-20.

[0095] Preferably, the inserted or replaced donor sequence includes all of exons 18-20 of the KIT gene, preferably also includes at least 100 bp of introns 17-18 and at least 100 bp of introns 20-21. Preferably, it also includes at least 120 bp of introns 17-18, for example, it includes at least 120, 130, 150, 180, 200, 250, 300, 400, 450, 460, 466, 480 or 500 bp of introns 17-18; preferably, it also includes at least 200 bp of introns 20-21, for example, it includes at least 200, 250, 300, 400, 450, 460, 466, 480, 500, 550, 600, 640, 645, 650 or 600 bp of introns 20-21.

[0096] Further preferably, the inserted or replaced donor sequence encodes all or part of the mutated KIT protein.

[0097] More preferably, the inserted or replaced donor sequence encodes all or part of the amino acid sequence shown in SEQ ID NO: 2 or positions 827-932 thereof.

[0098] In a fifth aspect of the present invention, a sgRNA targeting the KIT gene is provided, wherein the target site sequence targeted by the sgRNA is shown in SEQ ID NOs: 11-12.

[0099] Preferably, the sgRNA targets exons 18 to 20. Further preferably, the sgRNA targets introns 17 to 18 and / or introns 20 to 21.

[0100] Preferably, the sgRNA targets exons 18-20 of the KIT gene, and further preferably targets introns 17-18 and / or introns 20-21 of the KIT gene.

[0101] In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 13 and 15. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 14 and 16. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 17 and 19. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 18 and 20.

[0102] In a sixth aspect, the present invention provides a vector comprising the above-mentioned sgRNA targeting the KIT gene and / or the above-mentioned DNA molecule.

[0103] In a seventh aspect, the present invention provides a cell comprising the above-mentioned targeting vector, the above-mentioned sgRNA targeting the KIT gene, the above-mentioned DNA molecule, and / or the above-mentioned vector.

[0104] In an eighth aspect, the present invention provides a use of the above-mentioned targeting vector, the above-mentioned sgRNA targeting the KIT gene, the above-mentioned DNA molecule, the above-mentioned vector, or the above-mentioned cell in KIT gene modification.

[0105] In a ninth aspect, the present invention provides a KIT gene-modified cell or cell line or a method for preparing the same, wherein the cell or cell line expresses a mutant KIT protein.

[0106] Preferably, the cells or cell lines are selected from embryonic stem cells or sperm.

[0107] Preferably, in the cell or cell line, the KIT gene encoding the mutated KIT protein is homozygous or heterozygous.

[0108] Preferably, at least one chromosome in the cell or cell line comprises a KIT gene encoding a mutated KIT protein.

[0109] Preferably, gene editing technology is used to construct KIT gene-modified cells or cell lines.

[0110] Preferably, the cell or cell line is from an immunodeficient non-human animal.

[0111] Preferably, the cell or cell line is from an immunodeficient non-human animal cell or cell line.

[0112] Preferably, the KIT gene-modified cell or cell line is prepared by introducing one or more mutations at the KIT locus in the cell or cell line.

[0113] Further preferably, the KIT gene-modified cell or cell line is prepared by introducing one or more point mutations into exon 18 of the KIT locus of the cell or cell line using sgRNA and / or a targeting vector. The target site sequence targeted by the sgRNA is shown in SEQ ID NO: 11-12. The targeting vector comprises a nucleotide sequence encoding SEQ ID NO: 3. Preferably, the targeting vector further comprises a 5' arm and / or a 3' arm, the 5' arm having at least 90% identity with a nucleotide having NCBI accession number NC_000071.7, preferably, as shown in SEQ ID NO: 4 or 6; the 3' arm having at least 90% identity with a nucleotide having NCBI accession number NC_000071.7, preferably, the 3' arm sequence is shown in SEQID NO: 5 or 7.

[0114] The tenth aspect of the present invention provides a method for preparing a multi-gene modified non-human animal, comprising the following steps:

[0115] (1) preparing the above-mentioned KIT gene-modified non-human animal, or a KIT gene-modified non-human animal constructed using the above-mentioned method for preparing a KIT gene-modified non-human animal;

[0116] (2) mating, in vitro fertilization or direct gene editing of the KIT gene-modified non-human animal prepared in step (1) with other gene-modified non-human animals, and screening to obtain multi-gene-modified non-human animals.

[0117] Preferably, the other genetically modified non-human animals include but are not limited to Prkdc and / or IL2RG genetically modified non-human animals.

[0118] Preferably, the multi-gene modified non-human animal is a double-gene modified non-human animal, a triple-gene modified non-human animal, a quadruple-gene modified non-human animal, a pentagene modified non-human animal, a hexagene modified non-human animal, a heptagene modified non-human animal, an octagene modified non-human animal or a nine-gene modified non-human animal.

[0119] Preferably, each gene in the modified polygene in the genome of the polygene modified animal can be homozygous or heterozygous.

[0120] Preferably, the other genetically modified non-human animals are non-human mammals. More preferably, the non-human mammals may be rodents, pigs, rabbits, monkeys, etc. Most preferably, the non-human mammals are rodents, and the rodents are mice or rats.

[0121] Preferably, the other genetically modified non-human animal is an immunodeficient non-human mammal, such as an immunodeficient rat or mouse.

[0122] In a specific embodiment of the present invention, the non-human animal is a NOD / scid mouse, a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - Mouse, Rag 2 - / - -IL2rg - / - mice, nude mice or B-NDG mice.

[0123] The eleventh aspect of the present invention provides a multi-gene modified non-human animal or its offspring prepared by the above-mentioned method for preparing a multi-gene modified non-human animal.

[0124] In the twelfth aspect of the present invention, there is provided an animal model of tumor-bearing, inflammation, anemia or immune-related diseases or a method for preparing the same, wherein the animal model is derived from a KIT gene-modified non-human animal prepared by the above-mentioned preparation method, the above-mentioned KIT gene-modified non-human animal or its offspring, a multi-gene modified non-human animal constructed by the above-mentioned method, or the above-mentioned multi-gene modified non-human animal or its offspring.

[0125] The method for preparing the animal model comprises the steps of preparing a KIT gene-modified non-human animal by the above-mentioned preparation method or preparing a multi-gene-modified non-human animal by the above-mentioned method.

[0126] Preferably, the method for preparing a tumor-bearing animal model further comprises the step of implanting tumor cells into the non-human animal prepared by the above method or its offspring.

[0127] In the thirteenth aspect of the present invention, a cell or cell line or primary cell culture is provided, wherein the cell or cell line or primary cell culture is derived from the KIT gene-modified non-human animal prepared by the above-mentioned preparation method, the above-mentioned KIT gene-modified non-human animal or its offspring, the multi-gene modified non-human animal constructed by the above-mentioned method, the above-mentioned multi-gene modified non-human animal or its offspring, or the above-mentioned animal model of tumor, inflammation, anemia or immune-related disease.

[0128] In a fourteenth aspect of the present invention, a tissue or organ or a culture thereof is provided, wherein the tissue or organ or a culture thereof is derived from a KIT gene-modified non-human animal prepared by the above-mentioned preparation method, the above-mentioned KIT gene-modified non-human animal or its progeny, a multi-gene modified non-human animal constructed by the above-mentioned method, the above-mentioned multi-gene modified non-human animal or its progeny, or the above-mentioned animal model of tumor-bearing, inflammation, anemia or immune-related disease. Preferably, the tissue or organ is a spleen, a tumor or a culture thereof.

[0129] In the fifteenth aspect of the present invention, a tumor tissue after tumor bearing is provided, wherein the tumor tissue is derived from the KIT gene-modified non-human animal prepared by the above-mentioned preparation method, the above-mentioned KIT gene-modified non-human animal or its offspring, the multi-gene modified non-human animal constructed by the above-mentioned method, the above-mentioned multi-gene modified non-human animal or its offspring, or the above-mentioned animal model of tumor bearing, inflammation, anemia or immune-related diseases.

[0130] In a sixteenth aspect of the present invention, a mutant KIT protein is provided, wherein the mutant KIT protein comprises one or more amino acid mutations introduced into the intracellular region of a non-human animal KIT protein. Preferably, the mutant KIT protein affects downstream signal transduction.

[0131] Preferably, the mutated KIT protein comprises an extracellular region, a transmembrane region, a signal peptide and an intracellular region, wherein the intracellular region comprises one or more amino acid mutations.

[0132] Preferably, the mutated KIT protein comprises an amino acid sequence in which the amino acid at position 831 of SEQ ID NO: 10 is mutated, preferably comprises a mutation of valine (V) at position 831 of SEQ ID NO: 10 to methionine (M).

[0133] In a specific embodiment of the present invention, the mutant KIT protein comprises a mutation from G to A at position 75813222 of NCBI accession number NC_000071.7.

[0134] In a specific embodiment of the present invention, the mutant KIT protein comprises V831M.

[0135] In a specific embodiment of the present invention, the mutated KIT protein is selected from one of the following groups:

[0136] (A) all or part of the amino acid sequence shown in SEQ ID NO: 2;

[0137] (B) has a degree of identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:10;

[0138] (C) hybridizes to the nucleotide sequence encoding the protein shown in SEQ ID NO: 2 under stringent conditions;

[0139] (D) differs from the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or,

[0140] (E) having the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 10, including substitution, deletion and / or insertion of one or more amino acid residues.

[0141] In a seventeenth aspect of the present invention, a KIT gene is provided, wherein the KIT gene encodes a mutant KIT protein. Preferably, the KIT gene sequence is a non-human animal KIT gene exon 18 containing one or more mutations.

[0142] Preferably, the KIT gene sequence is a mutation at position 2552 of NM_021099.3.

[0143] Further preferably, the KIT gene sequence includes a mutation from G to A at position 2552 of NM_021099.3.

[0144] In a specific embodiment of the present invention, the KIT gene sequence is selected from one of the following groups:

[0145] (a) a KIT gene encoding a mutant KIT protein encodes the mutant KIT protein described above;

[0146] (b) the transcribed mRNA sequence includes part or all of the sequence shown in SEQ ID NO: 1;

[0147] (c) having a degree of identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to part or all of the nucleotide sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9;

[0148] (d) hybridizes to the nucleotide sequence shown in SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9 under stringent conditions;

[0149] (e) differs from the nucleotide sequence of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; or,

[0150] (f) a nucleotide sequence having the nucleotide sequence shown in SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9, including substitution, deletion and / or insertion of one or more nucleotides.

[0151] In an eighteenth aspect, the present invention provides a cell, tissue or organ, wherein the cell, tissue or organ expresses the mutated KIT protein.

[0152] The tissue includes tumor tissue after tumor bearing.

[0153] The non-human animal described in the present invention is a non-human mammal. Further preferably, the non-human mammal is any non-human mammal that can be genetically modified to prepare a KIT gene-modified non-human animal, such as a rodent, a pig, a rabbit, a monkey, etc. Further preferably, the non-human mammal is a rodent. Most preferably, the rodent is a mouse or a rat.

[0154] The non-human animal described in the present invention is an immunodeficient non-human mammal. Further preferably, the non-human animal is an immunodeficient rodent, pig, rabbit, monkey or any other non-human mammal that can be genetically modified to prepare a KIT gene-modified non-human animal. Further preferably, the non-human animal is an immunodeficient rodent. More preferably, the non-human animal is an immunodeficient mouse or rat. Most preferably, the non-human animal is a NOD / scid mouse, a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - (NRG) mouse, Rag 2 - / - -IL2rg - / - (RG) mice, B-NDG mice or nude mice.

[0155] In a nineteenth aspect, the present invention provides a KIT gene-modified non-human animal prepared by the above preparation method, the KIT gene-modified non-human animal or its progeny, the above cell or cell line, the cell or cell line obtained by the above preparation method, the multi-gene modified non-human animal constructed by the above method, the multi-gene modified non-human animal or its progeny, the above tumor-bearing, immune-related disease, inflammation or anemia animal model, the above cell or cell line or primary cell culture, the above tissue or organ or its culture, the above cell, tissue or organ, the above mutant KIT protein, the above KIT gene use, the use comprising:

[0156] A) Applications in the development of products involving immune processes in human cells (e.g. antibodies);

[0157] B) Application as a model system in pharmacology, immunology, microbiology and medical research;

[0158] C) Applications involving the production and use of animal experimental disease models for human cell transplantation, immune system reconstruction, etiology research and / or for the development of new diagnostic and / or therapeutic strategies;

[0159] D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human signaling pathway modulators; or,

[0160] E) Research gene function, research human-targeted drugs and drug efficacy, and research the application of drugs in anemia, cancer, immune-related diseases or inflammation.

[0161] Preferably, the method for drug screening or drug efficacy evaluation is not a treatment method. The method is used to screen drugs, detect and compare the efficacy of candidate drugs to determine which candidate drugs can be used as drugs and which cannot be used as drugs, or compare the drug efficacy sensitivity of different drugs, that is, the therapeutic effect is not inevitable, but only a possibility.

[0162] In a twentieth aspect of the present invention, there is provided a method for determining the effectiveness of a drug for treating cancer, comprising:

[0163] (a) transplanting tumor cells into the above-mentioned non-human animals, thereby forming one or more tumors in the non-human animals;

[0164] (b) administering a medicament to a non-human animal; and

[0165] (c) Determine the inhibitory effect on tumors.

[0166] Preferably, human peripheral blood cells (hPBMC) or human hematopoietic stem cells are injected into the non-human animal prior to transplanting tumor cells into the non-human animal.

[0167] Preferably, the tumor cells are derived from a tumor sample from a human patient.

[0168] Preferably, the tumor cells are melanoma cells, lung cancer cells (eg, primary lung cancer cells, non-small cell lung cancer cells, small cell lung cancer cells), gastric cancer cells (eg, primary gastric cancer cells), bladder cancer cells, breast cancer cells and / or prostate cancer cells.

[0169] Preferably, the medicament comprises an antibody, and further preferably, the medicament further comprises an additional therapeutic agent.

[0170] More preferably, the antibody includes one or more of anti-CD47 antibody, anti-PD-1 antibody, IL6 antibody or IL15 antibody.

[0171] More preferably, the additional therapeutic agent comprises one or more of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel or capecitabine.

[0172] Preferably, inhibition is determined by measuring tumor volume in a non-human animal.

[0173] In the twenty-first aspect of the present invention, there is provided a method for preparing an animal model comprising a human blood-lymphatic system, the method comprising: transplanting a cell population comprising human hematopoietic stem cells or human peripheral blood cells into the non-human animal.

[0174] Preferably, the human blood-lymphatic system comprises human cells selected from the group consisting of hematopoietic stem cells, bone marrow precursor cells, bone marrow cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes and platelets.

[0175] The twenty-second aspect of the present invention provides a method for reconstructing a human immune system, which comprises applying human hematopoietic stem cells or human peripheral blood cells to an individual to reconstruct the immune system in a non-human animal, wherein the individual is selected from the KIT gene-modified non-human animal prepared by the above-mentioned preparation method, the above-mentioned KIT gene-modified non-human animal or its offspring, the multi-gene modified non-human animal constructed by the above-mentioned method, the above-mentioned multi-gene modified non-human animal or its offspring, or the above-mentioned animal model of tumor-bearing, immune-related disease, inflammation or anemia.

[0176] The human immune system includes a human blood-lymphatic system. Preferably, the human blood-lymphatic system includes human cells selected from hematopoietic stem cells, bone marrow precursor cells, bone marrow cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes or platelets.

[0177] Preferably, in the peripheral blood of the non-human animal after transplantation of human hematopoietic stem cells to form a human immune system, the percentage of human leukocytes in the total living cells is greater than 25%-85% (for example, at 12, 15, 18, 21, 24 weeks or later after the non-human animal transplantation).

[0178] Preferably, the injection is tail vein injection.

[0179] Preferably, the amount of injected human hematopoietic stem cells is 3×10 4 Human hematopoietic stem cells (HSC).

[0180] Preferably, the standard for the immune system reconstruction is that the proportion of hCD45+ cells in the total living cells after lysis of red blood cells is ≥ 25%.

[0181] Preferably, the non-human animal has not been irradiated prior to human hematopoietic stem cell transplantation.

[0182] Preferably, the method further comprises taking peripheral blood (PB) at intervals after the injection of human hematopoietic stem cells to test whether the injection is successful and to observe the survival of the non-human animal. In one embodiment of the present invention, the period of time is 4 weeks.

[0183] Preferably, the peripheral blood (PB) is collected for testing and verification, including detecting the expression of human leukocyte surface molecule markers (CD45 + ) cells, T cells (CD3+), B cells (CD19+) and myeloid cells (CD33+).

[0184] In one embodiment of the invention, animals transplanted with human hematopoietic stem cells to form a human immune system have better development of human T cells, monocytes and / or granulocytes compared to B-NDG mice, where the B-NDG mice were irradiated prior to transplantation.

[0185] In one embodiment of the invention, animals transplanted with human hematopoietic stem cells to form a human immune system have a higher percentage of leukocytes among total viable cells compared to B-NDG mice, where the B-NDG mice were irradiated prior to transplantation.

[0186] In one embodiment of the present invention, animals transplanted with human hematopoietic stem cells to form a human immune system have a higher reconstitution success rate than B-NDG mice, where the B-NDG mice were irradiated before transplantation.

[0187] In one embodiment of the invention, the animal has enhanced exogenous cell transplantation capacity relative to B-NDG mice.

[0188] In one embodiment of the present invention, the non-human animal after transplantation of human hematopoietic stem cells to form a human immune system has one or more of the following characteristics:

[0189] (a) the percentage of human leukocytes among total viable cells is greater than 25% to 85% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in a non-human animal);

[0190] (b) the percentage of human T cells among total human leukocytes is greater than 5% to 60% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0191] (c) the percentage of human B cells among total human leukocytes is greater than 40% to 95% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0192] (d) the percentage of human NK cells among total human leukocytes is greater than 0% to 10% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0193] (e) the percentage of human monocytes among total human leukocytes is greater than 0% to 10% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0194] (f) the percentage of human classical dendritic cells in total human leukocytes is greater than 0% to 10% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0195] (g) the percentage of human helper T cells in human T cells is greater than 20% to 80% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0196] (h) the percentage of human cytotoxic T cells in human T cells is greater than 10% to 70% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0197] (i) the percentage of human Treg cells in human T cells is greater than 0%-30% (e.g., at week 12, 15, 18, 21, 24 or later after transplantation in the non-human animal);

[0198] Preferably, the non-human animal has not been irradiated prior to human hematopoietic stem cell transplantation.

[0199] The twenty-third aspect of the present invention provides a non-human animal or its offspring with a reconstructed human immune system obtained by the above-mentioned method for reconstructing the human immune system.

[0200] The twenty-fourth aspect of the present invention provides a method for antibody screening, which comprises transplanting human tumor cells into the non-human animal or its offspring with reconstructed human immune system, administering the antibody to be screened, and detecting and evaluating the effect of the non-human animal or its offspring administered the antibody.

[0201] Preferably, the method for antibody screening is not a therapeutic method. The method is used to screen or evaluate antibodies, detect and compare the efficacy of candidate antibodies to determine which candidate antibodies can be used as drugs and which cannot be used as drugs, or compare the drug sensitivity of different antibodies, that is, the therapeutic effect is not inevitable, but only a possibility.

[0202] The twenty-fifth aspect of the present invention provides a method for screening or evaluating drugs for human use, which comprises administering a drug to the above-mentioned non-human animal or non-human animal with reconstructed human immune system or its offspring.

[0203] Preferably, the non-human animal exhibits symptoms of anemia, and the therapeutic effect of the agent on anemia is evaluated.

[0204] Preferably, human tumor cells are transplanted into the above-mentioned non-human animals or non-human animals with reconstituted human immune systems or their offspring.

[0205] Preferably, human peripheral blood cells (hPBMC) or human hematopoietic stem cells are injected into the non-human animal prior to transplanting tumor cells into the non-human animal.

[0206] Preferably, the tumor cells are melanoma cells, lung cancer cells (eg, primary lung cancer cells, non-small cell lung cancer cells, small cell lung cancer cells), gastric cancer cells (eg, primary gastric cancer cells), bladder cancer cells, breast cancer cells and / or prostate cancer cells.

[0207] Preferably, the candidate agent is administered to a non-human animal into which human tumor cells are transplanted, and the efficacy of the candidate agent is tested and / or compared in the individuals to which the candidate agent is administered.

[0208] Preferably, the medicament comprises an antibody, and further preferably, the medicament further comprises an additional therapeutic agent.

[0209] More preferably, the antibody includes one or more of anti-CD47 antibody, anti-PD-1 antibody, IL6 antibody or IL15 antibody.

[0210] More preferably, the additional therapeutic agent comprises one or more of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel or capecitabine.

[0211] Preferably, the method for drug screening or evaluation is not a treatment method. The method is used to screen or evaluate drugs, detect and compare the efficacy of candidate drugs to determine which candidate drugs can be used as drugs and which cannot be used as drugs, or compare the sensitivity of the efficacy of different drugs, that is, the therapeutic effect is not inevitable, but only a possibility.

[0212] Preferably, the candidate agent is a monoclonal antibody or a bispecific antibody or a combination of two or more drugs.

[0213] Preferably, the detection includes determining the size and / or proliferation rate of tumor cells; preferably, the detection method includes vernier caliper measurement, flow cytometry and / or in vivo animal imaging detection.

[0214] Preferably, the testing comprises assessing an individual's body weight, fat mass, activated pathways, neuroprotective activity or metabolic changes, including changes in food consumption or water consumption.

[0215] The twenty-sixth aspect of the present invention provides a method for evaluating a treatment regimen, which comprises implanting human tumor cells into the non-human animal or its offspring with reconstructed human immune system, applying the treatment regimen to the individual implanted with human tumor cells, and detecting and evaluating the tumor suppression effect on the individual after application of the treatment regimen.

[0216] Preferably, the treatment regimen is CAR-T.

[0217] Preferably, the evaluation method is not a treatment method. The method detects and evaluates the effect of the treatment plan to determine whether the treatment plan has a therapeutic effect, that is, the therapeutic effect is not inevitable, but only a possibility.

[0218] The KIT gene-modified non-human animals obtained by the preparation method described in the present application can successfully reconstruct the human immune system without irradiation and myeloablation, and the state, survival rate and proportion of human leukocytes after reconstruction of the non-human animals are significantly better than those of B-NDG mice, and can better support the development of T cells, monocytes, granulocytes, etc.

[0219] The cells or cell lines of the present invention are somatic cells, immune cells (such as T cells, B cells, NK cells, antigen presenting cells, macrophages, dendritic cells), germ cells, blastocysts or tumor cells. Therefore, they can develop into animal or plant individuals, or they cannot develop into animal or plant individuals.

[0220] The “all or part” mentioned in the present invention, “all” refers to the whole, and “part” refers to a part of the whole, or some individuals that make up the whole.

[0221] The "gene locus" of the present invention refers to the position of a gene on a chromosome in a broad sense, and refers to a DNA fragment on a gene in a narrow sense, which can be a gene, a part of a gene, or a regulatory region of a gene, etc. For example, the "KIT gene locus" includes exons 1-21 of the KIT gene and any DNA fragment in its regulatory region.

[0222] The "exon XX to exon XXX" or "exon XX-XXX" or "all of exon XX-XXX" or "all of exon XX to all of exon XXX" mentioned in the present invention refers to exons and introns in between. For example, "all of exons 18-20" includes all of exon 18, all of introns 18-19, all of exon 19, all of introns 19-20, and all of exon 20.

[0223] The “intron x-xx” mentioned in the present application refers to the intron between exon x and exon xx, for example, intron 18-19 is the intron between exon 18 and exon 19.

[0224] The "immune-related diseases" described in the present invention include, but are not limited to, GVHD (graft versus host disease), Crohn's disease, ankylosing spondylitis, atopic dermatitis, psoriasis, allergies, asthma, myocarditis, nephritis, hepatitis (preferably non-alcoholic fatty liver disease), systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, scleroderma, hyperthyroidism, thrombocytopenic purpura (e.g., primary or idiopathic), autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc. In some embodiments, the immune-related disease is asthma, atopic dermatitis, rheumatoid arthritis or multiple sclerosis.

[0225] "Cancer" described in the present invention includes malignant tumors of various organ systems, such as malignant tumors affecting the lung, breast, thyroid, lymph, gastrointestinal and genitourinary tracts, and adenocarcinomas, which include malignant tumors such as most colon cancers, renal cell carcinomas, prostate cancers and / or testicular tumors, non-small cell lung cancer. Also included are malignant tumors of epithelial or endocrine tissues, including respiratory cancer, gastrointestinal cancer, urogenital cancer, testicular cancer, breast cancer, prostate cancer, endocrine cancer and melanoma. Exemplary cancers include cancers formed by cervical, lung, prostate, breast, head and neck, colon and ovarian tissues. Also included are carcinosarcoma, for example, including malignant tumors composed of cancerous tissue and sarcoma tissue. "Adenocarcinoma" refers to a cancer derived from glandular tissue or tumor cells forming a recognizable glandular structure. The "sarcoma" is recognized and refers to a malignant tumor of mesenchymal origin. In certain embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, cancer, bladder cancer, glioma, cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome and sarcoma. In certain embodiments, the leukemia is selected from acute lymphocytic (lymphocyte) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia and chronic myelogenous leukemia. In certain embodiments, lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B cell lymphoma, diffuse large B cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B cell lymphoma and T cell lymphoma, and Waldenstrom macroglobulinemia. In certain embodiments, sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma and chondrosarcoma. In certain specific embodiments, tumor is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer or cancer.

[0226] "Inflammation" described in the present invention includes acute inflammation and chronic inflammation, exemplary including but not limited to degenerative inflammation, exudative inflammation (e.g., serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation, specific inflammation (e.g., tuberculosis, syphilis, leprosy or lymphogranuloma). In some embodiments, the inflammation is inflammatory bowel disease (IBD).

[0227] The term "treating" (or "treat" or "treatment") as used herein means to slow down, interrupt, prevent, control, stop, alleviate, or reverse the progression or severity of a sign, symptom, disorder, symptom, or disease, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, symptoms, or disorders. For example, it refers to therapeutic intervention that improves the signs, symptoms, etc. of a disease or pathological state after the disease has begun to develop.

[0228] The "mutation" described in the present invention includes gene mutation or protein mutation, and the gene mutation or protein mutation is a heritable mutation. Among them, the gene mutation includes base substitution, frameshift, deletion or insertion. Preferably, the gene mutation is base substitution. The gene mutation can be spontaneous or induced. The protein mutation includes replacing the wild-type amino acid with other natural amino acids, other modified natural amino acids or non-natural amino acids, etc.

[0229] The "non-natural amino acid" of the present invention is a compound containing an amino group and a carboxyl group that is not naturally found in proteins. Preferably, the non-natural amino acid is any non-natural amino acid known in the art. Further preferably, the non-natural amino acid includes but is not limited to N-ethylaspartyl, hydroxylysine, 3-hydroxyproline, 2-aminobutyric acid, β-alanine, β-aminopropionic acid, 2-aminoadipic acid, 3-aminoadipic acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, allo-isoleucine, isodesmosine, 4-hydroxyproline, allo-hydroxylysine, 2-aminoisobutyric acid, N-methylglycine, N-methylisoleucine, 3-aminoisobutyric acid, 6-N-methyllysine, 2,4-diaminobutyric acid, N-methylvaline, ornithine, norleucine, norvaline, desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine or 2-aminopimelic acid, etc.

[0230] The "modified natural amino acids" of the present invention are amino acids whose side chains are chemically modified, for example, amino acids modified after translation, or side chains containing novel functional groups (such as sulfhydryl, amino or carboxyl), or side chains containing signal-generating moieties (such as fluorescent groups or radioactive labels).

[0231] The "mutated KIT protein" of the present invention refers to a protein that has at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or more, or any range therebetween, but less than 100% identity with the wild-type KIT protein, and when a non-human animal expresses such a "mutated KIT protein", it can affect downstream signal transduction, so that the proliferation and differentiation of hematopoietic stem cells in the non-human animal are inhibited. Preferably, the hematopoietic stem cells in the non-human animal modified with the KIT gene are absent.

[0232] The "identity" mentioned in the present invention refers to that in terms of using protein sequences or nucleotide sequences, those skilled in the art can adjust the sequences according to actual work needs so that the used sequences have (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 9%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% identity.

[0233] In order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are compared for the purpose of optimal comparison (e.g., for optimal comparison, gaps can be introduced in one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be ignored for the purpose of comparison). The amino acid residues or nucleotides on the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, which needs to be introduced to achieve the optimal comparison of the two sequences, taking into account the number of gaps and the length of each gap. For example, the comparison of the sequences and the determination of the percent identity between the two sequences can be completed using the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0234] The term "comprising" or "including" described in the present invention is an open-ended term, which includes the specified components or steps described, as well as other specified components or steps that will not be substantially affected. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0235] The "and / or" of the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately in the present application. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0236] The “plurality” mentioned in the present invention means two or more, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.

[0237] The non-human animal of genetic modification can be various animals, for example, mouse, rat, rabbit, pig, cattle (for example, cattle, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (for example, marmoset, rhesus monkey).For the non-human animal of suitable genetically modified embryonic stem cell (ES) that is not easy to obtain, adopt alternative methods to construct the non-human animal comprising genetic modification.Such method includes, for example, modifying non-ES cell genome (for example, fibroblast or induced pluripotent stem cell) and adopting nuclear transplantation to transfer the modified genome to suitable cell, for example oocyte, and incubating the modified cell (for example, modified oocyte) in non-human animal under appropriate conditions to form embryo.The above-mentioned construction method is known in the art, and is described in "A.Nagy, et al., "Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), " Cold Spring Harbor Laboratory Press, 2006 ", the entire contents of which are incorporated into the present application by reference.

[0238] In one aspect, the non-human animal is a mammal. In one aspect, the non-human animal is a small mammal, such as the superfamily of the family ... In a specific embodiment, the rodent is selected from the group consisting of a mouse and a rat. In one embodiment, the non-human animal is a mouse.

[0239] In some embodiments, the non-human animal can be an immunodeficient non-human mammal. For example, an immunodeficient rodent, an immunodeficient rabbit, an immunodeficient pig, an immunodeficient monkey, etc. In some embodiments, the non-human animal is a mouse of the C57BL strain, and the C57BL strain is selected from C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL6, C57BL / 10, C57BL10ScSn, C57BL / 10Cr and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from 129 / J, 129 / ReJ, 129 / OlaHsd, 129 / Sv, 129 / SvJ, 129 / Re, 129 / RrJ, 129 / Sv-ter / +. These mice are described in, for example, Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), the relevant contents of which are incorporated herein by reference in their entirety. In some embodiments, the genetically modified mouse is a hybrid of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a hybrid of the 129 strain, or a hybrid of the C57BL / 6 strain. In some embodiments, the mouse is a BALB strain, such as a BALB / c strain. In some embodiments, the mouse is a hybrid of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50% BALB / c-50% 12954 / Sv; or 50% C57BL / 6-50% 129). In certain embodiments, non-human animals are rodents. In certain embodiments, non-human animals are mice with BALB / c, BALB / cHeAn, BALB / cJ, BALB / cR1, BALB / cWt, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola), C58, CBA / Br, CBA / Ca, CBA / J, CBA / st or CBA / H strains. In certain embodiments, non-human animals are rats. Rats can be selected from Wistar rats, LEA strains, Sprague-Dawley strains, Fischer strains, F344, F6 and Dark Agouti.In some embodiments, the rat strain is a hybrid of two or more strains selected from Wistar, LEA, Sprague-Dawley, Fischer, F344, F6, and Dark Agouti.

[0240] The non-human animal may have one or more other genetic modifications and / or other modifications that are suitable for the specific purpose of preparing the genetically modified animal. For example, a suitable mouse for maintaining a xenograft (e.g., a human cancer or tumor) may have one or more modifications that damage, inactivate, or destroy all or part of the immune system of the non-human animal. Damage, inactivation, or destruction of the immune system of the non-human animal may include, for example, chemical means (e.g., administration of toxins), physical means (e.g., irradiation of the animal), and / or genetic modification (e.g., knocking out one or more genes). Non-limiting examples of such mice include, for example, NOD mice, SCID mice, NOD / scid mice, IL2Rγ knockout mice, NOD / SCID / γc null Mice (Ito, M. et al., NOD / SCID / γc null mouse:an excellent recipient mouse model for engraftment of human cells, Blood 100(9):3175-3182, 2002), nude mice, and Rag1 and / or Rag2 knockout mice. These mice can be optionally irradiated or otherwise treated to destroy one or more immune cell types. In some embodiments, the mouse modification type is selected from NOD mice, SCID mice, NOD / scid mice, IL-2Rγ knockout mice, NOD / SCID / γc null Mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD Prkdc scid IL-2Rγ null Mouse, NOD Rag 1 - / - IL - / - (NRG) mouse, Rag2 - / - IL - / - Modification of (RG) mice and combinations thereof. These transgenic animals are described, for example, in US 10820580 B2, which is incorporated herein by reference in its entirety.

[0241] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following literature. For example: Molecular Cloning AL Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (DN Glovered., 1985); Oligonucleotide Synthesis (MJ Gaited., 1984); Mullisetal. US Pat. No. 4, 683, 195; Nucleic Acid Hybridization (BDHames&S.J.Higginseds.1984); Transcription And Translation (BDHames&S.J.Higginseds.1984); Culture Of Animal Cells (RIFreshney, AlanR.Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B.Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J.Abelson and M.Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154and 155 (Wuetal.eds.) and Vol.185, "Gene Expression Technology" (D.Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (JHMiller and M.P. Caloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods InCell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes V (DMWeir and CCBlackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). .

[0242] The gene editing technology of the present invention includes gene targeting technology based on embryonic stem cells, homologous recombination technology, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease or other molecular biology technology. In some embodiments, CRISPR-Cas9 gene editing technology is used to produce genetically modified non-human animals. Many of these gene editing technologies are known in the art and are described in Yin et al. "Delivery technologies for genome editing," Nature Reviews Drug Discovery 16.6 (2017): 387-399, which is incorporated herein by reference. The present invention also provides many other methods for genome editing, for example, microinjecting genetically modified cells into enucleated oocytes, and fusing enucleated oocytes with another genetically modified cell.

[0243] The above merely summarizes some aspects of the present invention and is not and should not be considered to limit the present invention in any aspect.

[0244] All patents and publications mentioned in this specification are incorporated herein by reference as a whole. Those skilled in the art will recognize that certain changes may be made to the present invention without departing from the concept or scope of the present invention. The following examples further illustrate the present invention in detail and should not be considered to limit the scope of the present invention or the specific methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0245] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0246] Figure 1 : Schematic diagram of the mouse KIT locus (not to scale);

[0247] Figure 2 : Schematic diagram of KIT gene targeting strategy and targeting vector V1 design (not to scale);

[0248] Figure 3 : Schematic diagram of KIT gene targeting strategy and targeting vector V2 design (not to scale);

[0249] Figure 4 : Southern blot identification results of F1 generation of KIT gene mutant mice, where WT is the wild-type control;

[0250] Figure 5 :RT-PCR test results of heterozygous mice with KIT gene mutation;

[0251] Fig. 6A -C: Flow cytometry immunophenotyping results of B-NDG mice and KIT gene mutant mice, Fig. 6A The results of spleen immunophenotyping are as follows: Figure 6B The results of peripheral blood immunophenotyping are as follows: Figure 6C The results of bone marrow immunophenotyping, B-NDG is B-NDG mouse, B-NDG Kit is B-NDG mouse with KIT gene mutation, TC is T cell, BC is B cell, NK is NK cell, DC is dendritic cell, MC is monocyte, Mφ is macrophage, NE is neutrophil;

[0252] Figure 7 : Body weight of B-NDG mice and B-NDG mice with KIT gene mutation after immune reconstitution;

[0253] Figure 8 : Survival rate of B-NDG mice and B-NDG mice with KIT gene mutation after immune reconstitution;

[0254] Fig. 9 : Flow cytometry results after immune reconstitution of B-NDG mice and B-NDG mice with KIT gene mutation, where B-NDG refers to B-NDG mice, B-NDG Kit refers to B-NDG mice with KIT gene mutation, and WBC refers to white blood cells. DETAILED DESCRIPTION

[0255] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0256] In each of the following examples, equipment and materials were obtained from the following companies:

[0257] B-NDG mice were obtained from Biocytogen (Beijing) Pharmaceutical Technology Co., Ltd.

[0258] SpeI was purchased from NEB, catalog number R3133S;

[0259] SspI was purchased from NEB with the catalog number R3132S.

[0260] Example 1: Construction of KIT gene mutant mice

[0261] Mouse KIT gene (NCBI Gene ID: 16590, Primary source: MGI: 96677, UniProt ID: P05532, located at positions 75735647 to 75817382 on chromosome 5 NC_000071.7, based on transcript NM_021099.3 and its encoded protein NP_066922.2, the locus diagram is shown in Figure 1 shown.

[0262] To achieve the purpose of the present invention, one or more point mutations can be introduced into the coding sequence at the endogenous mouse KIT locus to generate a KIT mutant gene, the encoded protein sequence of which has one or more amino acid mutations compared to the wild-type protein.

[0263] The present application uses gene editing technology to modify C57BL / 6 mice, and introduces a point mutation in the exon 18 region of the KIT locus, so that the 831st amino acid of the mutant KIT protein expressed in the mouse is mutated from V to M. Specifically, the entire sequence of about 1887 bp from exon 18 to exon 20 of the mouse KIT gene containing the V813M mutation replaces the sequence of the corresponding position of the mouse endogenous gene, and the mRNA sequence transcribed from the KIT mutant gene is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

[0264] In order to realize the targeting strategy of the present invention, a targeting vector V1 ( Figure 2 ), the targeting vector V1 contains upstream and downstream homology arm sequences of the mouse KIT gene, and a mouse KIT gene fragment containing the V813M mutation. Among them, the upstream 5' homology arm sequence (SEQ ID NO: 4) is identical to the nucleotide sequence of positions 75808734 to 75812743 of NCBI accession number NC_000071.7, and the downstream 3' homology arm sequence (SEQ ID NO: 5) is identical to the nucleotide sequence of positions 75814631 to 75818633 of NCBI accession number NC_000071.7. The nucleotide sequence of the mouse KIT gene fragment containing the V813M mutation (SEQ ID NO: 3) is at least 99% identical to the nucleotide sequence of positions 75812744 to 75814630 of NCBI accession number NC_000071.7.

[0265] The targeting vector also includes a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the mouse KIT gene is designed as: 5'-CCAGACTCCATTTAAGCCGCCCTCCCCCTCCCCTGAGCCATCTGGTTACCA CTAGTGAAGT TCCTATT CTCTAGAAAGTATAGGAACTTCAGGTCTGAAGAGGAGTTTA-3' (SEQ ID NO: 8), wherein the sequence " CTAGT The last "T" in the sequence is the last nucleotide of the mouse KIT gene connected to the 5' end of the Neo box. GAAGT The first "G" in the " is the first nucleotide of the Neo box; the connection between the 3' end of the Neo box and the mouse KIT gene is designed as: 5'-AGCTTGCGGAACCCTTCGAAGTTCCTATTCTCTAGAAAGTATAGGA ACTTCGCGGG AACTATCTTTC CTAATAGCGCAACACTGATCTTTTCGAGTTAGCACT-3' (SEQ ID NO: 9), wherein the sequence " ACTTC The last "C" in the sequence is the last nucleotide of the Neo box. GCGGG The first "G" in " is the first nucleotide connecting the mouse KIT gene to the 3' end of the Neo box. The mRNA sequence transcribed from the modified mouse KIT mutant gene is shown in SEQ ID NO: 1, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0266] The construction of the targeting vector can be carried out by conventional methods, such as enzyme digestion and ligation. After the constructed targeting vector is initially verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector verified by sequencing is electroporated and transfected into the embryonic stem cells of B-NDG mice, and the obtained cells are screened using the positive clone screening marker gene to screen the correct positive clone cells. The screened correct positive clone cells (black mice) are introduced into the separated blastocysts (white mice) according to the technology known in the art, and the obtained chimeric blastocysts are transferred to the culture medium for short-term culture and then transplanted into the uterus of the recipient mother mouse (white mouse), and F0 generation chimeric mice (black and white) can be produced. F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice, and then the F1 generation heterozygous mice are mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene, and then mated with each other to obtain KIT mutant gene homozygous mice. The positive mice were mated with immunodeficient mice (eg, B-NDG) for multiple times to screen out KIT gene mutant mice in the B-NDG background (referred to as B-NDG Kit).

[0267] In addition, CRISPR / Cas9 technology can be used for gene editing to further design the targeting vector V2( Figure 3 ), the targeting vector V2 contains upstream and downstream homology arm sequences of the mouse KIT gene, and a mouse KIT gene fragment containing the V813M mutation. Among them, the upstream 5' homology arm sequence (SEQ ID NO: 6) is identical to the nucleotide sequence of positions 75811423 to 75812743 of NCBI accession number NC_000071.7, and the downstream 3' homology arm sequence (SEQ ID NO: 7) is identical to the nucleotide sequence of positions 75814631 to 75815910 of NCBI accession number NC_000071.7. The nucleotide sequence of the mouse KIT fragment containing the V813M mutation (SEQ ID NO: 3) is at least 99% identical to the nucleotide sequence of positions 75812744 to 75814630 of NCBI accession number NC_000071.7. The mRNA sequence transcribed from the modified mouse KIT mutant gene is shown in SEQ ID NO: 1, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0268] Conventional methods can be used to construct the targeting vector, such as enzyme digestion, ligation, direct synthesis, etc. After the constructed targeting vector is initially verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector that is verified to be correct by sequencing is used for subsequent experiments.

[0269] The target sequence determines the targeting specificity of sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors. Design and synthesize sgRNA sequences that recognize target sites. The target sequence of an exemplary sgRNA on the KIT gene is as follows:

[0270] gRNA1 target site sequence (SEQ ID NO: 11): 5′-CTGCCTTATACCATGACGGCTGG-3′;

[0271] sgRNA2 target site sequence (SEQ ID NO: 12): 5′-GGAAAGATAGTTCCCGCAGATGG-3′;

[0272] The activity of sgRNA was detected by UCA kit. After confirming that it could mediate efficient cutting efficiency, restriction sites were added to its 5' end and complementary chain to obtain forward oligonucleotide and reverse oligonucleotide sequences as shown in Table 1. After annealing, the annealing products were connected to pT7-sgRNA plasmid (the plasmid was linearized with BbsI first) to obtain expression vectors pT7-KIT-1 and pT7-KIT-2.

[0273] Table 1 Sequence list of sgRNA1 and sgRNA2

[0274]

[0275] The pT7-sgRNA vector was synthesized by a plasmid synthesis company with a fragment DNA containing a T7 promoter and sgRNA scaffold (SEQ ID NO: 29) and connected to a backbone vector (source: Takara, item number 3299) by restriction digestion (EcoRI and BamHI) in sequence. The sequencing was verified by a professional sequencing company, and the results showed that the target plasmid was obtained. Take the pronuclear fertilized eggs of mice, such as B-NDG mice, and use a microinjector to pre-mix the in vitro transcription products of pT7-KIT-1 and pT7-KIT-2 plasmids (using the Ambion in vitro transcription kit, according to the instructions for transcription), the targeting vector and Cas9 mRNA and inject them into the cytoplasm or nucleus of the mouse fertilized eggs. Microinjection of fertilized eggs was performed according to the method in the Mouse Embryo Manipulation Experiment Manual (3rd Edition) (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs were transferred to culture medium for a short period of culture and then transplanted into the oviduct of the recipient mother mouse for development. The obtained mice (F0 generation) were hybridized and self-fertilized to expand the population and establish a stable KIT gene mouse strain.

[0276] Using NOD-Prkdc scid IL-2rγ nullWhen the fertilized eggs of NOD / scid mice are injected, the background of the KIT gene mutant mice is clear and highly immunodeficient because of their high degree of immunodeficiency. The fertilized eggs of NOD / scid mice are selected for injection, and the correctly identified mutants can be further combined with NOD-Prkdc scid IL-2rγ null Mice are mated or in vitro fertilized, and their offspring are screened. According to Mendel's law of inheritance, there is a certain probability of obtaining a heterozygous animal model (NOD / scid background) with KIT gene mutation and IL-2rg gene knockout. Then, the heterozygotes are mated with each other to obtain KIT gene mutant mice with severe immunodeficiency.

[0277] The PCR method can be used to identify the somatic cell genotype of F1 generation mice, and the F1 generation PCR-positive mice are subjected to Southern blot detection to confirm whether there is random insertion. The mouse tail is cut to extract genomic DNA, and the genome is digested with SpeI enzyme or SspI enzyme, transferred to a membrane, and hybridized. The LR probe (LR Probe) and the 3' probe (3'Probe) are located on the 5'UTR and downstream of the 3'UTR of the mouse KIT gene, respectively. The specific probes and target fragment lengths are shown in Table 2, and the exemplary results are shown in Table 2. Figure 4 As shown, combined with the PCR and sequencing results, 16 mice numbered F1-01 to F1-16 were positive mice. This shows that the present method can be used to construct KIT gene mutant mice that can be stably propagated and have no random insertions.

[0278] Table 2 Length of specific probes and target fragments

[0279] Restriction enzymes Probe Wild-type fragment size Recombinant sequence fragment size SspI 3'Probe 6.0kb 4.5kb SpeI LR Probe 12.3kb 7.6kb

[0280] LR Probe-F (SEQ ID NO: 21): 5'-GCCGTTGAACTGGCCAATTATTTG-3',

[0281] LR Probe-R (SEQ ID NO: 22): 5'-CCATTCGCAGTCCCTTTGAAAATC-3';

[0282] 3'Probe-F (SEQ ID NO: 23): 5'-CCTTCAGGACCCAAGACGTAAC-3',

[0283] 3'Probe-R (SEQ ID NO: 24): 5'-CTGTAAGGACAACACATGACCAC-3';

[0284] In addition, RT-PCR can be used to detect the expression of mRNA in KIT gene mutant mice. Specifically, 1 5-week-old male B-NDG mouse (+ / +) and 1 5-week-old male KIT gene mutant mouse (Mut / +) prepared in this embodiment were selected, lung and spleen tissues were obtained after euthanasia by cervical dislocation, and RT-PCR detection was performed using the primer sequences shown in Table 3. The detection results are shown in FIG. Figure 5 As shown. Figure 5 It can be seen that the 2552nd position of mRNA in the lungs and spleen of B-NDG mice is G, and the 2552nd position of mRNA in the lungs and spleen of KIT gene mutant mice is A, indicating that KIT gene mutant mice were successfully constructed.

[0285] Table 3 RT-PCR primer sequences and target fragment sizes

[0286]

[0287] Example 2: Immune reconstitution and verification of immunodeficient mice containing KIT gene mutations

[0288] Newly born B-NDG Kit mice (n=15) and B-NDG mice (n=9) were selected. On the second day after birth, B-NDG mice were irradiated (1.0 Gy) for myeloablation and then injected with 3×10 4 Human hematopoietic stem cells (HSC) were used to reconstruct the immune system in mice. The standard for successful reconstruction was that the proportion of hCD45+ in the total viable cells after lysing red blood cells was ≥25%. Blood was collected 6 weeks after injection and transplantation, and peripheral blood (PB) was collected for flow cytometry at 6, 8, 10, 12, 15, 18, 21 and 24 weeks to evaluate whether the reconstruction was successful. The weight of the mice was measured and the status of the mice was observed every week, and the survival status was recorded.

[0289] The experimental results showed that B-NDG Kit mice and B-NDG mice had better survival throughout the experimental period, and the weight of B-NDGKit mice was generally higher than that of B-NDG mice (see Figure 7 At the end of the experiment (week 28), the survival rate of B-NDG Kit mice was 86.7% and that of B-NDG mice was 77.8% (see Figure 8 ); and it was observed that the B-NDG Kit mice were in good condition, while many B-NDG mice had adverse events of varying degrees. Specifically, 5 / 9 B-NDG mice began to develop cataracts in weeks 6-8, of which 2 mice had cataracts disappear in weeks 10 and 15, respectively, and 1 / 9 B-NDG mice began to have ruffled hair in week 7.

[0290] The results of flow cytometry showed that cells expressing human leukocyte surface molecule markers (CD45+) were detected in all mice from the 6th week. From the data of the entire experimental period, the percentage of human leukocytes (WBC) and the proportion of successful reconstruction in B-NDG Kit mice were higher than those in B-NDG mice from the 15th week (see Fig. 9 ). The development of T cells (TC, CD3+), B cells (BC, CD19+), NK cells (NK, CD56+), monocytes (MC, CD14+), and classical dendritic cells (cDC, hCD11c+ / hHLA-DR+) in peripheral blood was further analyzed by flow cytometry (data not shown); the development of helper T cells (Th, CD4+), cytotoxic T cells (Tc, CD8+) and Treg cells (Treg, hFoxp3+) in T cells was further analyzed from 12 weeks (data not shown).

[0291] Flow cytometry gating strategy: Human leukocytes (WBC) were positioned as intact, single, live, hCD45+, mCD45- cells. Among human leukocyte populations, T cells (TC) were positioned as intact, single, live, hCD45+, mCD45-, hCD3+, hCD19- cells; among T cell subsets, helper T cells (Th) were positioned as intact, single, live, hCD45+, mCD45-, hCD3+, hCD19-, hCD4+ cells; cytotoxic T cells (Tc) were positioned as intact, single, live, hCD45+, mCD45-, hCD3+, hCD19-, hCD8+ cells; Treg cells (Treg) were positioned as intact, single, live, hCD45+, mCD45-, hCD3+, hCD19-, hFoxp3+ cells. B cells (BC) were defined as intact, single, live, hCD45+, mCD45-, hCD3-, hCD19+ cells. NK cells (NK) were defined as intact, single, live, hCD45+, mCD45-, hCD3-, hCD56+ cells. Myeloid cells were defined as intact, single, live, hCD45+, mCD45-, hCD33+ cells; within the myeloid cell population, monocytes (MC) were defined as intact, single, live, hCD45+, mCD45-, hCD33+, hCD14+ cells. Classical dendritic cells (cDC) were defined as intact, single, live, hCD45+, mCD45-, hCD19-, hCD56-, hCD14-, hCD11c+, hHLA-DR+ cells.

[0292] The above data indicate that the KIT gene mutant mice prepared by the present application can directly undergo HSC immune reconstruction without myeloablation, can effectively promote the development of human cells in vivo, and improve the transplantation rate of human tissues and cells. At the same time, compared with B-NDG mice, KIT gene mutant mice maintain the reconstructed immune system for a longer time and have a lower rate of adverse events in mice.

[0293] The reconstructed humanized immune system mice can be used to establish xenograft tumor models, which can be widely used in the screening of human drugs, pharmacodynamic studies, etc., to improve the clinical conversion rate of drugs. Specifically, after the B-NDG Kit mice successfully reconstruct the immune system (the proportion of hCD45+ in the total living cells after lysing red blood cells is ≥25%), tumor tissue is transplanted, and after the tumor grows to a certain volume, the mice are divided into groups and given medication. The tumor volume, mouse weight and death are measured regularly, which can be used to evaluate and screen the in vivo efficacy and in vivo safety of the drugs to be tested or their combinations.

[0294] Example 3: Pharmacodynamic Model

[0295] The KIT gene mutant mice prepared by the method can be used for the study of anemia. For example, a number of KIT gene mutant mice are randomly divided into a control group or a treatment group. The treatment group randomly selects a drug for treating anemia, and the control group is given an equal volume of normal saline. By measuring blood indicators such as hematocrit, hemoglobin, red blood cell count, mean corpuscular volume, and mean corpuscular hemoglobin, the in vivo safety and in vivo efficacy of the compound can be effectively evaluated.

[0296] 7-week-old wild-type C57BL / 6 mice, B-NDG mice, and homozygous B-NDG Kit mice were divided into 3 groups (n=6). After collecting peripheral blood from mice, the mice were euthanized, and the number and volume of red blood cells and nucleated red blood cells were detected, hemoglobin and hematocrit were measured, and the percentage of nucleated red blood cells, mean corpuscular volume, mean corpuscular hemoglobin content, mean corpuscular hemoglobin concentration, standard deviation of red blood cell volume distribution width, and coefficient of variation of red blood cell volume distribution width were calculated. The results of the determination and calculation are shown in Table 4. The results showed that compared with B-NDG mice, red blood cells and hemoglobin were significantly reduced in KIT mutant mice, and they had an anemic phenotype.

[0297] Table 4 Complete blood cell counts of C57BL / 6 mice, B-NDG mice, and KIT gene mutant mice

[0298] name unit C57BL / 6N mice B-NDG mice B-NDG Kit RBC Number of red blood cells <![CDATA[10 12 cells / L]]> 10.55±0.32 9.98±0.17 7.18±0.5 HGB Hemoglobin g / L 156.33±5.13 161.17±2.99 136.83±9.39 HCT Hematocrit ％ 49.35±1.38 50.73±0.82 42.27±2.76 MCV Mean corpuscular volume f 46.8±0.68 50.82±0.71 58.92±1.15 MCH Mean corpuscular hemoglobin content pg 14.83±0.1 16.15±0.31 19.08±0.26 MCHC Mean corpuscular hemoglobin concentration g / L 316.83±3.87 317.67±2.8 323.67±2.42 RDW-SD Standard deviation of red blood cell volume distribution width f 23.23±1.6 26.27±0.88 33.93±1.13 RDW-CV Coefficient of variation of red blood cell volume distribution width ％ 17.83±0.46 17.65±0.23 16.35±0.65 NRBC# Nucleated red blood cell count <![CDATA[10 9 cells / L]]> 0.03±0.02 0.02±0.01 0.02±0.01 NRBC% Percentage of nucleated red blood cells ％ 0.35±0.21 0.75±0.32 0.92±0.34

[0299] Flow cytometry was used to confirm the expression of KIT protein in phagocytes in mice. Specifically, bone marrow tissues of 6-week-old homozygous B-NDG mice and homozygous KIT gene mutant mice (B-NDG background) were selected and the leukocyte marker antibody Brilliant Violet 510 was used to detect the expression of KIT protein in phagocytes in mice. TM anti-mouse CD45Antibody (mCD45, purchased from Biolegend, 103138), neutrophil marker Brilliant Violet 650 TM anti-mouse Ly-6G Antibody (mLy-6G, purchased from Biolegend, 127641), dendritic cell marker Brilliant Violet 421 TM anti-mouse CD335 (NKp46) Antibody (mNKp46, purchased from Biolegend, 137612) and Brilliant Violet 711 TM anti-mouse CD11cAntibody (mCD11c, purchased from Biolegend, 117349), macrophage and monocyte marker PE / Cyanine7 anti-mouse F4 / 80Antibody (mF4 / 80, purchased from Biolegend, 123114) and BioLegend Brilliant Violet785 TM Anti-mouse / human CD11b Antibody (mCD11b, purchased from Biolegend, 101243) and anti-mouse KIT antibody APC anti-mouse CD117 (c-kit) Recombinant Antibody (purchased from Biolegend, 105811) were used for recognition and staining and then flow cytometry was performed. The results are shown in Table 5.

[0300] The results showed that in B-NDG mice and KIT gene mutant mice, neutrophils (NE), dendritic cells (DC), macrophages ( ) and monocytes (MC).

[0301] Table 5B-Expression of mKIT in phagocytes of NDG mice and KIT gene mutant mice

[0302] Cell Type B-NDG mice (%) KIT gene mutant mice (%) Neutrophils 9.11 5.37 Dendritic cells 10.67 7.90 Macrophages and monocytes 48.73 37.93

[0303] To detect whether KIT mutation affects the distribution of leukocyte subsets in the spleen, blood, and bone marrow, the frequencies of leukocyte subsets were detected by flow cytometry. Splenocytes, blood cells, and bone marrow cells of 8-week-old homozygous B-NDG mice and homozygous KIT gene mutation mice were obtained and labeled with BioLegend PerCP anti-mouse CD45 Antibody (purchased from Biolegend, 103130), and T cells were labeled with Brilliant Violet 421 TM anti-mouse CD3e Antibody (purchased from Biolegend, 100341) and FITC anti-Mouse CD19 (purchased from Biolegend, 115506), B cell marker Brilliant Violet 421 TM Anti-mouse CD3e Antibody (purchased from Biolegend, 100341) and FITCanti-Mouse CD19 (purchased from Biolegend, 115506), NK cell and dendritic cell marker CD335 (NKp46) Monoclonal Antibody (29A1.4) (purchased from eBioscience TM , 17-3351-82) and Brilliant Violet711 TM anti-mouse CD11c Antibody (purchased from Biolegend, 117349), monocyte and macrophage marker PE / Cyanine7 anti-mouse F4 / 80 Antibody (purchased from Biolegend, 123114) and BioLegendBrilliant Violet 785 TM anti-mouse / human CD11b Antibody (purchased from Biolegend, 101243), neutrophil marker Brilliant Violet 650 TM Anti-mouse Ly-6G Antibody (purchased from Biolegend, 127641) was used for identification and staining, and flow cytometry was performed. The results are shown in Fig. 6A -C.

[0304] The results showed that T cells, B cells, NK cells, dendritic cells (DC), monocytes (MC), macrophages (Macrophages, The percentages of neutrophils (NE) and leukocytes in B-NDG mice were similar to those in B-NDG mice, indicating that KIT mutation does not change the proportion and distribution of immune cells in the spleen, peripheral blood, and bone marrow.

[0305] Example 4: Preparation and application of double or multiple gene-modified mice

[0306] The KIT gene mutant mice prepared by the method can also be used to prepare mice modified with two genes or multiple genes. The fertilized egg cells of the KIT gene mutant mice can be selected for gene editing, and a mouse model modified with two genes or multiple genes of KIT and other genes can be further obtained. The homozygous or heterozygous KIT mice obtained by the method can also be mated with homozygous or heterozygous mice modified with other genes, and their offspring can be screened. According to Mendel's law of inheritance, there is a certain probability of obtaining heterozygous mice modified with two genes or multiple genes of KIT and other genes, and then the heterozygotes can be mated with each other to obtain homozygous mice modified with two genes or multiple genes. These mice modified with two genes or multiple genes can be used for research on implantation of heterologous cells, tissues and human pathology, drug screening, etc.

[0307] The non-human mammals of the present invention can also be obtained by using other gene editing systems and preparation methods, including but not limited to gene targeting technology based on embryonic stem cells, homologous recombination technology, zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology, homing endonuclease (megabase wide range ribozyme) or other molecular biology technology. This example takes the traditional gene homologous recombination technology as an example, and takes the partial replacement design as an example to explain how to use other methods to prepare KIT gene point mutation mice.

[0308] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0309] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0310] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for preparing a KIT gene-modified non-human animal, characterized in that: The non-human animal expresses a mutated KIT protein, and the mutated KIT protein comprises one or more amino acid mutations introduced into the non-human animal KIT protein.

2. The preparation method according to claim 1, characterized in that: The mutated KIT protein comprises an amino acid sequence in which the amino acid at position 831 of SEQ ID NO: 10 is mutated, preferably comprises a mutation of valine (V) at position 831 of SEQ ID NO: 10 to methionine (M); Further preferably, the mutated KIT protein is selected from one of the following groups: (A) all or part of the amino acid sequence shown in SEQ ID NO: 2; (B) has a degree of sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to the amino acid sequence set forth in SEQ ID NO:2; (C) differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, (D) having the amino acid sequence shown in SEQ ID NO: 2, including substitution, deletion and / or insertion of one or more amino acid residues.

3. The preparation method according to claim 1 or 2, characterized in that: The KIT gene sequence encoding the mutated KIT protein comprises one or more mutations introduced into exon 18 of the non-human animal KIT gene, preferably comprises a mutation at position 2552 of NM_021099.3, and more preferably a mutation from G to A at position 2552 of NM_021099.

3.

4. A method for preparing a KIT gene-modified non-human animal, characterized in that: The method comprises replacing a nucleotide sequence encoding an endogenous KIT region at an endogenous KIT locus of a non-human animal with a nucleotide sequence comprising a corresponding region of KIT encoding a mutation; Preferably, the mutated KIT corresponding region includes SEQ ID NO: 2 or positions 827-932 thereof, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 2 or positions 827-932 thereof.

5. The preparation method according to claim 4, characterized in that: The nucleotide sequence comprising the corresponding region of KIT encoding the mutation comprises all of exons 18-20, and preferably further comprises at least 100 bp of continuous nucleotides of introns 17-18 and / or at least 100 bp of continuous nucleotides of introns 20-21; Preferably, the nucleotide sequence of the KIT corresponding region comprising the mutation comprises SEQ ID NO: 3, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO:

3.

6. The preparation method according to claim 4 or 5, characterized in that: The nucleotide sequence comprising the mutated KIT corresponding region is operably linked to an endogenous regulatory element, such as a promoter and / or UTR; Preferably, the non-human animal does not express wild-type KIT protein; Preferably, the non-human animal is homozygous or heterozygous for exon 18 of the endogenous KIT gene.

7. The preparation method according to any one of claims 1 to 6, characterized in that: The non-human animal is a non-human mammal, such as a monkey, a rodent (preferably a mouse or a rat), and further preferably, the non-human animal is an immunodeficient mouse or a rat, and further preferably, the non-human animal is a NOD / scid mouse, a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - Mouse, Rag2 - / - -IL2rg - / - mice, nude mice or B-NDG mice; Preferably, the mRNA transcribed from the mutated KIT gene in the genome of the non-human animal comprises SEQ ID NO: 1 or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to SEQ ID NO:

1.

8. The preparation method according to any one of claims 1 to 7, wherein the non-human animal further comprises other genetic modifications; Preferably, the non-human animal genome further includes a mutation in the endogenous Prkdc gene and / or a disruption in the IL-2rg gene; Preferably, the non-human animal also expresses a human or chimeric protein, and the human or chimeric protein includes at least one of B2M, HLA-A, SIRPA, ALB, FcRn, IL15, F3, MSLN, CSF1, THPO, IL7, IL6, GPC3, MGMT3, SCF, CD47, IL2, FLT3LG, TROP2, HER3, ICOS, NKP46, HER2, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4.

9. A mutant KIT protein, characterized in that: The mutated KIT protein is selected from one of the following groups: (A) all or part of the amino acid sequence shown in SEQ ID NO: 2; (B) has a degree of sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to the amino acid sequence set forth in SEQ ID NO:2; (C) differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, (D) having the amino acid sequence shown in SEQ ID NO: 2, including substitution, deletion and / or insertion of one or more amino acid residues.

10. A KIT gene, characterized in that: The KIT gene encodes the mutated KIT protein according to claim 9; Preferably, the KIT gene sequence is a non-human animal KIT gene exon 18 comprising one or more mutations, preferably comprising a mutation at position 2552 of NM_021099.3, and more preferably a mutation from G to A at position 2552 of NM_021099.3; Preferably, the KIT gene sequence is selected from one of the following groups: (a) the transcribed mRNA sequence is part or all of the sequence shown in SEQ ID NO: 1; (b) having a degree of identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% to part or all of the nucleotide sequence set forth in SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9; (c) differs from the nucleotide sequence of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; or, (d) a nucleotide sequence having the nucleotide sequence shown in SEQ ID NO: 1, 3, 4, 5, 6, 7, 8 or 9, including substitution, deletion and / or insertion of one or more nucleotides.

11. A use of a non-human animal obtained by the preparation method according to any one of claims 1 to 8, characterized in that: The application includes: A) Application in product development involving immune processes in human cells; B) Application as a model system in pharmacology, immunology, microbiology and medical research; C) Applications involving the production and use of animal experimental disease models for human cell transplantation, immune system reconstruction, etiology research and / or for the development of new diagnostic and / or therapeutic strategies; D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human signaling pathway modulators; or, E) Research gene function, research human-targeted drugs and drug efficacy, and research the application of drugs in anemia, cancer, immune-related diseases or inflammation.

12. A method for reconstructing a human immune system, characterized in that: The method comprises administering human hematopoietic stem cells or human peripheral blood cells to an individual to reconstitute the immune system in a non-human animal, wherein the individual is selected from the non-human animal obtained by the preparation method according to any one of claims 1 to 8; Preferably, the human immune system comprises a human blood-lymphatic system, and further preferably, the human blood-lymphatic system comprises a human cell selected from hematopoietic stem cells, bone marrow precursor cells, bone marrow cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes or platelets; Preferably, in the peripheral blood of the non-human animal after transplantation of human hematopoietic stem cells to form a human immune system, the percentage of human leukocytes in the total living cells is greater than 25%-85% (for example, at 12, 15, 18, 21, 24 weeks or later after the non-human animal transplantation); Preferably, the non-human animal has not been irradiated prior to human hematopoietic stem cell transplantation.

13. A method for screening or evaluating drugs for human use, characterized in that: The method comprises administering a pharmaceutical agent to a non-human animal obtained by the preparation method according to any one of claims 1 to 8, preferably, injecting human peripheral blood cells (hPBMC) or human hematopoietic stem cells into the non-human animal before transplanting tumor cells into the non-human animal; Preferably, the tumor cell is a melanoma cell, a lung cancer cell (e.g., a primary lung cancer cell, a non-small cell lung cancer cell, a small cell lung cancer cell), a gastric cancer cell (e.g., a primary gastric cancer cell), a bladder cancer cell, a breast cancer cell, and / or a prostate cancer cell; Preferably, the agent comprises an antibody, and further preferably, the agent further comprises an additional therapeutic agent; More preferably, the antibody comprises one or more of anti-CD47 antibody, anti-PD-1 antibody, IL6 antibody or IL15 antibody; More preferably, the additional therapeutic agent comprises one or more of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel or capecitabine.

Images