Method, composition and kit for rapidly detecting pseudomonas aeruginosa through body temperature amplification

Abstract

The invention relates to two rapid detection methods, namely a fluorescence method and a test strip method, for rapidly detecting pseudomonas aeruginosa by adopting a body temperature amplification (ERA) technology. The invention also relates to an oligonucleotide primer probe composition for the method. The invention also relates to a detection kit containing the composition. When the composition is used for ERA fluorescence method and test strip method detection, pseudomonas aeruginosa can be simply, rapidly, specifically, sensitively and visually detected.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and in particular, relates to a fluorescence method and a test strip method using body temperature amplification technology to quickly detect Pseudomonas aeruginosa, an oligonucleotide primer probe composition used in the method, and a kit containing the composition. Background Art

[0002] Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), is a common Gram-negative bacterium that is widely present in the natural environment, including soil, water bodies and food. Because it produces water-soluble green pigments during metabolism, wounds and wound surfaces appear green. It is also known as Pseudomonas aeruginosa. It is an important waterborne pathogen that is widely present in various types of water and has strong resistance to physical and chemical factors such as disinfectants, drying, ultraviolet rays and adverse environments. It can also reproduce in various foods, especially in foods with high water content and a pH value close to neutral, such as raw meat, seafood, dairy products, fruits and vegetables. Consuming water and food contaminated with Pseudomonas aeruginosa may cause food poisoning, manifested as gastrointestinal symptoms such as abdominal pain, nausea, vomiting and diarrhea. In some cases, infection may further lead to severe inflammatory reactions and organ damage such as acute enteritis, pneumonia, meningitis, sepsis, skin inflammation and urinary tract infection, especially for people with weak immune systems, such as the elderly, infants and patients with impaired immune function. Studies have found that in the food field, products such as salads, cooked meat products, and drinking water are often contaminated by Pseudomonas aeruginosa. Therefore, checking for Pseudomonas aeruginosa in food and drinking water has become an essential testing item in food sampling.

[0003] my country's latest drinking water standard GB19298-2014 "Packaged Drinking Water" clearly stipulates that Pseudomonas aeruginosa must not be detected in every 250mL water sample, and requires that each batch of finished products be tested for Pseudomonas aeruginosa before leaving the factory. If detected, it is an unqualified product and should be recalled and sales should be stopped. At present, the standards for Pseudomonas aeruginosa mainly include GB 8538-2016 National Food Safety Standard Drinking Natural Mineral Water Inspection Method, SN / T 2099-2008 Pseudomonas aeruginosa Detection Method in Imported and Exported Foods, etc. However, the traditional microbial culture and physiological and biochemical methods are mainly used.

[0004] With the rapid development of molecular biology technology, various molecular biology techniques that trace biological components by identifying nucleic acids have the advantages of strong specificity, high sensitivity, not easily disturbed by environmental conditions, and stable results. They are increasingly widely used in the detection of foodborne pathogenic microorganisms. However, the currently popular PCR technology usually takes about 2 hours to detect, and requires a professional variable temperature nucleic acid amplifier. Although isothermal amplification technology based on LAMP has also begun to be widely used in the screening and detection of Pseudomonas aeruginosa, amplification still requires equipment that provides a temperature of 65°C. In 2019, my country developed an isothermal nucleic acid amplification technology with global independent intellectual property rights - Enzymatic Recombinase Amplification (ERA). This technology can efficiently and quickly amplify trace amounts of DNA and RNA specific fragments at a room temperature of 37 to 42°C, so it is also called body temperature amplification technology, that is, amplification can be completed in the palm of a person's hand or under the armpit, without relying on temperature control equipment. In this technology, under body temperature, the recombinase and primer bind tightly to form a polymer of recombinase and primer. When the recombinase and primer polymer search for a complementary sequence that matches it completely on the template DNA, the double-stranded structure of the template DNA is opened with the help of single-stranded DNA binding protein. Then, under the action of DNA polymerase, the primer extends along the 5′→3′ direction to form a new complementary DNA chain and complete the exponential growth of the amplified product. It has made major breakthroughs in low-temperature adaptability and sensitivity and has reached the international advanced level. Compared with traditional PCR and LAMP isothermal amplification technologies, its most significant advantage is that it can complete amplification in 10-20 minutes at body temperature, and can be visualized by color development, fluorescence, test strips, etc. This technology is fast, convenient and accurate, and has become a hot topic in recent years. Summary of the invention

[0005] The purpose of the present invention is to quickly, efficiently, simply, intuitively, accurately and sensitively detect Pseudomonas aeruginosa components. This method is of great significance for on-site rapid screening and risk detection of Pseudomonas aeruginosa, and can effectively prevent poisoning incidents caused by accidental ingestion of contaminated food with Pseudomonas aeruginosa.

[0006] The inventors of the present invention have identified the DNA gyrase gene gyrA and exotoxin of Pseudomonas aeruginosa in the NCBI database. adn A gene, virulence gene alasB. At the same time, we searched for gene sequences of other pathogenic Pseudomonas species, such as Pseudomonas fluorescens, Pseudomonas pseudomallei, Pseudomonas putida, Pseudomonas stutzeri, Pseudomonas alcaligenes, and other common foodborne pathogens, such as Salmonella, Klebsiella, Yersinia enterocolitica, etc. Based on the primer design principle of the ERA technology of body temperature amplification, we designed specific ERA primers and probes that can efficiently detect Pseudomonas aeruginosa in the differential region. After a series of experimental screening, we finally determined the use of alas B gene for Pseudomonas aeruginosa temperature amplification ERA rapid detection method.

[0007] In one aspect of the present invention, the oligonucleotide primer upstream lasB-F: 5′-CCGGTGGCAACCAGAAGATCGGCAAGTA-3′ (SEQ ID No. 1) and downstream lasB-R: 5′-ATGCGCGTCGTTCAGTGGCGAATAAGC-3′ (SEQ ID No. 2) for rapid detection of Pseudomonas aeruginosa by ERA fluorescence method are provided. In another aspect of the present invention, the probe lasB-P: 5′-CACCTACGGTAGCGACTACGGTCCGCTGATCGTCAACGACCGCTGC-3′ (SEQ ID No. 3) for rapid detection of Pseudomonas aeruginosa by ERA fluorescence method is also provided, the base at the 3′ end of the probe is blocked with c3-spacer, the T at the 30th position is modified with FAM group, the base at the 31st position is replaced with THF, and the T at the 33rd position is modified with BHQ1. The probe is combined with SEQ ID No. 1 and SEQ ID No. 2 for ERA fluorescence method amplification, thereby specifically identifying Pseudomonas aeruginosa. The reaction program was set in the qPCR instrument as follows: 37 °C for 1 s; 37 °C for 14 s, for 60 cycles; and FAM fluorescence signals were collected in the second reaction stage.

[0008] In another aspect of the present invention, an oligonucleotide primer probe for rapid detection of Pseudomonas aeruginosa by the ERA test strip method using body temperature amplification technology is also provided, wherein the upstream sequence is still lasB-F (SEQ ID No.1), and the sequence of the downstream lasB-R-test strip is the same as SEQ ID No.2, but modified with Biotin at its 5′ end (SEQ ID No.4). The sequence of the test strip probe lasB-P-test strip is the same as SEQ ID No.3, but modified with FAM at its 5′ end, closed with c3-spacer at the 3′ end, and the 31st base is replaced with THF (SEQ ID No.5). SEQ ID No.1, SEQ ID No.4 and SEQ ID No.5 are combined for body temperature amplification ERA test strip method amplification, and Pseudomonas aeruginosa is rapidly detected according to the color development of the control band and the detection band of the test strip. The reaction procedure is: 37°C 15 min.

[0009] In another aspect of the present invention, a composition comprising the above oligonucleotide sequence is provided. The composition comprises the following primer and probe sequences: (1) Oligonucleotide primer pairs SEQ ID No. 1 to SEQ ID No. 2 and probe SEQ ID No. 3 for rapid detection of Pseudomonas aeruginosa by ERA fluorescence method; (2) The oligonucleotide primer pairs SEQ ID No. 1 and SEQ ID No. 4 and the probe SEQ ID No. 5 for rapid detection of Pseudomonas aeruginosa by the ERA test strip method using body temperature amplification technology are as follows:

[0010] In one embodiment, the amplification conditions of the Pseudomonas aeruginosa temperature amplification technique ERA fluorescence method are 37°C for 1s; 37°C for 14s, 60 cycles; and FAM fluorescence signals are collected in the second reaction stage. The test results are analyzed by fluorescence curves. If a good amplification curve is obtained, it means that the test result is positive, and no amplification means that the test result is negative.

[0011] In another embodiment, the amplification conditions of the ERA test strip method of Pseudomonas aeruginosa temperature amplification technology are 37 ° C constant temperature reaction for 15 minutes, after the reaction is completed, take 5 μL of the reaction product to a 1.5 mL centrifuge tube, dilute 50 times with pure water; take out the test strip (do not touch the NC membrane), insert it into the centrifuge tube, wait for the test strip to be completely soaked by the liquid, and read the result according to the color development of the control band and the test band. If both the control band and the test band have obvious red lines, it means that the test result is positive; if only the control band has a red line, it means that the test result is negative; if the control band does not have a red line, it means that the test result is invalid.

[0012] In another aspect of the present invention, provided are ERA fluorescence method and colorimetric method rapid detection kits respectively used for Pseudomonas aeruginosa temperature amplification technology, wherein the kit comprises the oligonucleotide sequence or the composition.

[0013] The kit provided by the invention comprises a specific primer and probe combination for rapid detection of Pseudomonas aeruginosa by the ERA fluorescence method and colorimetric method of the body temperature amplification technology of the invention, and an instruction manual.

[0014] In one embodiment, the Pseudomonas aeruginosa of the present invention alas B sequence as the basic sequence, and specific primers and probes were alas B sequence conservative region design. In one embodiment, the Pseudomonas aeruginosa specific amplification target sequence included in the test kit is: CCGGTGGCAACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCGCTGATCGTCAACGACCGCTGCGAGATGGACGACGGCAACGTCATCACCGTCGACATGAACGGCAGCACCAATGACAGCAAGACCACGCCGTTCCGCTTCGCCTGCCCGACCAACACCTACAAGCAGGTCAACGGCGCTTATTCGCCACTGAACGACGCGCAT (SEQ No.4), in a specific embodiment, the test kit for detecting Pseudomonas aeruginosa of the present invention also includes a reference substance. Preferably, the reference substance includes a positive control substance and a negative control substance. In one embodiment, the negative control is sterile double distilled water.

[0015] In another embodiment, the sensitivity of the ERA fluorescence method of the body temperature amplification technology for detecting Pseudomonas aeruginosa is 0.1 ng / μL. The sensitivity of the ERA colorimetric method for detecting Pseudomonas aeruginosa is 10 -3 ng / μL.

[0016] In yet another aspect of the present invention, the present invention provides use of the composition or the kit in detecting Pseudomonas aeruginosa in samples such as beverages and drinking water.

[0017] The design of amplification primers and probes is the key to developing sensitive and rapid ERA detection methods. Because primers with different sequences have different performances in the ERA reaction, which will affect the amplification efficiency and amplification speed, primer design and screening are very necessary.

[0018] Since the ERA technology has a unique reaction condition of 37-42 ℃, ERA detection has strict requirements for the design of primers. Ordinary PCR primers are not applicable because ERA technology primers are longer than general PCR primers, usually 28-35 nt. Primers that are too short will reduce the recombination rate, affect the amplification speed and detection sensitivity. If the primers are too long, other secondary structures such as primer dimers or hairpin structures may be generated during the amplification process, thereby affecting the yield of nucleic acid amplification. And when designing ERA primers, the denaturation temperature is no longer a key factor affecting the amplification primers.

[0019] In order to establish the ERA fluorescence method, it is necessary to further design the ERA detection probe. The probe design requires that it be designed in the middle position of the primer, fully complementary to the template, and 46 to 52 nucleotides in length, of which the 5′ end of the THF site is at least 30 nucleotides and the 3′ end is at least 15 nucleotides. The fluorescent group and the quenching group can only be labeled on thymine (T), and the distance between the fluorescent group and the quenching group is 1 to 5 nucleotides, because a larger interval will lead to a higher base value and a lower signal-to-noise ratio, thereby reducing the quenching efficiency. One nucleotide in the middle of the two is replaced by tetrahydrofuran (THF), and the number of intervals between the dT-fluorophore or dT-quencher and the THF base is 0, 1 or 2. The 3′ end of the probe needs to be modified and closed with a blocking group, such as C3-spacer, phosphate, amine, biotin or tetraethylene glycol. Under the action of exonuclease II, the two groups are separated, and the fluorescence signal accumulates synchronously while the amplification product grows, so that the fluorescence curve can be detected synchronously.

[0020] At the same time, in order to establish the ERA test strip method, the primers and probes need to be further screened. The test strip method requires the 5′ end of the primer sequence complementary to the probe to be modified with Biotin, and the probe is designed between the upstream and downstream primers. The probe length is 46 to 52 nucleotides, of which the 5′ end of the THF site is at least 30 nucleotides and the 3′ end is at least 15 nucleotides. THF replaces a base located 30 bp downstream of the fluorophore and 15 bp upstream of the blocking group, with a spacing of 1 to 5 nucleotides. The 5′ end of the probe is labeled with the FAM fluorescent group, and the 3′ end of the probe needs to be modified and blocked with a blocking group, such as C3-spacer, phosphate, amine, biotin or tetraethylene glycol. When the probe binds to its target, endonuclease IV recognizes and cleaves THF, and the cleaved probe extends from 5′-3′ along the template.

[0021] The design of primers and probes for ERA technology is not as mature as that of traditional PCR, and there is currently no design software available. Although the requirements for the design of these primers and probes are known, the final selection still needs to be screened and optimized by yourself, and the experimental results are not predictable.

[0022] According to the characteristics of Pseudomonas aeruginosa, the inventors used DNA gyrase gene gyr A. Exotoxins adn A gene, virulence gene alas B is the target gene, and the ERA fluorescence detection primers and probes are designed, namely: gyrA-F / R / P, lasB-F / R / P and adnA-F / R / P, and compared with the reported ecf X gene and alas The primer-probe combination of the B gene, i.e., exfX-exo-F / R / P and F1-m3 / R1-m / Probe, was compared for amplification effect, and the information is shown in Table 1. By comparing the index parameters such as amplification efficiency, specificity, and detection limit, the oligonucleotide primer-probe combination lasB-F / R / P for rapid detection of Pseudomonas aeruginosa by the body temperature amplification ERA technology provided by the present invention was finally determined.

[0023] Table 1 Sequence information of primers and probes for rapid detection of Pseudomonas aeruginosa by ERA fluorescence method

[0024] Note: a It means that when the test strip method is used for detection, the 5′ end of the downstream primer lasB-R is modified with Biotin; b It means that when the test strip method is used for detection, the 5′ end of the probe is modified with FAM, the T at the 30th position no longer modifies the FAM group, the T at the 33rd position no longer modifies the BHQ1 group, and the other modifications are the same as lasB-P.

[0025] The method of the present invention cleverly uses the body temperature amplification ERA technology for efficient DNA amplification and specificity of nucleic acid hybridization, and establishes two on-site visual rapid detection methods for Pseudomonas aeruginosa, namely, fluorescence method and test strip method, which have the advantages of simple operation, time-saving and labor-saving, accuracy and reliability, rapidity and sensitivity, and naked eye visibility. It can be used for rapid qualitative detection of Pseudomonas aeruginosa in samples such as water and food, and provides good technical support for rapid screening of Pseudomonas aeruginosa. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the result of the primer probe screening for Pseudomonas aeruginosa, including the three sets of primer probes designed: gyrA-F / R / P, lasB-F / R / P and adnA-F / R / P. The amplification results are shown in Figures 1A-1C , and the two sets of primers and probes reported in the article, exfX-exo-F / R / P and F1-m3 / R1-m / Probe, the amplification results are as follows Figure 1D and 1E , No. 1 represents Pseudomonas aeruginosa ATCC25619, No. 2 represents Pseudomonas aeruginosa IQCC12639, and CK represents blank control.

[0027] Figure 2 The above preferred primer-probe combination lasB-F / R / P uses the ERA fluorescence method to detect the specificity and coverage of Pseudomonas aeruginosa, wherein 1-7 are 7 species of Pseudomonas aeruginosa, and the strain numbers are: ATCC25619, IQCC12639, ATCC10145, ATCC15442, ATCC27853, ATCC9027, CMCC10104, and 8-23 are Other Pseudomonas and common foodborne pathogens, including: 8. Pseudomonas fluorescens ATCC13525, 9. Pseudomonas putida ATCC17485, 10. Pseudomonas straw CGMCC1.1797, 11. Pseudomonas stutzeri ATCC17588, 12. Pseudomonas cepacia ATCC25416, 13. Pseudomonas mendocina ATCC25411, 14. Escherichia coli O157:H7 ATCC43895, 15. Salmonella typhimurium ATCC14028, 16. Vibrio parahaemolyticus ATCC 33847, 17. Staphylococcus aureus ATCC27664, 18. Listeria monocytogenes ATCC13932, 19. Cronobacter sakazakii ATCC29544, 20. Shigella flexneri CMCC51571, 21. Yersinia enterocolitica ATCC27729, 22. Bacillus cereus ATCC10876, 23. Beta-hemolytic Streptococcus β-CMCC32210, CK represents blank control.

[0028] Figure 3 The above preferred primer-probe combination lasB-F / R / P was used to analyze the sensitivity of the ERA method for Pseudomonas aeruginosa. The template concentrations were 100, 10, 1, and 10 -1 , 10 -2 ng / μL, CK represents blank control, and each sample was repeated twice in parallel.

[0029] Figure 4 The above preferred primer-probe sequence combination lasB-F / R-test strip / P-test strip is further analyzed for the specificity and coverage of Pseudomonas aeruginosa using the test strip method, wherein Figure 4 A is the specificity test result, Figure 4 B is the coverage of the aeruginosa test. The strains numbered 1-23 are the same as above. Figure 2 , CK represents blank control.

[0030] Figure 5 The above preferred primer-probe combination lasB-F / R-test strip / P-test strip is used to analyze the sensitivity of the test strip method to Pseudomonas aeruginosa. The numbers 1-6 represent the template concentrations of 100, 10, 1, and 10 respectively. -1 , 10-2 , 10 -3 ng / μL test results, CK represents blank control, and each sample was repeated twice in parallel. DETAILED DESCRIPTION

[0031] The present invention is further described by way of examples, but the present invention is not limited to the following examples. Example 1 Screening of ERA primers and probes for detection of Pseudomonas aeruginosa and analysis of fluorescence detection performance

[0032] The three designed primer probes and two primer probes reported in the literature (Table 1) were analyzed for amplification efficiency, specificity, coverage, and sensitivity, and the primer probe combination for rapid detection of Pseudomonas aeruginosa by ERA method was finally determined.

[0033] 1) Pseudomonas aeruginosa DNA extraction: using PrepMan TM DNA of Pseudomonas aeruginosa was extracted using Ultra Sample preparation Reagent kit and diluted to 10 ng / μL using sterile water for testing.

[0034] 2) Detection system: Prepare the premix for each sample according to the instructions of the fluorescent nucleic acid amplification kit (ERA method): 20 μL of solvent, 2.1 μL of forward primer, 2.1 μL of reverse primer, 0.6 μL of probe, 1 μL of template, 22.2 μL of ddH2O. Transfer the premix to a PCR tube with fluorescent amplification reagent, oscillate to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cover the tube cap, centrifuge briefly to allow the activator to enter the premix, oscillate briefly to mix, centrifuge quickly again, and place in the mini qPCR instrument.

[0035] 3) Reaction program: 37 ℃ 1 s; 37 ℃ 14 s, 60 cycles; in the second reaction phase, select FAM as the fluorescence channel and set the threshold to default. Sterile water was used as a blank control.

[0036] 4) Result determination: The blank control should have no amplification curve to be considered valid, otherwise the experimental result is considered invalid. If there is an obvious amplification curve, it is considered positive. If there is no fluorescence curve, it is considered negative.

[0037] As shown in Figure 1, the amplification efficiency of the candidate primer probes for the ERA fluorescence detection of Pseudomonas aeruginosa in four combinations was compared. The results showed that the two sets of primer probes exfX-exo-F / R / P reported in the article had no amplification, and F1-m3 / R1-m / Probe had low amplification efficiency, indicating that although the primer probe principles of RPA and ERA technologies are similar, they are not suitable for ERA detection. The amplification efficiency of the self-designed gyrA-F / R / P and adnA-F / R / P primer probe combinations is slightly lower, and the amplification efficiency of lasB-F / R / P is the highest.

[0038] like Figure 2 As shown in the figure, the specificity and coverage of the screened primer probe combination lasB-F / R / P were analyzed. The results showed that only Pseudomonas aeruginosa was amplified, and it was able to cover 7 different strains of Pseudomonas aeruginosa, indicating high coverage. DNA of other Pseudomonas and common foodborne pathogens and ddH2O blank controls were not amplified, which fully demonstrated that the specific oligonucleotide primers screened in this experiment showed excellent specificity for the detection of Pseudomonas aeruginosa.

[0039] like Figure 3 As shown in Figure 2, the sensitivity of the screened primer probe combination lasB-F / R / P was further analyzed. The results showed that the oligonucleotide primer combination had the highest sensitivity and could detect the minimum content of Pseudomonas aeruginosa at 0.1 ng / μL. Example 2 Detection performance of the preferred Pseudomonas aeruginosa ERA primer probe test strip method

[0040] The performance of the test strip method was further analyzed for the selected primer probes for Pseudomonas aeruginosa ERA. The primer and probe combination for the rapid detection of Pseudomonas aeruginosa ERA test strip method was finally determined through analysis of specificity, coverage and sensitivity.

[0041] 1) Pseudomonas aeruginosa DNA extraction: same as in Example 1 above.

[0042] 2) Detection system: Prepare the premix for each sample according to the instructions of the test paper type nucleic acid amplification kit (ERA method): 20 μL of solvent, 2.1 μL of forward primer, 2.1 μL of reverse primer, 0.6 μL of probe, 1 μL of template, 22.2 μL of ddH2O. Transfer the premix to the PCR tube with the test paper type amplification reagent, oscillate to mix and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cover the tube cap, centrifuge briefly to allow the activator to enter the premix, oscillate briefly to mix and centrifuge quickly again, and put it into the PCR instrument.

[0043] 3) Reaction procedure: Amplify at 37°C for 15 min. After the reaction is completed, take 5 μL of the reaction product to a 1.5 mL centrifuge tube and dilute 50 times with pure water. Take out the test strip (do not touch the NC membrane) and insert it into the centrifuge tube. When the test strip is completely soaked by the liquid, read the result according to the color development of the control band and the test band. At the same time, use sterile water as a blank control.

[0044] 4) Result determination: If both the control band and the test band have obvious red lines, it means the test result is positive; if only the control band has a red line, it means the test result is negative; if no red line appears on the control band, it means the test result is invalid.

[0045] like Figure 4 As shown in the figure, the specificity and coverage analysis of the preferred primer probe combination lasB-F / R-test strip / P-test strip for Pseudomonas aeruginosa ERA test strip method was performed, and the results showed that only Pseudomonas aeruginosa was amplified, and it was able to cover 7 different strains of Pseudomonas aeruginosa, indicating high coverage. DNA of other Pseudomonas genera and common foodborne pathogens and ddH2O blank controls were not amplified, which fully demonstrated that the specific oligonucleotide primers screened in this experiment showed excellent specificity for Pseudomonas aeruginosa detection.

[0046] like Figure 5 As shown in the figure, the sensitivity analysis of the preferred ERA test strip method detection primer probe combination lasB-F / R-test strip / P-test strip was further performed, and the results showed that the oligonucleotide primer combination had the highest sensitivity and could detect the minimum content of Pseudomonas aeruginosa of 10 -3 ng / μL. Example 3 Detection Limit of Rapid Detection of Pseudomonas aeruginosa in Artificially Contaminated Sample Analysis

[0047] 1) Sample pretreatment: Take 25 mL of sterile water and prepare artificial contamination samples of Pseudomonas aeruginosa according to the method described in SN / T2099-2008. "Detection method of Pseudomonas aeruginosa in imported and exported food". Take 7 groups of 25 mL of the homogenate after mixing, and mix 10 7 The CFU / mL of Pseudomonas aeruginosa was diluted to 10 6 ~10 0 Artificially contaminated samples with CFU / mL were cultured for bacterial enrichment at 37°C for 0, 2, 4, and 6 h.

[0048] 2) DNA extraction, fluorescence detection, detection system, reaction procedure and result determination steps are the same as in Example 1. Test strip detection, detection system, reaction procedure and result determination steps are the same as in Example 2. Sterile ddH2O was used as a blank control during the experiment.

[0049] The results of artificial contamination sample detection are shown in Table 2. The results show that the minimum detection limit of the established ERA fluorescence method for Pseudomonas aeruginosa can reach 1 CFU / mL after 6 h of pre-enrichment, and the minimum detection limit of the established ERA test strip method can reach 1 CFU / mL after 4 h of pre-enrichment. The sensitivity of the method is relatively high.

[0050] Table 2 Detection results of artificially contaminated samples Example 4 Analysis of the accuracy and applicability of the screened Pseudomonas aeruginosa ERA primer probe for rapid detection of commercially available beverages

[0051] 1) Sample pretreatment: Commercially available beverages were pretreated according to the procedures of SN / T2099-2008 and cultured in BHI medium for 24 h.

[0052] 2) DNA extraction, fluorescence detection, detection system, reaction procedure and result determination steps are the same as in Example 1. Test strip detection, detection system, reaction procedure and result determination steps are the same as in Example 2. Sterile ddH2O was used as blank control, and each sample was repeated twice in parallel.

[0053] 3) The GB 8538-2022 test method was used to analyze the accuracy and applicability of the test results of the samples.

[0054] The actual results of commercial products are shown in Table 3. The results showed that the ERA fluorescence method and test strip method established in this study were used to test 20 commercially available beverages, and compared with the test results of the national standard GB 8538-2022 Food Safety National Standard Drinking Natural Mineral Water Test Method. The results showed that 10 of the 20 commercially available food samples detected Pseudomonas aeruginosa, with a detection rate of 50%, and the test results of the established ERA fluorescence method and test strip method were consistent with the test results of the GB 8538-2022 standard method (Table 3). The accuracy and practicality of the two rapid detection methods of Pseudomonas aeruginosa ERA established in this study were confirmed.

[0055] Table 3 Actual sample test results

[0056] Although specific embodiments of the present invention have been described, it will be appreciated by those skilled in the art that various changes and modifications may be made to the present invention without departing from the scope or spirit of the present invention. Therefore, the present invention is intended to cover all such changes and modifications that fall within the scope of the claims and their equivalents.

Claims

1. A composition for detecting Pseudomonas aeruginosa by ERA fluorescence method, characterized in that: The composition includes an upstream primer 5′-CCGGTGGCAACCAGAAGATCGGCAAGTA-3′, a downstream primer 5′-ATGCGCGTCGTTCAGTGGCGAATAAGC-3′, and a probe 5′-CACCTACGGTAGCGACTACGGTCCGCTGATCGTCAACGACCGCTGC-3′ for detecting Pseudomonas aeruginosa, wherein the 3′ end base of the probe is blocked with a c3-spacer, the 30th base is modified with a FAM group, the 31st base is replaced with THF, and the 33rd base is modified with BHQ1.

2. A composition for detecting Pseudomonas aeruginosa by ERA test strip method, characterized in that: The composition comprises the upstream primer, downstream primer and probe sequence as claimed in claim 1, wherein the 5' end of the downstream primer is modified with Biotin; the 5' end of the probe is modified with FAM, the 3' end is blocked with c3-spacer, and the 31st base is replaced with THF.

3. A method and kit for detecting Pseudomonas aeruginosa by ERA fluorescence method, the method comprising using the composition of claim 1.

4. A method and a kit for detecting Pseudomonas aeruginosa by the ERA test strip method, comprising using the composition of claim 2.

5. Use of the composition according to claim 1 and claim 2, the method and kit according to claim 3 and claim 4 in the detection of Pseudomonas aeruginosa.

Images