Preparation method and application of mesenchymal stem cell exosome carrying miR-451a

Abstract

The invention belongs to the technical field of biological medicine, and discloses a preparation method and application of mesenchymal stem cell source exosome miRNA for promoting regeneration of damaged pulmonary alveolar stem cells, and the miRNA is miR-451a. According to the application, miRNA-451a for promoting regeneration of the damaged pulmonary alveolar stem cells is screened and verified on the basis of an exosome miRNA sequencing technology in combination with bioinformatics analysis. The mesenchymal stem cell source engineering exosome capable of efficiently expressing miRNA-451a is prepared, the effect of the exosome miRNA in regeneration of damaged pulmonary alveolar stem cells and treatment of interstitial pneumonia is verified at the preclinical level, and a certain guiding effect is achieved on treatment of pulmonary alveolar injury diseases such as interstitial pneumonia.

Description

Technical Field

[0001] The present invention relates to the field of biomedical molecular biology, and in particular to an application of exosome miRNA derived from umbilical cord mesenchymal stem cells in promoting the regeneration of damaged alveolar stem cells and treating diseases related to alveolar damage. Background Art Alveoli are tiny air sacs in the human body where O2 / CO2 exchange takes place, and they are always exposed to the external environment. Alveoli are mainly composed of alveolar epithelial type I cells (ATI) and alveolarepithelial type II cells (ATII). Among them, ATI is a large squamous cell, accounting for more than 90% of the entire alveolar surface area, connected to the capillaries in the alveoli, and providing a place for gas exchange; ATII is a stem cell for alveolar regeneration, which has important secretory and regenerative functions, can self-renew and differentiate into ATI, and plays an important role in maintaining the normal structure and function of the alveoli. The accumulation of stimulation from factors such as environmental exposure, smoking and viral infection can cause damage and exhaustion of alveolar stem cells, causing them to lose the ability to repair lung tissue, and then cause the occurrence of respiratory diseases such as asthma, interstitial pneumonia and chronic obstructive pulmonary disease. Clinically, the treatment options for such diseases mainly include chemical drugs and physical assisted training. However, the chemical drugs used in the above treatment options are limited to delaying the development of the disease and have varying degrees of side effects. Therefore, it is urgent to explore a method to promote alveolar regeneration and restore normal lung tissue structure. Summary of the invention The purpose of the present invention is to provide a method for preparing and applying mesenchymal stem cell-derived exosome miRNA that effectively promotes the regeneration of damaged alveolar stem cells. To achieve the above object, the present invention adopts the following technical solutions: The present application provides an umbilical cord mesenchymal stem cell (UC-MSC) exosome miR-451a for promoting the regeneration of damaged alveolar stem cells, characterized in that: the miRNA is miR-451a, and its sequence is shown in SEQ ID NO: 1, 5'-AAACCGUUACCAUUACUGAGUU-3' The present application also provides the use of exosomal miR-451a in the preparation of a drug for repairing damaged alveolar stem cells. Preferably, the miR-451a can repair damaged alveolar stem cells, promote alveolar regeneration, and restore normal lung tissue structure. The present application also provides a method for preparing engineered mesenchymal stem cell-derived exosomes loaded with overexpression of miR-451a, comprising the following steps: Step S001, constructing a lentiviral vector expressing the miR-451a precursor sequence by homologous recombination, packaging the lentivirus by a three-plasmid transfection method, and aliquoting and freezing the obtained lentiviral particles at -80°C for later use; Step S002: In a 6-well plate, 2.5×10 5 Cells were inoculated per well, and when the cell confluence reached 70-80%, the cells were treated with culture medium containing the virus Lenti-miR-451a, Lenti-NC and Polybrene, cultured in a CO2 incubator at 37°C for 6 hours, and then replaced with fresh cell culture medium; Step S003, after continuing to culture for 48 hours, treating the cells with a culture medium containing 1.0 μg / mL puromycin, replacing the culture medium every two days, and continuing screening for two weeks until the cells can grow normally in the culture medium containing 0.5 μg / mL puromycin; Step S004, inoculating umbilical cord mesenchymal stem cells stably expressing miR-451a in a 15 cm culture dish, culturing conventionally until the cell confluence reaches about 75%, removing the culture medium, washing twice with PBS, adding 30 mL of α-MEM culture medium containing 5% exosome-free serum, culturing for 48 h under 5% CO2, and collecting the supernatant; Step S006, using ultra-high speed centrifugation to obtain exosomes expressing miR-451a. Preferably, the specific steps of S006 are: First, the cell supernatant was obtained from S006, and the supernatant was removed by centrifugation at 2,000 g for 15 min at 4°C to remove the dead cell precipitate and retain the supernatant. Subsequently, the supernatant was removed by low-temperature centrifugation at 10,000 g for 30 min, the precipitate was discarded, and the supernatant was retained. The particles larger than 220 nm were filtered using a 0.22 μm PVDF microporous filter membrane. The supernatant was removed, 3 mL of cold PBS was added, the precipitate was gently blown evenly with a Pasteur pipette, cold PBS was added to make up to 50 mL, the mixture was gently mixed, and the mixture was placed in a refrigerator at 4°C for 12 h to remove the protein. The supernatant was removed by centrifugation at 100,000 g for 1.5 h at 4°C, and the precipitate was resuspended in 300 μL of cold PBS and stored at -80°C for later use. In this application, we used miRNA sequencing and combined it with bioinformatics analysis to further screen and verify the UC-MSC-derived exosome miR-451a that promotes the regeneration of damaged alveolar epithelial cells. The present invention can obtain a large number of UC-MSC-derived exosomes carrying miR-451a by preparing engineered exosomes expressing miR-451a, with high preparation efficiency, and verified the therapeutic effect and application value of the exosomes in the regeneration of damaged alveolar stem cells and the treatment of interstitial pneumonia at the preclinical level. The present invention provides a new treatment plan for the treatment of diseases related to alveolar damage and provides support for subsequent clinical transformation. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 The results of exosome transmission electron microscopy, particle size analysis and surface marker detection. Figure 2 The expression of miR-451a in cells and exosomes after Lenti-miR-451a infected UC-MSCs. Figure 3 Effects of exosomes carrying miR-451a on the activity and proliferation of damaged alveolar stem cells. Figure 4 Schematic diagram of the administration regimen of exosomal miR-451a and its role in preventing alveolar damage diseases. DETAILED DESCRIPTION In order to more clearly illustrate the technical solution implemented by the patent of the present invention, the present invention will be fully described below in conjunction with specific embodiments. A method for preparing mesenchymal stem cell-derived exosomes expressing miR-451a comprises the following specific steps: Step S001, design and synthesize the pre-miR-451a double-stranded oligonucleotide sequence, connect it to the lentiviral vector after annealing, and obtain a lentiviral expression vector expressing pre-miR-451a. 5 μg pVSV-G, 10 μg pCMV-Δ8 / 9 and 10 μg pre-miR-451a lentiviral vector were co-transfected into 293-T cells with a confluence of 90%. After 48 hours, the cell supernatant was collected and centrifuged at 30,000g for 2 hours at 4°C to collect the lentiviral particles, which were packaged and frozen at -80°C for later use; Step S002, inoculate 2.5×10 5 UC-MSC cells were added to each well. When the cell confluence reached 70-80%, the cells were treated with culture medium containing Lenti-miR-451a or Lenti-NC and Polybrene. The cells were cultured at 37°C in a CO2 incubator and fresh cell culture medium was replaced after 6 hours. Step S003, continue culturing for 48 hours, and screen for two weeks using α-MEM cell culture medium containing 1.0 μg / mL puromycin + 10% fetal bovine serum until the cells can grow normally in the culture medium containing 0.5 μg / mL puromycin, thereby obtaining UC-MSCs that stably express miR-451a. The expression level of miR-451a in UC-MSCs cells will be detected by qRT-PCR. The detection process is as follows: ① Extraction of total RNA: UC-MSCs stably expressing Lenti-miR-451a or Lenti-miR-NC were inoculated in 6-well plates. After 48 h, the culture medium was discarded and 1 mL of Trizol Regent was added to each well. The mixture was thoroughly mixed and placed on ice for 5 min. The lysate was transferred to a 1.5 mL centrifuge tube. 200 μL chloroform, shake vigorously for 15s, and let stand on ice for 5min; centrifuge at 12,000g for 15min, transfer the supernatant to a new 1.5mL centrifuge tube; add an equal volume of isopropanol, mix by inversion until there is no floc, and let stand on ice for 15min; centrifuge at 12,000g for 10min, discard the supernatant; add 1mL 75% ethanol to wash the RNA precipitate; centrifuge at 7,000g for 7min, discard the supernatant; dry, add 100μL DEPC water, and store at -80℃ for later use. ② Synthesize the first-strand cDNA of miRNA by tailing method (tailing and reverse transcription are completed in one step): miRNA 1 st Strand cDNA Synthesis Kit (by tailing A) Catalog No. MR201, perform A-tailed reverse transcription on the total RNA extracted in step ①. For detailed operations, please refer to the official instructions of Vazyme (https: / / www.vazyme.com / product / 621.html). (1) Prepare the following buffer in an RNase-free centrifuge tube: (The total RNA used in the reaction must contain miRNA) Mix by gently pipetting, centrifuge briefly, and incubate at 37°C for 60 min and 85°C for 5 min to obtain the first-strand cDNA of miRNA. ③ qRT-PCR detection of miR-451a expression level in umbilical cord mesenchymal stem cells Template cDNA 10μL Forward Primer (10μM) 0.4μL Reverse Primer (10μM) 0.4μL 2×AceQ qPCR SYBR Green Master Mix 10μL <![CDATA[ddH2O]]> To 20μL 95℃5min 95℃10s 60℃30s The temperature was adjusted to 95°C for 10 s and 60°C for 30 s for 40 cycles. U6 was selected as the internal control of miRNA. ④Primer information used in qPCR: miR-451a-F AAACCGTTACCATTACTGAGTT miR-451a-R CTCAGTAATGGTAACGGTTTTT U6-F CGCTTCGGCAGCACATATAC U6-R TTCACGAATTTGCGTGTCAT The specific process of preparing mesenchymal stem cell-derived exosomes carrying miR-451a is as follows: ① Collection of culture medium containing exosomes carrying miR-451a: UC-MSCs stably expressing miR-451a were inoculated in 15 cm culture dishes and cultured until the cell confluence was about 75%. The culture medium was removed, and the cells were washed twice with PBS. 30 mL of α-MEM culture medium containing 5% exosome-free serum was added, and the cells were cultured under 5% CO2 for 48 h, and the supernatant was collected. ②Remove dead cells: centrifuge at 2,000g for 15 minutes, retain the supernatant and remove dead cells; ③Remove cell debris: centrifuge at 10,000g for 30 minutes, retain the supernatant and discard the precipitate; ④Remove particles with larger particle size: 0.22μm PVDF microporous filter membrane to remove particles larger than 220nm; ⑤ Collect exosomes: centrifuge at 100,000g for 1.5h at 4℃, remove the supernatant and retain the precipitate; ⑥ Remove contaminated proteins: Add 3 mL of cold PBS, gently blow the precipitate with a Pasteur pipette, add cold PBS to 50 mL, gently mix upside down, and place in a 4°C refrigerator for 12 hours to remove proteins; ⑦ Collection and storage of exosomes: Centrifuge at 100,000g for 1.5h at 4℃, remove the supernatant, resuspend the precipitate in 300μL of cold PBS, take a portion of the exosomes for projection electron microscopy observation and particle size analysis, and store the rest at -80℃ for future use. Example 1 Identification of mesenchymal stem cell-derived exosomes carrying miR-451a: ① Observation of exosomes by transmission electron microscopy: 10 μL of exosome suspension was dropped onto the TEM grid, with the coating surface facing the exosomes; ② Dry at room temperature for 20 minutes, remove excess exosomes with filter paper, and wash once with PBS; ③Fix with 1% glutaraldehyde for 5 minutes; ④ Wash with distilled water 7 times, 2 minutes each time; ⑤Stain with 2% uranyl acetate for 1 min, wash once with PBS, dry at room temperature, and observe the morphology and size of exosomes using transmission electron microscopy. Figure 1The exosomes obtained by transmission electron microscopy were in the shape of biconcave disks with a particle size of about 100nm; the results of nanoparticle size analysis showed that the exosome particle size was mainly distributed between 60-120nm; protein immunoblotting results showed that exosomes expressed positive markers HSP70, CD9, and TSG101, but did not express the negative marker Calnexin, indicating that the engineered exosomes were successfully prepared. Example 2: Expression of miR-451a in cells after exosomes carrying miR-451a infect damaged alveolar epithelial cells. Bleomycin (BLM) is a glycoprotein isolated from Streptomyces verticillatus and is clinically an anticancer drug. BLM can target alveolar stem cells, causing cell DNA breakage and acute lung injury. In this application, we used 10 μg / mL of BLM to treat A549 cells with a human alveolar type II cell phenotype in a 6-well plate for 24 hours, and then incubated the damaged A549 cells with 1 μg of exosomes carrying miR-451a. After 24 hours, the total RNA in the cells was extracted using the Trizol method, and the expression of miR-41a was detected by qRT-PCR. The results are shown in Figure 2 As shown, after A549 cells were treated with exosomes carrying miR-451a, the expression of miR-451a in cells was significantly increased. Example 3: Mesenchymal stem cell-derived exosomal miR-451a promotes the proliferation ability of damaged alveolar epithelial cells. 90 μL of DMEM complete medium containing 3,000 A549 cells was added to each well of the 96-well plate, and cultured at 37°C in a CO2 incubator for 12 hours. 90 μL of complete medium containing 20 μg / mL BLM was added to make the final concentration 10 μg / mL. After 24 hours, 0.1 μg of exosomes carrying miR-451a and miR-NC or an equal volume of saline was added to each well. CCK-8 detection was performed at 0, 24, 48, 72, and 96 hours: 20 μL of CCK-8 solution was added to each well, and the culture was continued for 2 hours. The absorbance was measured at 450 nm. The results are shown in Figure 2. Figure 3 As shown, compared with the injured group, exosomes carrying miR-451a can significantly promote the proliferation ability of damaged A549 cells. Example 4: Mesenchymal stem cell-derived exosomes carrying miR-451a inhibit inflammatory response and pulmonary fibrosis caused by damage to alveolar type II cells. BLM mainly targets alveolar type II cells, and the acute lung injury it causes mainly includes three stages: epithelial damage, inflammatory infiltration, and tissue remodeling, which is similar to the process of human pulmonary fibrosis. In this application, we used a Micro-Sprayer nebulizer to aerosolize 50 μL of BLM (1.5 U / kg) or normal saline into the lung tissue of C57BL / 6 mice. On the second day after BLM treatment of mice, the mice were given 2.0 μg / 50 μL of exosomes carrying miR-451a or miR-NC by tracheal instillation under anesthesia. Two weeks after BLM treatment of mice, hematoxylin-eosin staining (H&E staining) was used to detect pathological changes in the lung tissue of mice. Results Figure 4 As shown in the results, the present study found that the lung tissue of mice in the BLM treatment group showed severe alveolar collapse, inflammatory cell infiltration and interstitial thickening, with obvious interstitial thickening and collagen fiber deposition; at the same time, the hydroxyproline content and inflammatory factors in the lung tissue of mice increased significantly. Exosomes carrying miR451a can significantly inhibit the inflammatory response and pulmonary fibrosis caused by damaged alveolar stem cells. In summary, this application screened out differential miRNAs in mesenchymal stem cell-derived exosomes based on miRNA sequencing technology, and screened out exosome miR-451a that promotes the proliferation of damaged alveolar stem cells through in vitro experiments. The present invention can prepare a large number of exosomes that meet the needs of preclinical experiments by preparing engineered mesenchymal stem cell-derived exosomes that overexpress miR-451a, with high preparation efficiency, providing a new solution for the treatment of alveolar damage-related diseases.

Claims

1. A method for preparing mesenchymal stem cell exosomes carrying miR-451a, characterized in that The following steps are involved: Step 1, constructing a lentiviral vector expressing the miR-451a precursor sequence by homologous recombination, packaging the lentivirus by a three-plasmid transfection method, and aliquoting the obtained lentiviral particles and freezing them at -80°C for later use; Step 2: In a 6-well plate, 2.5 × 10 5 Mesenchymal cells were inoculated per well, and when the cell confluence reached 70-80%, the mesenchymal cells were treated with culture medium containing the virus Lenti-miR-451a, Lenti-NC and Polybrene, and cultured in a CO2 incubator at 37°C for 6 hours, and then replaced with fresh cell culture medium; Step 3, after continuing to culture for 48 hours, using puromycin to select umbilical cord mesenchymal stem cells that stably express miR-451a; Step 4, collecting the supernatant of umbilical cord mesenchymal stem cells that stably express miR-451a, and obtaining umbilical cord mesenchymal stem cell-derived exosomes expressing miR-451a by ultracentrifugation.

2. The method for preparing mesenchymal stem cell exosomes carrying miR-451a according to claim 1, characterized in that The cell culture medium used in step 4 is α-MEM medium + 5% fetal bovine serum without exosomes.

3. The method for preparing mesenchymal stem cell exosomes carrying miR-451a according to claim 2, characterized in that The specific steps in step 4 are: collecting the supernatant of umbilical cord mesenchymal stem cells that stably express miR-451a, centrifuging at 2,000g for 15 minutes at 4°C to remove dead cells; and centrifuging at 10,000g for 30 minutes to remove cell debris; Filter with 0.22μm PVDF microporous membrane to remove particles larger than 220nm; centrifuge at 100,000g for 1.5h at 4℃; remove the supernatant, add 3mL of cold PBS, pipette and add PBS to 50mL, mix gently up and down, and let stand in a 4℃ refrigerator for 12h to remove protein; centrifuge at 100,000g for 1.5h at 4℃; remove the supernatant, resuspend the precipitate with 300μL of cold PBS, and store at -80℃ for later use.

4. A mesenchymal stem cell exosome carrying miR-451a is used in the preparation of a preparation for promoting the regeneration of damaged alveolar stem cells or repairing damaged alveolar stem cells.

5. The use of a mesenchymal stem cell exosome carrying miR-451a as claimed in claim 4 in the preparation of a preparation for promoting the regeneration of damaged alveolar stem cells or repairing damaged alveolar stem cells, characterized in that: The sequence of miR-451a is shown in SEQ ID NO: 1, which is 5'-AAACCGUUACCAUUACUGAGUU-3'.

6. The use of a mesenchymal stem cell exosome carrying miR-451a as claimed in claims 4-5 in the preparation of a preparation for promoting the regeneration of damaged alveolar stem cells or repairing damaged alveolar stem cells, characterized in that: The exosomes are derived from the supernatant obtained from the umbilical cord mesenchymal stem cell culture medium.

7. Use of mesenchymal stem cell exosomes carrying miR-451a in the preparation of drugs for treating alveolar damage-related diseases.

8. The use of a mesenchymal stem cell exosome carrying miR-451a as claimed in claim 7 in the preparation of a drug for treating alveolar damage-related diseases, characterized in that: The sequence of miR-451a is shown in SEQ ID NO: 1, which is 5'-AAACCGUUACCAUUACUGAGUU-3'.

9. The use of a mesenchymal stem cell exosome carrying miR-451a as claimed in claims 7-8 in the preparation of a drug for treating alveolar damage-related diseases, characterized in that: The exosomes are derived from the supernatant obtained from the umbilical cord mesenchymal stem cell culture medium.

Images