RPA-PfAgo detection system for cryptosporidium parvum

Abstract

The invention discloses an RPA-PfAgo detection system for cryptosporidium parvum. The RPA-PfAgo detection system is characterized in that a reaction result is detected by exposing a product to blue light; the detection system does not need complex instruments and equipment, and the result can be observed by naked eyes in a short time; the method has the characteristics that the simplicity and the multifunctionality of the detection method are greatly enhanced, and professional personnel operation is not needed.

Description

Technical Field

[0001] The invention discloses an RPA-PfAgo detection system for Cryptosporidium parvum, provides RPA-PfAgo detection primers and a detection system for Cryptosporidium parvum, and belongs to the technical field of biological detection and prevention. Background Art

[0002] Cryptosporidium is a parasitic protozoan whose oocysts usually infect the host through the fecal-oral route, leading to clinical diarrheal syndrome. Currently, there is no effective treatment for Cryptosporidium. Since Cryptosporidium is very tenacious in the environment and is easily spread, and there is no effective treatment for cryptosporidiosis, it is particularly important to detect and prevent the disease.

[0003] At present, the technologies for detecting Cryptosporidium parvum are mainly divided into pathogen detection, molecular biology and immunological detection. However, these methods mostly rely on laboratory operations and have certain limitations, such as the need for professionals or expensive and complex equipment, and are time-consuming and prone to high false positive rates. Although the Cas12a-based Cryptosporidium parvum detection method is rapid, specific, sensitive and reliable, the CRISPR system also has some limitations; Cas proteins can only function at room temperature and lose their activity at high temperatures, thus affecting the cutting activity. Since Cas proteins require a gRNA to guide the cutting of target nucleic acids, and RNA is easily degraded, this makes storage and transportation difficult; in addition, the synthesis of gRNA is quite expensive. Summary of the invention

[0004] The present invention provides a Cryptosporidium parvum RPA-PfAgo visualization detection method, which is fast, stable and convenient, and solves the above-mentioned problems existing in the detection methods of the prior art.

[0005] The present invention discloses an RPA-PfAgo detection system for Cryptosporidium parvum, comprising an RPA primer product, a PfAgo protein, a probe, a group of gDNAs and a buffer.

[0006] The RPA-PfAgo detection primer for Cryptosporidium parvum described in the present invention has the following primer sequence: CP-RPAF: 5′-TTATCGTATTACTCTCCGTTATAGTCTCCG-3′; CP-RPAR: 5′-ACGGTTGATGTTGATGATGATGATGATGAT-3′.

[0007] The present invention provides a group of gDNAs for cutting the double-stranded DNA of the above-mentioned RPA product, wherein the sequence of the gDNAs is: gDNA-1: 5′-TCCTCTGAGTGGAACG-3′; gDNA-2: 5′-ACAGGAACATCCTTTA-3′; gDNA-3: 5′-CAGCCGTTCCACTCAG-3′.

[0008] Furthermore, the single-stranded DNA obtained by cutting the double-stranded DNA of the RPA product by the gDNAs is used to cut the probe, and the sequence of the probe is: 5′6-FAM-cgcaccatcctttaaagttcctctgagtggggtgcg-BHQ1-3′.

[0009] The detection method of the RPA-PfAgo detection system described in the present invention is to extract the genomic DNA of Cryptosporidium parvum, amplify it by RPA at 39°C for 30 minutes, mix the RPA product with PfAgo, react at 95°C for 25 minutes, and observe the results under blue light.

[0010] The technical problem solved by the scheme of the present invention is that compared with CRISPR, PfAgo only needs a small piece of gDNA to cut the target sequence, and because PfAgo is resistant to high temperature, it is more suitable for on-site detection. In the use of RPA and PfAgo, this paper developed a visual detection method for Cryptosporidium parvum. In order to minimize the possibility of false negatives, we developed primers and gDNAs based on the conserved Cryptosporidium parvum gp60 gene. In addition, the efficiency and specificity of RPA amplification were improved by optimizing the amplification conditions. In order to reduce the complexity of the operation and reduce contamination, after the RPA reaction was allowed to react at 39°C for 30 minutes, the RPA product was directly transferred to the PfAgo system without purification and then heated at 95°C for 25 minutes. The reaction results were checked by exposing the product to blue light. Since only heating and blue light equipment are required, the simplicity and versatility of this detection method are greatly enhanced. According to the results, RPA-PfAgo was able to detect 100 copies of Cryptosporidium parvum nucleic acid without cross-reaction with other organisms. The reliability of this method was then evaluated using clinical samples, and it was found that its positive agreement rate with the results of the fluorescent quantitative PCR method was over 95%.

[0011] The positive effects of the present invention are:

[0012] 1. The scheme of the present invention designs primers and gDNAs based on the conserved gp60 gene of Cryptosporidium parvum; in addition, the efficiency and specificity of RPA amplification are improved by optimizing the amplification conditions. In order to reduce the complexity of the operation and reduce contamination, after the RPA reaction at 39°C for 30 minutes, the RPA product is directly transferred to the PfAgo system without purification and then heated at 95°C for 30 minutes. The reaction results are checked by exposing the product to blue light. Since only heating and blue light equipment are required, the simplicity and versatility of this detection method are greatly enhanced.

[0013] 2. The detection method of the RPA-PfAgo detection system provided by the present invention does not require complicated instruments and equipment, and the results can be observed by naked eyes in a relatively short time; the method is simple to operate and does not require professional personnel; and the main components of the method are easy to preserve and have low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the workflow of the RPA-PfAgo reaction of the present invention; Figure 2 This is the purification result of PfAgo of the present invention; Figure 3 Optimization of the RPA-PfAgo cutting system of the present invention; Figure 4 Establishing an evaluation of the RPA-PfAgo detection performance for the present invention; Figure 5 This is the RPA-PfAgo clinical sample detection result of the present invention. DETAILED DESCRIPTION

[0015] The present invention is further described below in conjunction with specific embodiments so that those skilled in the art can better understand the present invention. The present invention can be understood and implemented, but the embodiments are not intended to limit the present invention. Example 1

[0016] The conserved sequence gp60 (NCBI: MK034693.1) gene corresponding to Cryptosporidium parvum was retrieved from the National Center for Biotechnology Information (NCBI) database. Subsequently, a RPA-PfAgo detection primer for Cryptosporidium parvum was designed using the TwistAmp® Assay Design Manual and PrimerPremier 5.0 software to cut the gDNAs of the double-stranded DNA of the RPA product, and its sequence is as follows: Upstream primer: TTATCGTATTACTCTCCGTTATAGTCTCCG; Downstream primer: ACGGTTGATGTTGATGATGATGATGATGAT; Probe: 5′6-FAM-cgcaccatcctttaaagttcctctgagtggggtgcg-BHQ1-3′. Example 2

[0017] A RPA-PfAgo detection system and detection method for Cryptosporidium parvum 1. Methods 1.1 Oligonucleotide primers for amplification, gDNA and probe preparation A pair of RPA primers were designed based on the conserved region of the gp60 gene of Cryptosporidium parvum: CP-RPAF: 5′-TTATCGTATTACTCTCCGTTATAGTCTCCG-3′; CP-RPAR: 5′-ACGGTTGATGTTGATGATGATGATGATGAT-3′; A set of conservative gDNAs was also designed: gDNA-1: 5′-TCCTCTGAGTGGAACG-3′; gDNA-2: 5′-ACAGGAACATCCTTTA-3′; gDNA-3: 5′-CAGCCGTTCCACTCAG-3′; To cut the double-stranded DNA of the RPA product, the cut single-stranded DNA is used to cut the probe: 5′6-FAM-cgcaccatcctttaaagttcctctgagtggggtgcg-BHQ1-3′; Sat'zngon Biotech synthesized the primers, gDNA, and probes.

[0018] 1.2 Expression and purification of PfAgo pET28a-PfAgo was chemically synthesized by Sangon Biotech (Shanghai) and transformed into competent cells. Overnight culture (10 mL) was added to 400 mL LB broth (containing kanamycin, 50 μg / ml) and grown at 37 °C to an OD600 of 0.6. Isopropyl-β-d-1-thiogalactopyranoside (IPTG, 1 Mm) was added to the culture medium and induced at 16 °C and 180 rpm for 20 h. After centrifugation at 15000 g for 20 min at 4 °C, the supernatant protein was purified using a His-tag protein purification kit (SangonBiotech). The purified target protein was concentrated using an ultrafiltration column (50 KD), and the total protein was determined by the BCA method and stored at -80 °C.

[0019] 1.3 RPA response First, primer CP-RPAF (10 μM, 2.4 μl), primer CP-RPAR (10 μM, 2.4 μl), Rehydration buffer (29.5 μl), RNase Inhibitor and deionized water 13.2 μl (total volume 47.5 μl) were added to the freeze-dried reaction system, vortexed and briefly centrifuged, and then 2.5 μl of 280 mM MgAc (provided by the kit) was added and mixed thoroughly to start the reaction. Within 30 minutes, the temperature of the RPA reaction was maintained at 42 °C in a PTC-200 thermal cycler (MJ Research, USA).

[0020] 1.4 PfAgo reaction PfAgo reaction system (10 μl), including 0.5ul PfAgo, 0.75ul gDNA-1, 0.75ul gDNA-2, 0.5ul gDNA-3, 1.5ul probe, 1ul buffer (10×taq plus and pfu buffer), 2ul RPA product and 3ulddH2O. The test tube was placed in a PTC-200 thermal cycler at 95°C for 30 minutes, and the fluorescence signal after PfAgo-mediated cleavage reaction was observed under blue light.

[0021] 1.5 Evaluation of the RPA-PfAgo detection system The use range is 1×10 6 Up to 1×10 0 The analytical sensitivity of the RPA-PfAgo detection system was determined by measuring the number of Cryptosporidium parvum genome copies / μl, and the RPA-PfAgo sensitivity and specificity reaction was performed by the QuantStudio3 real-time fluorescence quantitative PCR detection system at 95°C for 30 minutes, and the results were observed under blue light.

[0022] 1.6 Identification of Cryptosporidium parvum in clinical samples Thirty-seven clinical samples (fecal samples) were collected from four breeding farms in Changchun, China. Genomes were extracted from these samples as templates in the RPA-PfAgo assay.

[0023] 2 Results 2.1 Principle of RPA-PfAgo Extract the genome of Cryptosporidium parvum. By using gDNA as a guide, PfAgo can specifically cut the amplified fragment chain complementary to the gDNA sequence (first cut) and release 16bp of new gDNA. The new gDNA fragment with 5′-phosphorylation can bind to the empty PfAgo protein to cut the gDNA complementary molecular probe (refer to Figure 1 ), 2.2 Expression and purification results of PfAgo PfAgo protein expression was induced by 1 mM IPTG at 37°C for 5-6 hours. The pellet was resuspended after harvesting, then lysed and finally concentrated. The expressed PfAgo was mainly dissolved in the supernatant and eluted by elution buffer (refer to Figure 2 ), Figure 2 In a: M: Marker; 1: Induction supernatant; 2: Induction precipitate; 3: Flow-through; 4-7: Washing solution; 8-10: Eluent, Figure 2 b is the result of PfAgo ultrafiltration; in order to obtain more conservative primers and gDNA, a pair of RPA primers, three sets of gDNA and a target probe were designed based on the conserved sites of the gp60 gene.

[0024] 2.3RPA-Pfago reaction optimization results The gDNA quantity, probe concentration, and buffer concentration in the RPA-Pfago reaction were optimized. According to the data, the optimal gDNA quantity for the RPA-Pfago reaction was in three (refer to Figure 3 a); The optimal probe concentration is 2 μM ( Figure 3 b); The best buffer is commercial buffer (10×taq plus and pfu buffer) ( Figure 3 c); Figure 3 a is the optimization of gDNA quantity (1, 2, and 3); Figure 3 b Optimization of different probe concentrations (0 μM, 0.5 μM, 1 μM, 1.5 μM, and 2 μM); Figure 3 c is the optimization of different buffer concentrations (0.5 μM, 1 μM, 2 μM and 10×taq plus and pfu buffer).

[0025] 2.4 Results of the RPA-PfAgo detection system The Cryptosporidium parvum genome was extracted and amplified by RPA at 42°C for 30 minutes. The RPA product was mixed with PfAgo and reacted at 95°C for 30 minutes. The results were observed under blue light. The range of use was 1×10 6 Up to 1×10 0The sensitivity of the RPA-PfAgo reaction was evaluated by 10-fold serial dilutions of the Cryptosporidium parvum genome template at 10 copies / μl (ref. Figure 4 ). The obtained findings demonstrate that the developed detection system can detect as low as 1 × 10 2 The potential of the genome per μl ( Figure 4 a). Figure 4 b Demonstrates the ability of the RPA-PfAgo detection system to detect Cryptosporidium parvum, while other parasites or controls Figure 4 a is the sensitivity of RPA-PfAgo in detecting the genome of Cryptosporidium parvum under blue light. The detection limit of RPA-PfAgo assay was calculated by 6 copies / μL to 10 0 The range of copies / μL was determined by testing 10-fold serial dilutions of the Cryptosporidium parvum genome. Figure 4 b shows the sensitivity of RPA-PfAgo in detecting Cryptosporidium parvum by real-time fluorescence. 6 Copies / μL to 10 0 Ten-fold serial dilutions of the DNA standards were tested in the copies / μL range to determine the detection limit of the RPA-PfAgo assay. Figure 4 c Specificity of RPA-PfAgo assay for detecting Cryptosporidium parvum under blue light. Figure 4 d is the specificity of RPA-PfAgo in detecting Cryptosporidium parvum by real-time fluorescence. The fluorescence value did not increase. The above results show that the established RPA-PfAgo detection method for Cryptosporidium parvum has high sensitivity and specificity.

[0026] 2.6 Results of RPA-PfAgo detection of Cryptosporidium parvum in clinical samples A total of 37 clinical samples were successfully evaluated to determine the effectiveness of the RPA-PfAgo test. The RPA-PfAgo test results were more than 90% consistent with the fluorescence quantitative PCR test results (refer to Figure 5 ): Figure 5 a is the detection of 37 clinical samples by RPA-PfAgo under blue light, of which 9 were positive and 28 were negative. Figure 5 b RPA-PfAgo detected 37 clinical samples by real-time fluorescence. Table 1 shows that 37 clinical samples were detected by fluorescence quantitative PCR, and 11 were positive, with a coincidence rate of more than 90% with RPA-PfAgo detection.

[0027] Table 1

[0028] Through the above embodiments of the present invention, the scheme of the present invention provides an RPA-PfAgo method for sensitively and rapidly detecting the genome of Cryptosporidium parvum. This method can detect 10 2 The method can obtain 100 copies of Cryptosporidium parvum genome nucleic acid and has no cross-reactivity with other pathogens. Moreover, only two temperatures are needed to complete the process, and the method is more suitable for field environments. In addition, the method of the present invention provides substantial support for accurate Cryptosporidium parvum genome epidemic control and medicine.

[0029] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A RPA-PfAgo detection primer for Cryptosporidium parvum, characterized in that The primer sequences are as follows: CP-RPAF: 5′-TTATCGTATTACTCTCCGTTATAGTCTCCG-3′; CP-RPAR: 5′-ACGGTTGATGTTGATGATGATGATGATGAT-3′.

2. A set of gDNAs for cleaving the double-stranded DNA of the RPA product as claimed in claim 1, wherein the single-stranded DNA has a phosphate group at the 5' end, thereby allowing complementary base pairing with the amplified target fragment. Characterized in that The sequence is: gDNA-1: 5′-TCCTCTGAGTGGAACG-3′; gDNA-2: 5′-ACAGGAACATCCTTTA-3′; gDNA-3: 5′-CAGCCGTTCCACTCAG-3′.

3. The gDNAs according to claim 2, characterized in that: The sequence of the single-stranded DNA used to cut the probe from the double-stranded DNA of the RPA product cut by the gDNAs is: 5′6-FAM-cgcaccatcctttaaagttcctctgagtggggtgcg-BHQ1-3′.

4. An RPA-PfAgo detection system for Cryptosporidium parvum, characterized in that: The RPA-PfAgo detection system comprises: the RPA primer product according to claim 1, the probe according to claim 3, and the gDNAs and buffer according to claim 2.

Images