Three-generation DNA library building method based on PacBio platform

Abstract

The invention provides a third-generation DNA library building method based on a PacBio platform, belongs to the technical field of biology, and particularly relates to removal of non-target fragments in library construction, and the method can effectively remove non-dumbbell library fragments in a PacBio library, improve the proportion of a complete dumbbell library in a total library and obtain a high-quality sequencing library.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a third-generation DNA library construction method based on the PacBio platform, which can effectively increase the proportion of complete dumbbell-shaped libraries and obtain high-quality sequencing libraries. Background Art

[0002] With the development of life science technology, gene sequencing has gradually matured and sequencing throughput has increased significantly. The third-generation sequencing system Sequel & Sequel II is based on PacBio single-molecule real-time sequencing technology (SMRT), which is currently a relatively mature third-generation sequencing technology with long read length, high consistent accuracy, single-molecule sequencing, etc. It avoids sequencing bias introduced by PCR and can obtain base modification information while sequencing. NGS and third-generation sequencing technologies are widely used in pathogen detection and vaccine research. In addition, PacBio transcriptome sequencing is conducive to the identification of gene subtypes, and because it can sequence full-length transcripts or fragments with significant lengths, it helps to reliably discover new genes and annotate new subtypes of genes. PacBio third-generation library construction is to connect PacBio adapters with hairpin structures at both ends of double-stranded DNA molecules that have been broken to a certain length (10-20kb or longer), so that the DNA molecules form a "dumbbell-shaped" SMRTbell library. During sequencing, the polymerase emits fluorescent signals under the action of fluorescently labeled bases and is collected by the camera (CCD). This process is repeated on the circularized library to complete the sequencing. However, the premise of accurate detection is to build a high-quality library. The decisive factor for the quality of the library in library construction is the connection between the adapter and the template. Therefore, it is very important to develop an efficient and accurate method to obtain a complete library connected to the double-ended adapter.

[0003] In the construction of the third generation library, the standard method for removing incomplete fragments (non-dumbbell library fragments) is to perform enzyme digestion on the fragments that are not connected to the complete double-ended adapter after the adapter is connected, but this method cannot effectively determine the digestion efficiency and the proportion of the complete library, and has many disadvantages. In order to overcome the defects of the prior art, the present application provides a new method for removing incomplete libraries, thereby constructing a high-quality PacBio third-generation sequencing library. Summary of the invention

[0004] The present invention provides a method for removing non-dumbbell-shaped library fragments during the construction of a third-generation library, which uses affinity tags to capture and remove non-target fragments. The method of the present application is simple to operate, does not require enzyme digestion of the ligated products, and can obtain a high-quality sequencing library.

[0005] In a first aspect, the present application provides a method for removing non-dumbbell-shaped library fragments during the construction of a third-generation library, the method comprising adding a first affinity tag to the non-dumbbell-shaped library fragments, and then capturing and removing the non-dumbbell-shaped library fragments containing the first affinity tag by a second affinity tag, wherein the first affinity tag and the second affinity tag can form an affinity bond.

[0006] In some embodiments, the first affinity tag is connected to a deoxyribonucleoside triphosphate or a nucleic acid fragment to form a deoxyribonucleoside triphosphate containing a first affinity tag or a nucleic acid fragment containing a first affinity tag, and the second affinity tag is connected to a solid phase carrier to form a solid phase carrier containing a second affinity tag. In some embodiments, the deoxyribonucleoside triphosphate or nucleic acid fragment is connected to at least one first affinity tag, and the solid phase carrier is connected to at least one second affinity tag; preferably, the deoxyribonucleoside triphosphate or nucleic acid fragment is connected to 2, 3 or 4 first affinity tags, and the solid phase carrier is connected to 2, 3 or 4 second affinity tags. In some embodiments, the solid phase carrier comprises at least one of glass microspheres, silica films, metal nanoparticles, inorganic microspheres, organic hybrid microspheres, and magnetic beads; preferably, the solid phase carrier is a magnetic bead.

[0007] In some embodiments, the first affinity tag comprises one or more of biotin, biotin derivatives, biotin analogs, protein antigens, proteases, and protein ligands; the second affinity tag comprises one or more of avidin, streptavidin, protein antibodies, protease inhibitors, and protein receptors; preferably, the first affinity tag is biotin or a biotin derivative, and the second affinity tag is streptavidin or avidin. In some embodiments, the first affinity tag comprises one or more of avidin, streptavidin, protein antibodies, protease inhibitors, and protein receptors; the second affinity tag comprises one or more of biotin, biotin derivatives, biotin analogs, protein antigens, proteases, and protein ligands; preferably, the first affinity tag is streptavidin or avidin, and the second affinity tag is biotin or a biotin derivative.

[0008] In some embodiments, the method comprises adding a deoxyribonucleoside triphosphate containing a first affinity tag or a nucleic acid fragment containing a first affinity tag to a non-dumbbell library fragment under the action of an enzyme to obtain a non-dumbbell library fragment containing a first affinity tag. In some embodiments, the deoxyribonucleoside triphosphate containing a first affinity tag is added to the 3' end of the non-dumbbell library fragment. In some embodiments, the 3' end of the non-dumbbell library fragment is the 3' end of any end of the non-dumbbell library fragment. In some embodiments, the 3' end of the non-dumbbell library fragment is the 3' end of the gap in the non-dumbbell library fragment. In some embodiments, the nucleic acid fragment containing the first affinity tag is added to any end of the non-dumbbell library fragment.

[0009] In some embodiments, the enzyme is a non-template-dependent DNA polymerase. In some embodiments, the non-template-dependent DNA polymerase is a terminal deoxynucleotidyl transferase or a Phi29 DNA polymerase; preferably, the non-template-dependent DNA polymerase is a terminal deoxynucleotidyl transferase.

[0010] In some embodiments, the deoxyribonucleoside triphosphate comprises one or more of dATP, dCTP, dTTP, dGTP, dUTP; preferably, the deoxyribonucleoside triphosphate is dATP.

[0011] In some embodiments, the method comprises adding the deoxyribonucleoside triphosphate containing the first affinity tag to the 3' end of the non-dumbbell library fragment under the action of a non-template-dependent DNA polymerase, and then capturing and removing the non-dumbbell library fragment containing the first affinity tag at the 3' end through the solid phase carrier containing the second affinity tag. In some embodiments, the non-template-dependent DNA polymerase is a terminal deoxynucleotidyl transferase. In some embodiments, the 3' end of the non-dumbbell library fragment is the 3' end of any end of the non-subling library fragment. In some embodiments, the first affinity tag is biotin and the second affinity tag is streptavidin. In some embodiments, the concentration of the deoxyribonucleoside triphosphate in the reaction system is 10-20 μM.

[0012] In some embodiments, the enzyme is a ligase. In some embodiments, the ligase is a DNA ligase and / or an RNA ligase; preferably, the enzyme is a DNA ligase. In some embodiments, the DNA ligase comprises at least one of Escherichia coli DNA ligase, T4 DNA ligase, T7 DNA ligase, T3 DNA ligase, Taq DNA ligase, or Ampligase DNA ligase; preferably, the DNA ligase is T4 DNA ligase.

[0013] In some embodiments, the nucleic acid fragment comprises one or more of a double-stranded DNA fragment, a single-stranded DNA fragment, a double-stranded RNA fragment, a single-stranded RNA fragment, and a DNA and RNA hybrid double-stranded fragment; preferably, the nucleic acid fragment is a double-stranded DNA fragment.

[0014] In some embodiments, the double-stranded DNA fragment is 20-100 bp in length, wherein at least one end is a sticky end; preferably, the sticky end is a sticky end with a protruding T base at the 3' end. In some embodiments, the other end of the double-stranded DNA fragment is a blunt end, a sticky end, a closed end or a Y-shaped end; preferably, when the other end of the double-stranded DNA fragment is a blunt end, its 3' end contains a blocking group. In some embodiments, the concentration of the double-stranded DNA fragment in the reaction system is 1-10 μM; preferably, the concentration is 2-5 μM.

[0015] In some embodiments, the method comprises ligating the nucleic acid fragment containing the first affinity tag to the end of the non-dumbbell-shaped library fragment under the action of a ligase, and then capturing and removing the non-dumbbell-shaped library fragment containing the first affinity tag by the solid phase carrier containing the second affinity tag; preferably, the ligase is DNA ligase, the first affinity tag is biotin, and the second affinity tag is streptavidin.

[0016] In some embodiments, the non-dumbbell-shaped library fragments comprise one or more of a hairpin adapter, a library fragment with a hairpin adapter connected to only one end, a library fragment with no hairpin adapter connected to both ends, or a library fragment with a hairpin adapter connected to both ends but containing a gap.

[0017] The second aspect of the present application provides a method for constructing a large DNA fragment library of the Pacbio platform, the method comprising:

[0018] 1) obtaining a target double-stranded DNA, and optionally fragmenting the target DNA into 5-20 kb;

[0019] 2) Perform end repair on the broken DNA fragments;

[0020] 3) Optionally, an A-tailing reaction is performed after the end repair step;

[0021] 4) Connecting the hairpin connector to obtain a connector-connected product;

[0022] 5) Optionally, purifying the product after the linker ligation;

[0023] 6) using the method described in the first aspect of the present application to remove non-dumbbell-shaped library fragments;

[0024] 7) Purify the library after removing the non-dumbbell-shaped library fragments.

[0025] In some embodiments, the hairpin linker is a blunt end or a sticky end; preferably, the hairpin linker is a sticky end.

[0026] The third aspect of the present application provides a kit for constructing a PacBio sequencing library by the method described in the second aspect of the present application.

[0027] In some embodiments, the kit comprises one or more of a fragmentation reagent module, a repair reagent module, a purification reagent module, and a ligation reagent module. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1A : 2100 peak profile of the purified product after connector connection in Example 1;

[0029] Figure 1B : Peak shape diagram of the supernatant product 2100 after the streptavidin magnetic beads are captured in Example 1;

[0030] Figure 2A : 2100 peak profile of the purified product after the adapter ligation product was ligated to the A fragment in Example 3;

[0031] Figure 2B : Peak shape diagram of the supernatant product purification after the streptavidin magnetic beads captured the non-dumbbell-shaped library fragments in Example 3. DETAILED DESCRIPTION

[0032] The technical solution of the present application is further explained below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are merely simple examples of the present application and do not represent or limit the scope of protection of the present application. The scope of protection of the present application shall be subject to the claims.

[0033] In the following examples, unless otherwise specified, all reagents and consumables used were purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used were conventional methods and means in the field.

[0034] Example 1: Adding biotin-modified dATP to non-dumbbell-shaped library fragments and verifying the efficiency of streptavidin magnetic beads in capturing non-dumbbell-shaped library fragments

[0035] Using 264bp double-stranded DNA (derived from Nanjing Novozymes ND607-AF component) as the simulation fragment, biotin-modified dATPs (thermo product 19524016) and PacBio third-generation library construction kit (PacBio product 102-182-700) were used to construct the third-generation library of the short fragment, and the efficiency of streptavidin magnetic beads in capturing biotin-modified non-dumbbell library fragments was studied.

[0036] 1. End repair and A-tailing reaction of simulated fragments

[0037] Prepare the final trimming and A-tailing system according to Table 1.

[0038] Table 1: End-of-revision and A-end system

[0039] Components volume 264bp simulated DNA fragment (50ng / μl) 16μl Repair buffer 8μl End repair mix 4μl DNA repair mix 2μl <![CDATA[ddH2O]]> 30μl Total 60μl

[0040] Use a pipette to gently pipette to mix, centrifuge briefly to collect the reaction solution at the bottom of the tube, place the reaction tube in a PCR instrument, and perform the reaction according to Table 2.

[0041] Table 2: End-repair and A-tailing reaction procedures

[0042] Reaction temperature Reaction time Heating cover 105℃ / 20℃ 20min 65℃ 15min 4℃ Hold

[0043] 2. Connector connection

[0044] The products of the previous step were connected with hairpin connectors according to the preparation system in Table 3.

[0045] Table 3: Joint connection system

[0046] Components volume The product of the previous step 60μl Ligation mix 30μl Ligation Enhancer 1μl Adapter 4μl Total 95μl

[0047] Place the above reaction system in a PCR instrument and perform the reaction according to Table 4.

[0048] Table 4: Adapter ligation reaction procedure

[0049] Reaction temperature Reaction time Heating cover 105℃ / 20℃ 30min 4℃ Hold

[0050] 3. Magnetic bead purification

[0051] The product after connector connection was purified by magnetic beads using Nanjing Novozymes N411 magnetic bead purification product. Magnetic bead purification was performed according to the N411 product manual. DNA was eluted with 45 μl sterile ultrapure water to obtain 40 μl of purified product. The output of the purified library was detected using the Qubit instrument, and the library peak shape was detected using the Agilent 2100 instrument.

[0052] 4. Add biotin-containing dATP to non-dumbbell library fragments

[0053] The above-mentioned purified library includes a dumbbell-shaped library with adapters connected to both ends (complete dumbbell-shaped library), and also includes a non-dumbbell-shaped library with only one end connected to an adapter and no adapters connected to both ends (non-dumbbell-shaped library). The terminal transferase TDT is used to add dNTPs containing biotin modification to the 3' hydroxyl end of the non-dumbbell-shaped library fragment, so that the non-dumbbell-shaped library fragment contains biotin modification. In this embodiment, dATP containing biotin is used for experiments. The reaction system is prepared according to Table 5.

[0054] Table 5: Reaction system for adding biotin-modified dATP

[0055] Components volume Purified product from the previous step 40μl TDT (Novozyme, A111) 1μl 10×Buffer 5μl dATP-Biotin(1nM) 1μl Total 50μl

[0056] Use a pipette to gently pipette and mix, centrifuge briefly to collect the reaction solution at the bottom of the tube. Place the reaction tube in a PCR instrument and perform the reaction according to Table 6.

[0057] Table 6: Reaction procedure for adding biotin-modified dATP

[0058] Reaction temperature Reaction time Heating cover 105℃ / 37℃ 60min 4℃ Hold

[0059] The above product was purified by magnetic beads using Nanjing Novozymes N411 magnetic bead purification product according to the N411 product manual. DNA was eluted using 23 μl sterile ultrapure water to finally obtain 20 μl of purified product. The purified library output was detected using the Qubit instrument.

[0060] 5. Evaluating the efficiency of streptavidin beads in capturing non-dumbbell libraries

[0061] According to the instructions of Novozyme N512 product, the above-mentioned purified product was subjected to the streptavidin magnetic bead capture step, and finally the supernatant was subjected to magnetic bead purification and eluted with 23 μl sterile ultrapure water to finally obtain 20 μl of purified product. The output of the purified library was detected using the Qubit instrument, and the library peak shape was detected using the Agilent 2100 instrument.

[0062] 6. Results Analysis

[0063] Figure 1A 2100 is the peak diagram of the purified product after adapter ligation. The figure shows that there are 5 fragment peaks of different lengths, among which the 15bp peak represents the Lower marker, the 1500bp peak represents the Up marker, the 261bp peak represents the simulated fragment without hairpin adapters at both ends, the 306bp peak represents the simulated fragment with only one end connected to the hairpin adapter, and the 366bp peak represents the simulated fragment with both ends connected to the hairpin adapter. Figure 1A It can be seen that not all simulated fragments can be connected to the hairpin connector during connector connection. The connector connection products include dumbbell-shaped library fragments (both ends are connected to hairpin connectors) and non-dumbbell-shaped library fragments (containing only a single-end hairpin connector or no hairpin connectors at both ends).

[0064] Figure 1BThis is a peak diagram of the supernatant product after using streptavidin magnetic beads to capture non-dumbbell library fragments containing biotin. The figure shows that there are 3 fragment peaks of different lengths, among which the 15bp peak represents the Lower marker, the 1500bp peak represents the Upmarker, and the 369bp peak represents the simulated fragment with hairpin adapters connected at both ends. This shows that after capture with streptavidin magnetic beads, the supernatant only contains the library with both ends of the simulated fragment connected to the hairpin adapter, that is, the complete dumbbell library. This means that by adding biotin-containing dATPs to the non-dumbbell library fragments and then using streptavidin magnetic beads to remove the non-dumbbell library, high-purity complete dumbbell library fragments can be obtained.

[0065] Example 2: Comparison of the effects of enzyme digestion and addition of biotin dNTPs on library sequencing results by removing non-dumbbell-shaped library fragments

[0066] λDNA (NEB N3011L) was used as a template for library construction. The λDNA was sheared using g-Tube (Covaris 520079) consumables to construct a third-generation PacBio platform library. The hairpin adapter ligation product was purified and divided into two parts. One part was treated with conventional enzyme digestion to digest the non-dumbbell-shaped library fragments. The other part was treated with TDT enzyme to add biotin-containing dATP to its 3', and then captured using streptavidin magnetic beads to remove non-dumbbell-shaped library fragments containing biotin dATP. The effects of the two methods on library construction were compared.

[0067] The steps for shearing λDNA using g-Tube consumables are as follows: add 150μl (8μg) of λDNA sample to the g-Tube; centrifuge at 7200rpm for 1min; ensure that there is no liquid remaining in the upper well chamber. If there is still liquid remaining, centrifuge again at 7200rpm for 1min. If there is still a small amount of liquid remaining, centrifuge at 7200rpm until there is no liquid remaining in the upper centrifugal column; invert the g-Tube and centrifuge at 7200rpm for 1min until there is no liquid remaining in the upper well chamber; transfer the sample to a 1.5ml EP tube for later use.

[0068] The above-mentioned disruption reaction product was purified by magnetic beads using N411, and eluted with 45 μl of sterile ultrapure water to finally obtain 40 μl of purified product. The purified product was evenly divided into 4 portions, each with 10 μl.

[0069] According to the method of Example 1, the above 4 purified products of the broken fragments were subjected to end repair, hairpin adapter ligation and ligation product purification respectively, and the 4 purified products of adapter ligation were mixed and then evenly divided into 4 tubes, each with 40 μl.

[0070] Two of the tubes were subjected to the method of Example 1 (two repeated experiments), biotin-modified dATP was added to the purified product, and the biotin-containing non-dumbbell-shaped library fragments were captured using streptavidin magnetic beads, and the supernatant was purified to obtain a sequencing library.

[0071] The other two tubes of hairpin connectors were connected to the purified products and the non-dumbbell-shaped library fragments were removed by enzyme digestion according to the product instructions of the PacBio third-generation library construction kit (PacBio 102-182-700) (two repeated experiments were performed). The specific steps are as follows:

[0072] Prepare the enzyme digestion system according to Table 7, and perform the corresponding reaction program in the PCR instrument according to Table 8.

[0073] Table 7: Enzymatic digestion reaction system

[0074]

[0075]

[0076] Table 8: Enzymatic digestion reaction program

[0077] Reaction temperature Reaction time Heating cover 105℃ / 37℃ 15min 4℃ Hold

[0078] The above enzyme digestion product was purified by magnetic beads and eluted with 23 μl of sterile ultrapure water to finally obtain 20 μl of purified product.

[0079] The products obtained by the above two methods were sequenced separately on the Sequel II sequencing platform. The data obtained by sequencing are shown in Table 9.

[0080] Table 9: Sequencing result data

[0081]

[0082] Among them, the ccs Numbers in the library data obtained by the conventional enzyme digestion method were 896970 and 906857, with an average value of 901914. The ccs Numbers in the library data obtained by the magnetic bead grabbing method were 987576 and 992456, with an average value of 990016. It can be seen that the ccsNumber value in the library data obtained by the magnetic bead grabbing method increased by 10%. The higher the ccs Number value, the more high-quality reads there are in the data. From the ccsNumber data, it can be seen that the complete dumbbell-shaped library obtained by removing the incomplete library fragments by the magnetic bead grabbing method has a higher yield. The HiFi reads obtained from the offline data were sorted from long to short according to the fragment length. The N50 length value represents the read length when the length accumulated to the reads is not less than 50% of the total length. As can be seen from Table 9, the N50 of the offline data of the library obtained by the conventional enzyme digestion method was 9567 and 9434, respectively, with an average value of 9500. The N50 of the offline data of the library obtained by the magnetic bead capture method was 9743 and 9720, respectively, with an average value of 9731. The N50 length value increased by 10%, indicating that the more long fragments in the sequencing library, the higher the quality of the final assembled genome.

[0083] Example 3: Adding biotin-modified fragments to non-dumbbell-shaped libraries and verifying the efficiency of streptavidin magnetic beads in capturing non-dumbbell-shaped library fragments

[0084] Using 264bp double-stranded DNA (derived from Nanjing Novagen ND607-AF component) as the simulation fragment, the PacBio library construction kit (PacBio product 102-182-700) was used to construct the third-generation library of the short fragment. Among them, Novagen N103 ligase product was used to connect the non-dumbbell library fragments with the biotin-modified nucleic acid fragments to study the efficiency of streptavidin magnetic beads in capturing the biotin-modified non-dumbbell library fragments.

[0085] According to the method of Example 1, the simulated fragment was subjected to end repair and A-tailing reaction, adapter ligation and ligation product purification, and the adapter ligation purification product was ligated with the double-stranded DNA fragment (A fragment) modified with biotin. The reaction system was prepared according to Table 10, and the reaction was carried out according to the procedure of Table 11.

[0086] Table 10: Reaction system for ligating biotin-modified fragments

[0087] Components volume Connector ligation purification product 10μl T4 DNA Ligase 2.5μl 2×Rapid Ligation Buffer 15μl A fragment (10μM) 2.5μl Total 30μl

[0088] Table 11: Reaction procedure for ligating biotin-modified fragments

[0089] Reaction temperature Reaction time Heating cover 105℃ / 30℃ 10min 4℃ Hold

[0090] Among them, fragment A is a Y-shaped linker, and its first chain (F chain) is SEQ ID NO: 1 (CGGGGTTTACCTTACCGAAATCGGTACGGATACCGCGAAAGAGCAGATTTATAACCGCTTCACACTGACGGGCCTTCCCC), and the 5' end is phosphorylated and the 3' end is amino modified; the other chain (R chain) in fragment A is SEQ ID NO: 2 (CCCCTTCCGGCGTCAGTGTGAAGCGGTTATAAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAACCCCGT), and the first T base at its 5' end contains biotin modification.

[0091] The ligation product was purified by magnetic beads and eluted with 23 μl of sterile ultrapure water to finally obtain 20 μl of purified product.

[0092] According to the method of Example 1, streptavidin magnetic beads were used to capture the connector-ligated purified product, and the supernatant was purified.

[0093] The experimental results are shown in Figure 2A and Figure 2B ,in, Figure 2A The 2100 peak diagram of the purified product after the adapter-ligated product was ligated to the A fragment containing biotin. The figure shows that there are 6 fragment peaks of different lengths, among which the 15bp peak represents the LowerMarker, the 106bp peak represents the A fragment, the 309bp peak represents the simulated fragment with only one end connected to the hairpin adapter, the 366bp peak represents the simulated fragment with both ends connected to the hairpin adapter, the 417bp peak represents the simulated fragment with one end of the library connected to the hairpin adapter and the other end connected to the A fragment, and the 1500bp peak represents the Up Marker. Figure 2A It can be seen that some non-dumbbell-shaped library fragments will be connected to the A fragment modified with biotin.

[0094] Figure 2B The peak shape diagram of the supernatant product after the non-dumbbell-shaped library fragment containing fragment A was captured by streptavidin magnetic beads. The figure shows that there are 4 fragment peaks of different lengths, among which the 15bp peak represents the Lower Marker, the 309bp peak represents the simulated fragment with only one end connected to the hairpin adapter, the 369bp peak represents the simulated fragment with both ends connected to the hairpin adapter, and the 1500bp peak represents the Up Marker. Figure 2A and 2BThe comparison of the results showed that the A fragment containing biotin modification could be connected with the non-dumbbell-shaped library fragments. By capturing with streptavidin magnetic beads, some non-dumbbell-shaped library fragments in the library could be effectively removed, and relatively high-quality complete dumbbell-shaped library fragments could be obtained.

[0095] Example 4: Comparison of the effects of two methods of removing non-dumbbell-shaped library fragments: enzyme digestion and adding biotin-A fragments on library sequencing results

[0096] λDNA (NEB N3011L) was used as a template for library construction. The λDNA was sheared by g-Tube consumables to construct a third-generation PacBio platform library. The adapter-ligated product was purified and divided into two parts. One part was treated with the library that was not completely connected to the hairpin adapter (non-dumbbell-shaped library) by enzyme digestion method, and the other part was connected to the A fragment containing biotin modification by T4 DNA ligase. Then, streptavidin magnetic beads were used to remove the non-dumbbell-shaped library fragment containing biotin modification. The effects of the two methods on library construction were compared.

[0097] According to the method of Example 2, the λDNA was sheared, end-repaired, connected to the adapter and the connection product was purified. The products after the connection and purification were mixed and evenly divided into 4 tubes, each tube 40μl. In 2 of the tubes, the biotin-containing A fragment was connected to the hairpin adapter connection product according to the method of Example 3 (2 repeated experiments), and the non-dumbbell library fragment containing the biotin A fragment was captured using streptavidin magnetic beads, and the supernatant was purified to obtain the sequencing library. The other 2 tubes of the connection and purification products were digested by enzyme according to the method in Example 2 (2 repeated experiments), and the digested products were purified to obtain the sequencing library.

[0098] The libraries obtained by the above two methods were subjected to third-generation sequencing respectively, and the sequencing platform was SequelⅡ. The experimental results showed that the ccs Number value in the offline data of the library obtained by the magnetic bead grabbing method was higher than that of the conventional enzyme digestion method. The higher the ccs Number value, the more high-quality reads there are in the offline data. From the ccs Number data, it can be seen that the complete dumbbell-shaped library obtained by removing the non-dumbbell-shaped library fragments by the magnetic bead grabbing method has a higher yield. The N50 fragment length value obtained by the magnetic bead grabbing method is higher than that obtained by the conventional enzyme digestion method in the sequencing offline data, indicating that the library after the magnetic bead grabbing method removes the non-dumbbell-shaped library fragments has more long fragments, and the quality of the final assembled genome is higher.

Claims

1. A method for removing non-dumbbell-shaped library fragments during the construction of a third-generation library, the method comprising adding a first affinity tag to the non-dumbbell-shaped library fragments, and then capturing and removing the non-dumbbell-shaped library fragments containing the first affinity tag by a second affinity tag, wherein the first affinity tag and the second affinity tag can form an affinity bond.

2. The method of claim 1, wherein the first affinity tag is connected to a deoxyribonucleoside triphosphate or a nucleic acid fragment to form a deoxyribonucleoside triphosphate containing the first affinity tag or a nucleic acid fragment containing the first affinity tag, and the second affinity tag is connected to a solid phase carrier to form a solid phase carrier containing a second affinity tag.

3. The method according to claim 2, wherein the deoxyribonucleoside triphosphate or nucleic acid fragment is connected to at least one first affinity tag, and the solid phase carrier is connected to at least one second affinity tag; preferably, the deoxyribonucleoside triphosphate or nucleic acid fragment is connected to 2, 3 or 4 first affinity tags, and the solid phase carrier is connected to 2, 3 or 4 second affinity tags.

4. The method according to claim 2, wherein the solid phase carrier comprises at least one of glass microspheres, silica films, metal nanoparticles, inorganic microspheres, organic hybrid microspheres, and magnetic beads; preferably, the solid phase carrier is magnetic beads.

5. The method of claim 1, wherein the first affinity label comprises one or more of biotin, biotin derivatives, biotin analogs, protein antigens, proteases, and protein ligands; the second affinity label comprises one or more of avidin, streptavidin, protein antibodies, protease inhibitors, and protein receptors; preferably, the first affinity label is biotin or a biotin derivative, and the second affinity label is streptavidin or avidin.

6. The method of claim 1, wherein the first affinity label comprises one or more of avidin, streptavidin, protein antibody, protease inhibitor, and protein receptor; the second affinity label comprises one or more of biotin, biotin derivatives, biotin analogs, protein antigens, proteases, and protein ligands; preferably, the first affinity label is streptavidin or avidin, and the second affinity label is biotin or a biotin derivative.

7. The method of claim 2, comprising adding a deoxyribonucleoside triphosphate containing a first affinity tag or a nucleic acid fragment containing a first affinity tag to the non-dumbbell-shaped library fragment under the action of an enzyme.

8. The method of claim 7, wherein the deoxyribonucleoside triphosphate containing the first affinity tag is added to the 3' end of the non-dumbbell-shaped library fragment.

9. The method of claim 8, wherein the 3' end of the non-dumbbell library fragment is the 3' end of any end of the non-dumbbell library fragment or the 3' end of the gap in the non-dumbbell library fragment.

10. The method of claim 7, wherein the enzyme is a template-independent DNA polymerase; preferably, the template-independent DNA polymerase is terminal deoxynucleotidyl transferase or Phi29 DNA polymerase; more preferably, the template-independent DNA polymerase is terminal deoxynucleotidyl transferase.

11. The method of claim 2, wherein the deoxyribonucleoside triphosphate comprises one or more of dATP, dCTP, dTTP, dGTP, and dUTP; preferably, the deoxyribonucleoside triphosphate is dATP.

12. The method of claim 7, comprising adding the deoxyribonucleoside triphosphate containing the first affinity tag to the 3' end of the non-dumbbell library fragment under the action of a non-template-dependent DNA polymerase, and then capturing and removing the non-dumbbell library fragment containing the first affinity tag at the 3' end by the solid phase carrier containing the second affinity tag.

13. The method of claim 12, wherein the template-independent DNA polymerase is terminal deoxynucleotidyl transferase, the first affinity tag is biotin, and the second affinity tag is streptavidin.

14. The method according to claim 2, wherein the concentration of the deoxyribonucleoside triphosphate in the reaction system is 10-20 μM.

15. The method of claim 7, wherein the nucleic acid fragment containing the first affinity tag is added to either end of the non-dumbbell-shaped library fragment.

16. The method according to claim 7, wherein the enzyme is a ligase; preferably, the ligase is a DNA ligase and / or an RNA ligase; more preferably, the ligase is a DNA ligase.

17. The method according to claim 16, wherein the DNA ligase comprises at least one of Escherichia coli DNA ligase, T4 DNA ligase, T7 DNA ligase, T3 DNA ligase, Taq DNA ligase or Ampligase DNA ligase; preferably, the DNA ligase is T4 DNA ligase.

18. The method according to claim 2, wherein the nucleic acid fragment comprises one or more of a double-stranded DNA fragment, a single-stranded DNA fragment, a double-stranded RNA fragment, a single-stranded RNA fragment, and a DNA and RNA hybrid double-stranded fragment; preferably, the nucleic acid fragment is a double-stranded DNA fragment.

19. The method according to claim 18, wherein the double-stranded DNA fragment is 20-100 bp in length, wherein at least one end is a sticky end; preferably, the sticky end is a sticky end with a protruding T base at the 3' end.

20. The method of claim 19, wherein the other end of the double-stranded DNA fragment is a blunt end, a sticky end, a closed end or a Y-shaped end; preferably, when the other end of the double-stranded DNA fragment is a blunt end, its 3' end contains a closed group.

21. The method according to claim 18, wherein the concentration of the double-stranded DNA fragments in the reaction system is 1-10 μM; preferably, the concentration is 2-5 μM.

22. The method of claim 7, comprising ligating the nucleic acid fragment containing the first affinity tag to the end of the non-dumbbell-shaped library fragment under the action of a ligase, and then capturing and removing the non-dumbbell-shaped library fragment containing the first affinity tag by the solid phase carrier containing the second affinity tag; preferably, the ligase is DNA ligase, the first affinity tag is biotin, and the second affinity tag is streptavidin.

23. The method of claim 1, wherein the non-dumbbell-shaped library fragments comprise one or more of a hairpin adapter, a library fragment with a hairpin adapter connected to only one end, a library fragment with no hairpin adapter connected to both ends, or a library fragment with hairpin adapters connected to both ends but containing a gap.

24. A method for constructing a large DNA fragment library on the Pacbio platform, the method comprising: 1) obtaining a target double-stranded DNA, and optionally fragmenting the target DNA into 5-20 kb; 2) Perform end repair on the broken DNA fragments; 3) Optionally, an A-tailing reaction is performed after the end repair step; 4) Connecting the hairpin connector to obtain a connector-connected product; 5) Optionally, purifying the product after the linker ligation; 6) removing non-dumbbell-shaped library fragments using the method according to any one of claims 1 to 23; 7) Purify the library after removing the non-dumbbell-shaped library fragments.

25. The method of claim 24, wherein the hairpin connector is a blunt end or a sticky end; preferably, the hairpin connector is a sticky end.

26. A kit for constructing a PacBio sequencing library by the method according to any one of claims 24-25.

27. The kit of claim 26, comprising one or more of a fragmentation reagent module, an end-repair reagent module, a purification reagent module, and a ligation reagent module.

Images