Molecular marker for identifying corn to improve stem rot resistance and identification method

Abstract

The invention relates to the technical field of corn molecular breeding and biology, in particular to a molecular marker for improving stem rot resistance in corn and an identification method. The method comprises the following steps: identifying the resistance of stem rot in multiple environments by utilizing an advanced RIL group, and excavating two SNP loci on the No.8 chromosome of corn by combining a high-density genetic linkage map and fine positioning. By using the molecular marker information provided by the invention, the disease-resistant site can be efficiently and quickly introduced into other susceptible materials to generate corn stem rot resistant germplasm, and the genotype of a to-be-detected corn material can be accurately identified in a high-throughput manner to screen out the stem rot resistant material.

Description

Technical Field

[0001] The invention belongs to the field of corn molecular breeding and biotechnology, and is specifically used for identifying molecular markers for improving stalk rot resistance in corn and an identification method. Background Art

[0002] Since corn stalk rot is greatly affected by pathogens, environment and genotype, and it is difficult to find high resistance and multi-resistance sources, corn stalk rot is becoming more and more serious. At present, most of the resistance loci that have been located have low effects, and few disease resistance genes have been cloned. Further exploration of corn stalk rot resistance QTLs and disease resistance genes, and development of molecular markers closely linked to QTLs, will provide strong support for molecular breeding of stalk rot resistance to aggregate multiple resistance genes, and is expected to improve corn stalk rot resistance. KASP markers do not need to be typed according to the size of DNA fragments, and can get rid of the relatively cumbersome, low-throughput, and expensive detection method of traditional gel electrophoresis, which is more suitable for the rapidly developing high-throughput molecular detection platform at this stage. Therefore, the development of low-cost KASP molecular markers linked to the QTL of corn resistance to Fusarium graminearum stalk rot suitable for high-throughput molecular detection platforms is of great significance for popularizing the application of molecular marker technology and improving the efficiency and level of corn stalk rot resistance breeding in my country. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to provide a molecular marker and identification method for identifying improved stalk rot resistance in corn. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned herein through the following description.

[0004] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0005] The present invention provides a method for identifying or assisting in identifying corn stalk rot resistance, the method being any one of the following:

[0006] M1. The method comprises detecting the genotypes of the SNP1 site and the SNP2 site in the tested corn genome, and identifying or assisting in identifying the corn stalk rot resistance according to the genotypes, wherein the SNP1 site is a site on the corn chromosome 8, and the nucleotide type thereof is C or T, which is the 50th nucleotide of SEQ ID No.9 in the sequence list; the SNP2 is a site on the corn chromosome 8, and the nucleotide type thereof is A or G, which is the 50th nucleotide of SEQ ID No.16 in the sequence list;

[0007] M2. The method comprises detecting the genotype of the SNP1 site in the tested corn genome, and identifying or assisting in identifying corn stalk rot resistance according to the genotype;

[0008] M3. The method comprises detecting the genotype of the SNP2 site in the corn genome to be tested, and identifying or assisting in identifying corn stalk rot resistance based on the genotype.

[0009] The SNP1 is located on chromosome 8 of maize, i.e., position 169887059 of B73 RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3). The SNP2 is located on chromosome 8 of maize, i.e., position 172364072 of B73 RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3).

[0010] Further, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 60 of the sequence as shown in SEQ ID No.10; the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence as shown in SEQ ID No.17. Further, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 70 of the sequence as shown in SEQ ID No.11; the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence as shown in SEQ ID No.18. Further, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 80 of the sequence as shown in SEQ ID No.12; the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence as shown in SEQ ID No.19. Further, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 90 of the sequence as shown in SEQ ID No.13; the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence as shown in SEQ ID No.20. Further, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 100 of the sequence as shown in SEQ ID No.14; the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence as shown in SEQ ID No.21. Further, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 150 of the sequence as shown in SEQ ID No.15; the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence as shown in SEQ ID No.22. Furthermore, the molecular marker Ks11 is a nucleotide sequence containing a polymorphism of C / T at position 200 of the sequence as shown in SEQ ID No.7; and the molecular marker Ks13 is a nucleotide sequence containing a polymorphism of A / G at position 202 of the sequence as shown in SEQ ID No.8.

[0011] Those skilled in the art know that SEQ ID No.7 is composed of the nucleotide sequence of the SNP1 site (nucleotide No. 200) and its vicinity, and the amount of the nucleotide sequence near the SNP site should not be used as a limiting factor for the protection scope of the present invention, which can be 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 120bp, 150bp, 180bp, 250bp, 300bp, 500bp, 1000bp before and after the SNP site, or any other arbitrary value, and its role is to assist in locating the position of the SNP on chromosome 8 of the maize genome. The same is true for SEQ ID No.8 or SNP2.

[0012] The front and back mentioned herein should be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0013] In the above-mentioned M1 method, according to the genotype identification or auxiliary identification of corn stalk rot resistance, the genotype of the SNP site is CCAA, and the stalk rot resistance of the corn to be tested is higher than that of the corn to be tested with the genotype of the SNP site being CCGG or TTGG, and the stalk rot resistance of the corn to be tested with the genotype of the SNP site being CCGG is higher than that of the corn to be tested with the genotype of the SNP site being TTGG; the genotype of the SNP site is CCAA, which is the homozygous type of the SNP1 site being C and the homozygous type of the SNP2 site being A, the genotype of the SNP site is CCGG, which is the homozygous type of the SNP1 site being C and the homozygous type of the SNP2 site being G, and the genotype of the SNP site is TTGG, which is the homozygous type of the SNP1 site being T and the homozygous type of the SNP2 site being G.

[0014] In the above method, the chromosome of the corn to be tested contains a DNA fragment, which is a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID No.9, or / and contains a sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID No.16.

[0015] The present invention also provides a method for corn breeding, which is any one of the following:

[0016] H1. The method comprises detecting the genotype of corn, and selecting corn with a genotype of CCAA as a parent for breeding, wherein the CCAA is a homozygous type in which the aforementioned SNP1 site is C and the aforementioned SNP2 site is a homozygous type of A;

[0017] H2. The method comprises detecting the genotype of corn, and selecting corn with a genotype of CC as a parent for breeding, wherein CC is a homozygous type in which the aforementioned SNP1 site is C;

[0018] H3. The method includes detecting the genotype of corn, and selecting corn with a genotype of AA as a parent for breeding, wherein AA is a homozygous type with the aforementioned SNP2 site being A.

[0019] The breeding objectives of the method include breeding corn with stalk rot resistance.

[0020] In the above applications and methods, the substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2 can be used to determine the nucleotide types of the SNP1 and SNP2 sites in the above corn genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0021] The present invention also provides any of the following applications of a substance for detecting the polymorphism or genotype of a SNP site in a corn genome:

[0022] A1) Identifying or assisting in identifying resistance to corn stalk rot;

[0023] A2) screening or breeding maize lines, strains or varieties resistant to stalk rot;

[0024] A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot;

[0025] A4) Corn breeding;

[0026] A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot;

[0027] A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to stalk rot;

[0028] A7) preparing a product for screening or breeding corn lines, strains or varieties susceptible to stalk rot;

[0029] A8) Prepare corn breeding products.

[0030] The SNP site is any of the following:

[0031] P1, the SNP sites are SNP1 site and SNP2 site, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.9 in the sequence list, which is C or T; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.16 in the sequence list, which is A or G;

[0032] P2, the SNP site is the SNP1 site;

[0033] P3. The SNP site is the SNP2 site.

[0034] The present invention also provides application of the above-mentioned substance or method in corn breeding.

[0035] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in a corn genome, wherein the product is the aforementioned substance, and the product is any one of:

[0036] C1) Products for detecting single nucleotide polymorphisms or genotypes associated with corn stalk rot resistance;

[0037] C2) Products for identifying or assisting in identifying resistance to corn stalk rot;

[0038] C3) Products used for corn breeding;

[0039] C4) screening or breeding products of corn lines, strains or varieties resistant to corn stalk rot;

[0040] C5) A product of screening or breeding corn lines, strains or varieties susceptible to corn stalk rot.

[0041] In the above products, the substance is the following D1), D2) or D3):

[0042] D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site;

[0043] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0044] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0045] In the above-mentioned applications and methods, the PCR primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker. In the above applications and methods, the product may be a reagent or a kit or a system, and the system may include a combination product of a reagent or a kit, an instrument and an analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader and an online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), and a combination product consisting of PCR primers, PARMS master mix reagents, an online software SNP decoder and a fluorescence quantitative PCR instrument. The product may include the above-mentioned substance for detecting the polymorphism or genotype of the SNP1, SNP2 and / or SNP3 sites in the corn genome.

[0046] In the aforementioned applications or products, the primer composition is F1-1, F1-2, F2-1 and / or F2-2:

[0047] F1-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.1 in the sequence listing, the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.3 in the sequence listing;

[0048] F1-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of 176-200th bases of SEQ ID No.7 in the sequence listing and T at the 200th base, a single-stranded DNA having a nucleotide sequence of 178-200th bases of SEQ ID No.7 in the sequence listing and C at the 200th base, and a single-stranded DNA represented by bases 219-244 of SEQ ID No.7 in the sequence listing;

[0049] F2-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.4 in the sequence listing, the single-stranded DNA shown in SEQ ID No.5 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.6 in the sequence listing;

[0050] F2-2, a primer set consisting of a single-stranded DNA whose nucleotide sequence is the 181st to 202nd base of SEQ ID No. 8 in the sequence listing with A at the 202nd base, a single-stranded DNA whose nucleotide sequence is the 182nd to 202nd base of SEQ ID No. 8 in the sequence listing with G at the 202nd base, and a single-stranded DNA represented by the 278th to 305th bases of SEQ ID No. 8 in the sequence listing.

[0051] The present invention provides application of the above product in corn breeding.

[0052] The aforementioned DNA molecule is any of the following:

[0053] B1) the nucleotide sequence is SEQ ID No. 7 in the sequence listing or the DNA molecule of positions 176 to 244 of SEQ ID No. 7 or positions 178 to 244 of SEQ ID No. 7;

[0054] B2) the nucleotide sequence is SEQ ID No. 8 in the sequence listing or the DNA molecule at positions 181 to 305 of SEQ ID No. 8 or the DNA molecule at positions 182 to 305 of SEQ ID No. 8;

[0055] B3) A combination consisting of D1) and D2).

[0056] The use of the aforementioned DNA molecule in any of the following:

[0057] A1) Identifying or assisting in identifying resistance to corn stalk rot;

[0058] A2) screening or breeding maize lines, strains or varieties resistant to stalk rot;

[0059] A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot;

[0060] A4) Corn breeding;

[0061] A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot;

[0062] A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to corn stalk rot;

[0063] A7) preparing a product for screening or breeding corn strains, lines or varieties susceptible to corn stalk rot;

[0064] A8) Prepare corn breeding products.

[0065] The SNP sites provided by the present invention can be used to identify or assist in identifying corn stalk rot resistance or for corn breeding. In breeding stalk rot-resistant corn, it is best to select corn with a SNP1 site genotype of CC and a SNP2 site genotype of AA, or select corn with a SNP1 site genotype of CC or a SNP2 site genotype of AA as parents for breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 The disease manifestations of stem rot in parental inbred lines KA105 and KB204; (A) Field phenotype of stem rot in parental inbred lines; (B) Disease classification of parental inbred lines under four environments. "***" indicates significant at the 0.001 level.

[0067] Figure 2 This is a QTL mapping result diagram for stalk rot disease classification under single environment and multi-environment joint analysis conditions. The lines represent the QTL mapping results of stalk rot disease classification on maize chromosome 8 under different environments; the X-axis represents the genetic map position in cM; the Y-axis represents the LOD value. In the additive effect analysis of QTL, the lines represent the additive effect values ​​of different QTLs; the X-axis represents the genetic map position in cM; the Y-axis represents the additive effect value, and the positive and negative values ​​represent the direction of action.

[0068] Figure 3 Effect verification and fine positioning of target QTL; (A) QTL effect verification; (B) QTL fine positioning; (C) DSI distribution of heterozygous single plant segregation offspring. If there is a significant difference in DSI between the two groups of genotypes (P<0.05), it is inferred that the parental recombinant individual carries the disease resistance gene, represented by R; on the contrary, if there is no significant difference between the two groups of genotypes (P>0.05), it is inferred that the parental recombinant individual does not carry the disease resistance gene, represented by S. Black rectangles represent homozygous disease resistance allele segments; white rectangles represent homozygous disease susceptible allele segments; gray rectangles represent heterozygous allele segments. The bar graph represents the DSI distribution of plants with different genotypes. "**" indicates P<0.01, and "***" indicates P<0.001. DETAILED DESCRIPTION

[0069] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0070] Fusarium graminearum: recorded in the non-patent document "Li Yaling, Long Shusheng, Ma Bingyuan. Comparative test of cultivation characteristics of Fusarium graminearum [J]. Shaanxi Agricultural Science. 1989 (4): 36-37", the public can obtain it from Northwest Agriculture and Forestry University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. Disease-resistant parent inbred line KA105 (abbreviated as KA105): recorded in the non-patent document "Wang Boxin, Wang Yahui, Chen Pengfei, Liu Xudongyu, Feng Zhiqian, Hao Yinchuan, Zhang Renhe, Zhang Xinghua, Xue Jiquan. Analysis of combining ability of maize inbred lines derived from Shaanxi A group and Shaanxi B group under different density conditions [J]. Acta Agronomica Sinica. 2017, 43 (9): 1328-1336", the public can obtain it from Northwest Agriculture and Forestry University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. Susceptible parent inbred line KB204 (KB204 for short): recorded in the non-patent document "Tian Xiaokang. Evaluation and association analysis of lodging resistance of maize inbred lines bred in Shaanxi A group and Shaanxi B group [D]. Northwest A&F University. 2020", the public can obtain it from Northwest A&F University. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. RIL family: The recombinant inbred line is produced by hybridizing the disease-resistant inbred line KA105 and the disease-susceptible inbred line KB204 to produce an F2 population, which is continuously selfed to the F7-8 generation through single seed transmission to form an F 7:8 Recombinant Inbred Line (RIL) population, totaling 240 copies.

[0071] Population 1: includes the disease-resistant inbred line KA105, the disease-susceptible inbred line KB204 and the RIL family. Detailed information is as follows:

[0072] Table 1 RIL pedigrees (240 copies)

[0073]

[0074]

[0075] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0076] The following examples used Statistics Analysis System (SAS) 9.2 statistical software to process the data. The experimental results were expressed as BLUP values ​​and tested using One-way ANOVA. P<0.05 (*) indicated a significant difference, and P<0.01 (**) and P<0.001 (***) indicated a very significant difference.

[0077] Example 1: Mining SNPs for detecting corn stalk rot

[0078] 1. QTL mapping of resistance to Fusarium graminearum stem rot in maize

[0079] method:

[0080] (1) Characteristic investigation

[0081] 50-55 days after inoculation with Fusarium graminearum, the occurrence of corn stalk rot in the field was identified by the stem splitting method. The stalks were split longitudinally to observe the infection of pathogens at the root and stem base and the degree of pith tissue necrosis. The disease rating scale (DRS) was used to identify the phenotype of stalk rot, which was divided into 5 levels:

[0082] Level 1: Highly resistant, normal plants, no obvious symptoms;

[0083] Level 3: disease-resistant, the plant stem surface is normal, and brown lesions appear at the stem tip;

[0084] Level 5: Moderate resistance, the base of the plant stem becomes soft and faded, with obvious water stains; the medullary tissue between the first and second internodes at the base of the stem shrinks and decomposes, and browning symptoms appear;

[0085] Level 7: Infected, the lower stem nodes of the plant gradually turn from green to brown, the stem becomes soft and severely dehydrated, the internal stem pith tissue decomposes into filaments and shrinks severely, and white or rose-red hyphae appear on the stem nodes; the root system becomes soft, dry, and sparse but does not fall over; the fruit clusters begin to droop;

[0086] Level 9: Highly susceptible, the stem of the plant is hollow and constricted, with only necrotic vascular tissue remaining inside the stem, the nodes and internodes turn black and have rose-red marks; the root system is sparse, rotten and hollow, the plant is bent or lodged; the bracts of the female ear are dry and loose, and the female ear droops.

[0087] Select 10 plants with consistent growth in each family, observe and record the disease grade of stem rot one by one, take the average value as the phenotypic value of each family, and use the disease grade mean of a single family to perform multi-environment joint analysis to calculate the BLUP value to represent the multi-environment joint analysis phenotypic value of the family. Among them, the disease grade BLUP value between 1-2 is highly resistant; between 2.01-3 is resistant; between 3.01-5 is moderately resistant; between 5.01-7 is susceptible; and between 7.01-9 is highly susceptible. Investigate and record the number of days from sowing to 50% of the plants shedding pollen in each family.

[0088] (2) Phenotypic data analysis

[0089] In order to evaluate the significance of genotype and environment variance and the interaction between the two, the "PROC MIXED" program in SAS (V9.2) software was used to calculate the variance components. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype was used as a fixed effect, flowering date as a covariate, and environment, replication within environment, and interaction between genotype and environment as random effects. The results of variance analysis were used to calculate the broad-sense heritability (H) of stem rot resistance. 2 ): in, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effect of environmental variation on phenotype, the SAS (V9.2) mixed linear model was used to estimate the best linear unbiased prediction (BLUP) of each family. The BLUP value was used as the data for multi-environment joint analysis to draw the phenotypic distribution histogram of each trait, calculate the phenotypic correlation coefficient, and locate the multi-environment joint QTL.

[0090] (3) Construction of linkage map

[0091] At the 5-6 leaf stage of corn, 5 young leaves of plants with consistent growth in each family were selected and mixed, and genomic DNA was extracted using the conventional CTAB method. Genotyping analysis was performed using the Maize6H-60K chip independently developed by the Corn Research Center of Beijing Academy of Agricultural and Forestry Sciences. The linkage map was constructed using QTL ICImapping 4.2 software. Finally, 48,087 polymorphic SNP markers were obtained, and redundant markers were removed and merged into 7,200 bin markers.

[0092] (4) QTL positioning

[0093] Based on the constructed high-density genetic linkage map, the phenotypic values ​​of four stem rot evaluation indicators in the RIL population in single environment and multiple environments were combined to detect stem rot resistance QTL. The composite interval mapping (CIM) method of Windows QTL Cartographer V2.5 software was used for preliminary positioning, and LOD=3 was used as the threshold line. The confidence interval of the target QTL was determined by decreasing 2 LOD values ​​on both sides of the LOD value peak.

[0094] Results: Resistance to Fusarium graminearum stem rot of parental materials was identified in four environments (2019YL, 2019SY, 2020YL and 2020SY). Figure 1 ), the results of statistical analysis showed that there was a significant difference in stem rot resistance between the disease-resistant parent KA105 and the susceptible parent KB204 (Table 2). The RIL population showed a wide range of continuous variations in different environments, indicating that stem rot resistance is a quantitative trait controlled by multiple genes.

[0095] Table 2 Phenotypic distribution of recombinant inbred lines of two parents under multiple environments

[0096]

[0097] Note: 2019YL: Yangling in 2019; 2019SY: Sanyuan in 2019; 2020YL: Yangling in 2020; 2020SY: Sanyuan in 2020; BLUP: multi-environment joint analysis.

[0098] In the RIL population, the disease grading ranged from 1 to 9, with a mean of 2.91 to 5.43 and a coefficient of variation of 33% to 65%. The results of the joint variance analysis showed (Table 3) that the differences between genotypes in the RIL population were extremely significant, and the differences between environments and between genotypes and environments were extremely significant. The estimated genetic variance was greater than the estimated variance of the environment and the interaction between genotypes and environments, indicating that genetic factors were the main source of variation. The heritability of stem rot resistance in the Pop.1 population was 81%.

[0099] Table 3 Variance and heritability analysis of stem rot phenotypic indicators in multiple environments

[0100]

[0101] Note: *** indicates P < 0.001.

[0102] The phenotypic data of disease classification in single environment and multi-environment BLUP values ​​were used to locate the QTL for resistance to Fusarium graminearum stem rot. A QTL for resistance to Fusarium graminearum stem rot was detected on chromosome 8, bin 8.08 ( Figure 2), located between physical positions 168,681,373bp–173,552,374bp (B73 RefGen_V3), with a confidence interval of approximately 4.87Mb. This QTL was co-located in 2020YL and BLUP values ​​(Table 4). The explained phenotypic variation was 4.42%–9.24%, and the resistance allele originated from the disease-resistant parent KA105.

[0103] Table 4 QTL analysis of disease classification of Fusarium graminearum stem rot under single and multiple environmental conditions

[0104] Characteristics environment chromosome Left side mark Right flank marking LOD Contribution rate R2 (%) DRS BLUP 8 AX-107940009 AX-107952274 5.80 9.24 DRS 2020YL 8 AX-107940009 AX-107952274 3.13 4.42

[0105] 2. Verification and fine positioning of QTL effects for maize stalk rot resistance

[0106] Methods: The QTL effect was verified and finely positioned by the recombinant progeny verification method. According to the initial QTL positioning results, the remaining heterozygous lines with fixed background genotypes in the target segment were screened in the RIL population, and the KASP marker was developed to screen the individuals that exchanged in the target segment. The key recombinant individuals were verified by the genotype and stalk rot phenotype of the offspring for effect verification and fine positioning. The genotype and stalk rot disease graded identification of the recombinant single plant offspring were performed, and the disease severity index (DSI) of each genotype was calculated. The difference in maize stalk rot resistance among the three genotypes was tested by one-tailed t test. If the difference between different genotypes was significant (P < 0.05), it means that the heterozygous region carries the resistance locus, and vice versa.

[0107] DSI (%) = ∑ (disease grade × number of plants with corresponding grade) × 100 / (maximum disease grade × total number of plants)

[0108] result:

[0109] (1) The remaining heterozygous line material 638RIL-31 screened in the Pop.1 population was used to verify the effect and fine-map the target QTL, develop molecular markers in the target interval (Table 5), and screen recombinant individuals that exchanged only in the candidate segment of the QTL. The effect verification of the resistance QTL showed that the homozygous allele from the disease-resistant parent could significantly improve the field resistance to stem rot (P<0.001)( Figure 3A). Among them, the average DSI of plants with homozygous disease-resistant KA105 / KA105 genotype was 23.15% in 2021, and the average DSI of plants with homozygous disease-susceptible KB204 / KB204 genotype was 44.73%; in 2022, the average DSI of plants with homozygous KA105 genotype in Yangling was 49.88%, and the average DSI of plants with homozygous KB204 genotype was 65.08%. The t-test results showed that there was a very significant difference in DSI between the two genotypes (P<0.001). In summary, the segregating population produced by the remaining heterozygous line 638RIL-31 was used to detect the effect of resistance QTL. The results of the two-year test were very significantly different, indicating that the genetic effect of the QTL is real. The allele derived from KA105 can stably reduce the DSI by 15.2–21.58%, significantly improving the field resistance of plants to Fusarium graminearum stem rot.

[0110] (2) Molecular markers were encrypted in the candidate interval of the target QTL, and molecular marker primers were designed with reference to the maize B73 reference genome V3 version sequence, and molecular markers Ks11 and Ks13 were used at both ends of the candidate interval. Ks11, located at position 169887059 of maize chromosome 8, was named SNP1. The nucleotide sequence of the SNP site and the first 201bp bases and the last 199bp bases totaling 401bp (i.e., bases 169886857-169887257 of maize chromosome 8) is shown below, and its reverse complementary sequence is shown in SEQ ID No.7 in the sequence table. The 200th base in SEQ ID No.7 is the SNP site, i.e., base 169887059 of B73 RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3), which is a C / T polymorphism. In SEQ ID No.7, Y is C or T, and the genotype of the SNP site is the following three: CC, TC or TT. The CC is the homozygous type of the SNP site being C, the TT is the homozygous type of the SNP site being T, and the TC is the heterozygous type of the SNP site being C and T. The corn variety with the genotype CC of the SNP site has significantly higher stalk rot resistance than the corn variety with the genotype TT or TC of the SNP site.

[0111] Ks13 is located at position 172364072 of chromosome 8 of maize, and is named SNP2. The SNP site and the nucleotides near it are shown in SEQ ID No.8 of the sequence table, wherein the 202nd base is the SNP site, that is, the 172364072nd base of B73RefGen_V3 (https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3), which is an A / G polymorphism. In SEQ ID No.8, R is A or G, and the genotype of the SNP site is as follows: AA, AG or GG. The AA is the homozygous type of the SNP site A, the GG is the homozygous type of the SNP site G, and the AG is the heterozygous type of the SNP site A and G. The corn varieties with the genotype of the SNP site AA have significantly higher resistance to stalk rot than the corn varieties with the genotype of the SNP site GG or AG.

[0112] (3) Ks11 and Ks13 were used to divide the heterozygous progeny of 638RIL-31 into three recombinant types. The fine mapping results showed that the DSI difference between the homozygous KA105 / KA105 genotype plants and the KB204 / KB204 genotype plants in type II was not significant (P>0.05) ( Figure 3 B), there were significant differences in DSI between the homozygous KA105 genotype plants and the homozygous KB204 genotype plants in types I, III and IV (P<0.01), which indicated that the KA105 donor fragment in the heterozygous segments of types I, III and IV carried the QTL for resistance to Fusarium graminearum stem rot. Based on the overlapping heterozygous segments of the two types, it was determined that the target QTL was mainly located between markers Ks11 and Ks13, with a physical distance of about 2.48Mb (B73 RefGen_V3). Among them, there was an extremely significant difference in DSI between the homozygous disease-resistant genotype and the homozygous disease-susceptible genotype plants in type III (P<0.01) ( Figure 3 Middle C).

[0113] Maize chromosome 8 bases 169886857-169887257:

[0114] TTCAAGGCCGATGACAAGTTGATAACAATTAGTGGCACTGTGATTTGTTCCTATTCGTCTATTATAATGTGATAACAATTAGAGAACGGATGTAGTAGTACATTCGTTCTCGATCATTTATAAACTAAACAACGACAAATAAAGACAAATAGAAAATAACGGAGAGGGTAATATTTTAGGCGACCTGCTAAAGTACATAATRGGGAAGAAAGTACGTCACCTTGTTCCTTTGCTCCGCTCCATTTTCTAATGGGGAAGAAAGTACTGAAGTTTTTTTTTTCTTCCAAAAAATAAAAAACACATTCCTCATTTTTAGAACGCGATACCTTTGTTTTGTTCTGATCCCTCTGGCATCTGCCTGAAACATGATAGTAATACTATTACTAGTGTGATCTACGGCA

[0115] SEQ ID No.7Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0116] TGCCGTAGATCACACTAGTAATAGTATTACTATCATGTTTCAGGCAGATGCCAGAGGGATCAGAACAAAACAAAGGTATCGCGTTCTAAAAATGAGGAATGTGTTTTTTATTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGATCGAGAACGAATGTACTACTACATCCGTTCTCTAATTGTTATCACATTATAATAGACGAATAGGAACAAATCACAGTGCCACTAATTGTTATCAACTTGTCATCGGCCTTGAA

[0117] SEQ ID No.8Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0118] CTTCTGGAGGGAGCTCCTTATCCAAAGATATATCGTCGAGATCTGATCTAGCAATCCTTTGAATACATTTGTCGATCACTTGAGTCAGCCCTGAGTGGGAAGCAACTTCCAGAATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAATGAATAATGATTCCATTTCAATTCATAGACTTCAAGCCACCAGGTTCGCTTGAATCAACTAAAAAAGCAATAGCCAACAATTTTAGTAGTTCAACTATTAATAGTTTTTT

[0119] SEQ ID No.9Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0120] ATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTAT GTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTT

[0121] SEQ ID No.10Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0122] TTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCT

[0123] SEQ ID No.11 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0124] ACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCG

[0125] SEQ ID No.12 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0126] GAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTT

[0127] SEQ ID No.13 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0128] TTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGAT

[0129] SEQ ID No.14 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0130] GTGTTTTTTATTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGATCGAGAACGAA

[0131] SEQ ID No.15 Ks11:(Chr.8_169887059,B73 RefGen_V3)

[0132] CCAGAGGGATCAGAACAAAACAAAGGTATCGCGTTCTAAAAATGAGGAATGTGTTTTTTATTTTTTGGAAGAAAAAAAAAACTTCAGTACTTTCTTCCCCATTAGAAAATGGAGCGGAGCAAAGGAACAAGGTGACGTACTTTCTTCCCYATTATGTACTTTAGCAGGTCGCCTAAAATATTACCCTCTCCGTTATTTTCTATTTGTCTTTATTTGTCGTTGTTTAGTTTATAAATGATCGAGAACGAATGTACTACTACATCCGTTCTCTAATTGTTATCACATTATAATAGACGAAT

[0133] SEQ ID No.16 Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0134] TTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTA

[0135] SEQ ID No.17 Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0136] GTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATA

[0137] SEQ ID No.18 Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0138] CTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATAT

[0139] SEQ ID No.19 Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0140] ACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTG

[0141] SEQ ID No.20Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0142] AATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAA

[0143] SEQ ID No.21Ks13:(Chr.8_172364072,B73 RefGen_V3)

[0144] CAACTTCCAGAATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCCRTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAATGAATAATGA

[0145] SEQ ID No.22Ks13: (Chr.8_172364072,B73 RefGen_V3)

[0146] AATCCTTTGAATACATTTGTCGATCACTTGAGTCAGCCCTGAGTGGGAAGCAACTTCCAGAATAGGAATAACATCCTCCACTAGAGTCTTGTCTACAAAATTAAGAAGCCGGCGCTGTAGAAGAAGACCATGTTAACCATTTGCCTTCC RTAAATCGACAAAGCAAAGCTGAATTGATGTTAAACAGATTGATAAATTATACAGCCATAAATGTAATATACAAATGTTGAGCAGCCTAATGAATAATGATTCCATTTCAATTCATAGACTTCAAGCCACCAGGTTCGCTTGAATCAACT

[0147] Ks11 was named SNP1, and Ks13 was named SNP2.

[0148] Example 2: Establishment of a method for detecting corn stalk rot resistance

[0149] 1. Convert SNP markers to KASP markers and design primer sets for detecting the markers

[0150] The two SNP markers identified in Example 1 are converted into KASP markers for use in molecular marker-assisted selection breeding. The primer set for detecting KASP markers based on KASP technology is the KASP primer set, including a KASP primer pair for SNP1 and a KASP primer pair for SNP2.

[0151] Since the GC content of bases 169886857 to 169887257 of maize chromosome 8 cannot be used to design a KASP primer pair, the inventors used its reverse complementary sequence, SEQ ID No. 7, to design a KASP primer pair for SNP1. The KASP primer pair for SNP1 includes two upstream primers (primer Ks11-X and primer Ks11-Y) and one downstream primer (primer Ks11-R) of SNP1. SNP1 is located at the 200th nucleotide of the DNA molecule shown in SEQ ID No. 7 of the sequence list in the maize genome. Primer Ks11-X is a primer with a FAM fluorescent label sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks11-R amplifies a fragment of SNP1 with T (corresponding to positions 176-244 of SEQ ID No.7, and the 200th nucleotide is T), and the fluorescent signal of the FAM group can be read using an enzyme reader or a fluorescent quantitative PCR instrument; Primer Ks11-Y is a primer with a HEX fluorescent label sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks11-R amplifies a fragment of SNP1 with C (corresponding to positions 178-244 of SEQ ID No.7, and the 200th nucleotide is C), and the fluorescent signal of the HEX group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0152] The KASP primer pair of SNP2 includes two upstream primers (primer Ks13-X and primer Ks13-Y) and one downstream primer (primer Ks13-R) of SNP. SNP2 is the 202nd base of the DNA molecule shown in SEQ ID No. 8 in the sequence list located in the corn genome. Primer Ks13-X is a primer with a FAM fluorescent label sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks13-R amplifies the fragment of SNP2 with A (corresponding to positions 181-305 of SEQ ID No.8, and the 202nd nucleotide is A), and the fluorescent signal of the FAM group can be read using an enzyme reader or a fluorescent quantitative PCR instrument; Primer Ks13-Y is a primer with a HEX fluorescent label sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks13-R amplifies the fragment of SNP2 with G (corresponding to positions 182-305 of SEQ ID No.8, and the 202nd nucleotide is G), and the fluorescent signal of the HEX group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0153] Table 5 Primers of KASP markers for QTL effect verification

[0154]

[0155] Note: Lowercase letters gaaggtgaccaagttcatgct are the specific fluorescent tag sequence FAM; lowercase letters gaaggtcggagtcaacggatt are the specific fluorescent tag sequence HEX.

[0156] 2. Detection Method

[0157] 1. DNA extraction

[0158] The genomic DNA of the leaves of the corn to be tested is extracted and diluted to obtain a template solution, wherein the DNA concentration in the template solution is 30-40 ng / μL.

[0159] 2. KASP molecular marker detection

[0160] First, dilute the six primers to 100 μM with ddH2O, and then prepare the primer working solution according to the following formula. The primer working solution includes primer working solution 1 and primer working solution 2, which can be used in the following KASP reaction system. Primer working solution 1: primer Ks11-X 12 μL, primer Ks11-Y 12 μL, primer Ks11-R 30 μL, ddH2O 46 μL. Primer working solution 2: primer Ks13-X 12 μL, primer Ks13-Y 12 μL, primer Ks13-R 30 μL, ddH2O 46 μL. KASP reaction system: includes 2 μL HiGeno 2×Probe Mix, 1 μL DNA template (20–50 ng / μL), 0.944 μL ddH2O and 0.056 μL primer working solution. KASP was performed on a Bio-Rad T100 Thermal Cycler PCR amplification instrument using the Touch down PCR amplification program. The KASP reaction program was as follows: 94°C pre-denaturation for 15 min, first step amplification reaction, 94°C denaturation for 20 s, 65°C annealing for 60 s, 10 cycles, second step amplification reaction, 94°C denaturation for 20 s, 55°C annealing and extension for 60 s, 38 cycles. A blank control (NTC) was also set up in the experiment in which no template DNA was added to the reaction system, and one or more blank controls were set up for each plate.

[0161] 3. Perform fluorescence scanning.

[0162] The PCR reaction products were scanned and the fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). The SNP typing software KclusterCaller (V 3.4.1.36; LGC Hoddesdon, UK) was used to read the genotype data and perform cluster analysis. The genotype of the FAM allele was X:X, the genotype of the HEX allele was Y:Y, and the heterozygous genotype was X:Y. The FAM excitation wavelength was 485nm and the emission wavelength was 520nm. The HEX excitation wavelength was 535nm and the emission wavelength was 556nm. The system reference fluorescence ROX excitation wavelength was 575nm and the emission wavelength was 610nm.

[0163] If the fluorescence using primer working solution 1 shows only the fluorescence signal of the FAM group, the Ks11 (i.e., SNP1) genotype of the corn to be tested is TT (i.e., Ks11 is the homozygous type of T in the corn genome); if it shows only the fluorescence signal of the HEX group, the genotype of Ks11 of the corn to be tested is CC (i.e., Ks11 is the homozygous type of C in the corn genome); if it shows both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group, the genotype of Ks11 of the corn to be tested is TC (i.e., Ks11 is the heterozygous type of C and T in the corn genome). If the fluorescence using primer working solution 2 shows only the fluorescence signal of the FAM group, the Ks13 (i.e., SNP2) genotype of the corn to be tested is AA (i.e., Ks13 is the homozygous type of A in the corn genome); if it shows only the fluorescence signal of the HEX group, the genotype of Ks13 of the corn to be tested is GG (i.e., Ks13 is the homozygous type of G in the corn genome); if it shows both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group, the genotype of Ks13 of the corn to be tested is AG (i.e., Ks13 is the heterozygous type of A and G in the corn genome).

[0164] It can be seen that the genotype of the corn plant to be tested can be defined according to the following rules:

[0165] CCAA genotype: If the fluorescence using primer working solution 1 shows only the fluorescence signal of the HEX group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the FAM group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is CC and the Ks13 (i.e. SNP2) genotype of the corn to be tested is AA. CCAA identification accuracy = CCAA genotype plants resistant to stalk rot / CCAA genotype plants × 100%.

[0166] CCGG genotype: If the fluorescence using primer working solution 1 shows only the fluorescence signal of the HEX group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the HEX group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is CC and the Ks13 (i.e. SNP2) genotype of the corn to be tested is GG. CCGG identification accuracy = CCGG genotype plants resistant to stalk rot / CCGG genotype plants × 100%.

[0167] TTAA genotype: If the fluorescence using primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the FAM group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is TT and the Ks13 (i.e. SNP2) genotype of the corn to be tested is AA. TTAA identification accuracy = TTAA genotype plants resistant to stalk rot / TTAA genotype plants × 100%.

[0168] TTGG genotype: If the fluorescence using primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence using primer working solution 2 shows only the fluorescence signal of the HEX group, then the Ks11 (i.e. SNP1) genotype of the corn to be tested is TT and the Ks13 (i.e. SNP2) genotype of the corn to be tested is GG. TTGG identification accuracy = TTGG genotype plants susceptible to stem rot / TTGG genotype plants × 100%.

[0169] Example 3: Detecting corn stalk rot resistance using the method of Example 2

[0170] 1. Practical determination of resistance to corn stalk rot

[0171] 1. Field design

[0172] The parents KA105 and KB204 and their 240 RIL populations (RIL families) were identified for stem rot resistance in Yangling, Shaanxi and Sanyuan, Shaanxi in 2019-2020. The location and year were uniformly defined as the environment, abbreviated as "year + location initials", such as 2019YL. The field experiment adopted an incomplete randomized block design, with 2 replications set in each environment, single-row planting, 4m row length, 0.6m row spacing, and a density of 5500 plants / mu. The field management measures were the same as those for local field corn.

[0173] 2. Pathogen culture

[0174] Cultivation of Fusarium graminearum strains: Inoculate the pathogenic bacteria strains isolated from single spores onto PDA (Potato Dextrose Agar) medium, and culture them in a constant temperature incubator at 25°C for 5-7 days in the dark. When the mycelium covers the surface of the medium, cut it into equal parts with the medium and inoculate it onto the sterilized corn kernel medium to propagate the inoculum of Fusarium graminearum. Propagation of Fusarium graminearum inoculum: Select healthy and full corn kernels and soak them in water for 20h-22h, boil them in boiling water for 100min, and lay the cooked kernels flat to dry; pack them into high temperature resistant inoculum bags at 500g each, and sterilize them at 121°C for 50min; after cooling, inoculate the Fusarium graminearum grown on the PDA medium, and seal them with a breathable sealing film; culture them in the dark at 25°C for 15-20 days until the mycelium covers the surface of the kernels. During this period, rub the bag every two days to make the kernels and the mushroom blocks fully contact. The grown inoculum is dried in the shade for 3-4 days, packed into sacks and placed in a cold storage for use. Preparation of PDA solid culture medium: Wash and peel fresh potatoes, cut them into pieces, weigh 200 g, boil them in boiling water for 30 min, filter through 8 layers of gauze, and collect the filtrate; weigh 20 g of glucose and add it to dissolve, weigh 15 g of agar powder, heat and dissolve it, then pour it into the filtrate, stir evenly, make the solution volume to 1 L, sterilize it at high temperature and high pressure at 121℃ / 20 min, divide it into portions and cool it for use, or store it in a 4℃ refrigerator.

[0175] 3. Intra-field bacteria

[0176] During the tasseling period of corn, the field inoculation method of burying the roots is used. Before inoculation, the cultivated seed inoculation material is stirred and mixed. During inoculation, a pit is dug 5-10 cm near the root of the plant, some fibrous roots are cut off to create wounds, 75-85g of corn kernels with bacteria are placed in the pit, and the soil is covered and compacted. After the inoculation is completed, the field is irrigated to keep the soil moist to promote the reproduction and infection of pathogens.

[0177] 4. Characteristic investigation

[0178] The occurrence of corn stalk rot in the field was identified by the stem splitting method. 50-55 days after inoculation, the plants were cut at the cob attachment and split longitudinally along the stem to observe the pathogen infection at the root and stem base and the degree of pith tissue necrosis. The disease rating scale (DRS) was used to identify the phenotype of stalk rot, which was divided into 5 levels:

[0179] Level 1: Highly resistant, the plant is normal without obvious symptoms; Level 3: Resistant, the surface of the plant stem is normal, and brown lesions appear on the stem tip; Level 5: Moderately resistant, the base of the plant stem becomes soft and faded, with obvious water stains; the pith tissue of the 1st and 2nd internodes at the base of the stem shrinks and decomposes, and browning symptoms appear; Level 7: Susceptible, the lower nodes of the plant gradually turn from green to brown, the stem becomes soft and severely dehydrated, the internal pith tissue decomposes into filaments and shrinks severely, and white or rose-red hyphae appear on the nodes; the root system becomes soft, dry, and sparse but does not lodge; the ear begins to droop; Level 9: Highly susceptible, the plant stem is hollow and constricted, only necrotic vascular tissue is retained inside the stem, the nodes and internodes turn black and have rose-red marks; the root system is sparse, rotten and hollow, and the plant breaks or lodges; the bracts of the female ear are dry and loose, and the female ear droops.

[0180] Select 10 plants with consistent growth in each family, observe and record the disease grade of stem rot one by one, take the average value as the phenotypic value of each family, and use the disease grade mean of a single family to perform multi-environment joint analysis to calculate the BLUP value to represent the multi-environment joint analysis phenotypic value of the family. Among them, the disease grade BLUP value between 1-2 is highly resistant; between 2.01-3 is resistant; between 3.01-5 is moderately resistant; between 5.01-7 is susceptible; and between 7.01-9 is highly susceptible. Investigate and record the number of days from sowing to 50% of the plants shedding pollen in each family.

[0181] 5. Phenotypic data analysis

[0182] In order to evaluate the significance of genotype and environment variance and the interaction between the two, the "PROC MIXED" program in SAS (V9.2) software was used to calculate the variance components. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype was used as a fixed effect, flowering date as a covariate, and environment, replication within environment, and interaction between genotype and environment as random effects. The results of variance analysis were used to calculate the broad-sense heritability (H) of stem rot resistance. 2 ): in, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effect of environmental variation on phenotype, the SAS (V9.2) mixed linear model was used to estimate the best linear unbiased prediction (BLUP) of each family. The BLUP value was used as the data for multi-environment joint analysis to draw the phenotypic distribution histogram of each trait, calculate the phenotypic correlation coefficient, and locate the multi-environment joint QTL.

[0183] 6. Using Ks11 and Ks13 to identify corn stalk rot resistance

[0184] The genotypes of Ks11 and Ks13 of the tested corn shown in Table 1 were detected according to the method of Example 2.

[0185] The disease classification and genotype results of the tested corn shown in Table 1 are shown in Table 6, and the heterozygous genotype is not included in Table 6. In the Pop.1 population, except for the target QTL fine mapping family 638RIL-31, there are 122 recombinant inbred lines with homozygous genotypes at the Ks11 and Ks13 molecular markers in the remaining 239 recombinant inbred families.

[0186] The phenotypic identification of RIL families was based on the selection of 10 plants with consistent growth in each family under a single environment, and the incidence of stem rot was observed and recorded one by one. Finally, the average value of the 10 materials was used as the family phenotypic value. The disease grading of a single family was expressed using the BLUP value of multi-environment joint analysis.

[0187] Table 6 Alleles and phenotypes of molecular markers Ks11 and Ks13

[0188]

[0189]

[0190]

[0191]

[0192] Note: Ks11: CC (disease resistance allele), TT (disease susceptible allele); Ks13: AA (disease resistance allele), GG (disease susceptible allele)

[0193] Table 7 Significance analysis of molecular markers Ks11 and Ks13 for stalk rot disease classification

[0194] ks11 ks13 Phenotype RIL family coefficient (number) BLUP value CC AA Disease resistance 36 3.29±0.30c CC GG Disease resistance 18 <![CDATA[3.70±0.27 b ]]> TT GG Infection 35 <![CDATA[5.21±0.39 a ]]>

[0195] Note: Ks11: CC (resistance allele), TT (susceptibility allele); Ks13: AA (resistance allele), GG (susceptibility allele); Different lowercase letters indicate significant differences (P<0.05).

[0196] The statistical results of molecular markers Ks11 and Ks13 are shown in Tables 8 and 9. The BLUP value of the recombinant inbred line with the genotype CC at SNP1 (i.e., Ks11) was significantly lower than that of the recombinant inbred line with the genotype TT (P < 0.001). The BLUP value of the recombinant inbred line with the genotype AA at SNP2 (i.e., Ks13) was significantly lower than that of the recombinant inbred line with the genotype GG (P < 0.05).

[0197] Table 8 Significance analysis of disease grading of different genotypes of molecular marker Ks11

[0198]

[0199] Note: The t-test was used to analyze the significance of stem rot phenotypes. * indicates significance at the 0.05 level, ** indicates significance at the 0.01 level, and *** indicates significance at the 0.001 level.

[0200] Table 9 Significance analysis of disease grading of different genotypes of molecular marker Ks13

[0201]

[0202] Note: The t-test was used to analyze the significance of stem rot phenotypes. * indicates significance at the 0.05 level, ** indicates significance at the 0.01 level, and *** indicates significance at the 0.001 level.

[0203] The above results show that the SNP molecular markers Ks11 and Ks13 that are closely linked to the QTL for resistance to Fusarium graminearum stalk rot can be used for identification of corn stalk rot resistance. In breeding stalk rot-resistant corn, it is best to select corn with a CC genotype at SNP site Ks11 and an AA genotype at SNP site Ks13 or a CC genotype at SNP site Ks11 or an AA genotype at SNP site Ks13 as parents for breeding.

[0204] Supplementary Table 6

[0205]

[0206] Note: “638RIL-9-1” and “638RIL-9-2” represent different strains of 638RIL-9 family, and the same applies to other strains.

[0207] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for identifying or assisting in identifying corn stalk rot resistance, characterized in that: The method is any of the following: M1. The method comprises detecting the genotypes of the SNP1 site and the SNP2 site in the tested corn genome, and identifying or assisting in identifying the corn stalk rot resistance according to the genotypes, wherein the SNP1 site is a site on the corn chromosome 8, and the nucleotide type thereof is C or T, which is the 50th nucleotide of SEQ ID No.9 in the sequence list; the SNP2 is a site on the corn chromosome 8, and the nucleotide type thereof is A or G, which is the 50th nucleotide of SEQ ID No.16 in the sequence list; M2. The method comprises detecting the genotype of the SNP1 site in the tested corn genome, and identifying or assisting in identifying corn stalk rot resistance according to the genotype; M3. The method comprises detecting the genotype of the SNP2 site in the corn genome to be tested, and identifying or assisting in identifying corn stalk rot resistance based on the genotype.

2. The method according to claim 1, characterized in that: The chromosome of the corn to be tested contains a DNA fragment, which is a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID No.9, or / and contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID No.

16.

3. A method for corn breeding, characterized in that: The method is any of the following: H1. The method comprises detecting the genotype of corn, selecting corn with a genotype of CCAA as a parent for breeding, wherein the CCAA is a homozygous type in which the SNP1 site in claim 1 is C and the SNP2 site in claim 1 is A; H2. The method comprises detecting the genotype of corn, selecting corn with a genotype of CC as a parent for breeding, wherein CC is a homozygous type in which the SNP1 site in claim 1 is C; H3. The method comprises detecting the genotype of corn and selecting corn with a genotype of AA as a parent for breeding, wherein the AA is a homozygous type of A at the SNP1 site in claim 1.

4. Any of the following applications of a substance for detecting polymorphism or genotype of a SNP site in a corn genome, A1) Identifying or assisting in identifying resistance to corn stalk rot; A2) screening or breeding maize lines, strains or varieties resistant to stalk rot; A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Corn breeding; A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot; A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to stalk rot; A7) preparing a product for screening or breeding corn lines, strains or varieties susceptible to stalk rot; A8) preparing corn breeding products; The SNP site is any of the following: P1, the SNP sites are SNP1 site and SNP2 site, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.9 in the sequence list, which is C or T; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.16 in the sequence list, which is A or G; P2, the SNP site is the SNP1 site; P3. The SNP site is the SNP2 site.

5. Use of the substance described in claim 4 or the method described in 1 or 3 in corn breeding.

6. A product for detecting the polymorphism or genotype of a SNP site in a corn genome, characterized in that: The product is the substance described in claim 1, and the product is any one of: C1) Products for detecting single nucleotide polymorphisms or genotypes associated with corn stalk rot resistance; C2) Products for identifying or assisting in identifying resistance to corn stalk rot; C3) Products used for corn breeding; C4) screening or breeding products of corn lines, strains or varieties resistant to corn stalk rot; C5) A product of screening or breeding corn lines, strains or varieties susceptible to corn stalk rot.

7. The use according to claim 1 or the product according to claim 6, characterized in that: The substance is the following D1), D2) or D3): D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The use or product according to claim 7, characterized in that: The primer combination is F1-1, F1-2, F2-1 and / or F2-2: F1-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.1 in the sequence listing, the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.3 in the sequence listing; F1-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of 176-200th bases of SEQ ID No.7 in the sequence listing and T at the 200th base, a single-stranded DNA having a nucleotide sequence of 178-200th bases of SEQ ID No.7 in the sequence listing and C at the 200th base, and a single-stranded DNA represented by bases 219-244 of SEQ ID No.7 in the sequence listing; F2-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.4 in the sequence listing, the single-stranded DNA shown in SEQ ID No.5 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.6 in the sequence listing; F2-2, a primer set consisting of a single-stranded DNA whose nucleotide sequence is the 181st to 202nd base of SEQ ID No. 8 in the sequence listing with A at the 202nd base, a single-stranded DNA whose nucleotide sequence is the 182nd to 202nd base of SEQ ID No. 8 in the sequence listing with G at the 202nd base, and a single-stranded DNA represented by the 278th to 305th bases of SEQ ID No. 8 in the sequence listing.

9. Use of the product according to claim 6 or 7 in corn breeding.

10. The use of DNA molecules in any of the following: A1) Identify or assist in identifying resistance to corn stalk rot; A2) screening or breeding maize lines, strains or varieties resistant to stalk rot; A3) screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Corn breeding; A5) preparing a product for identifying or assisting in identifying resistance to corn stalk rot; A6) preparing a product for screening or breeding corn lines, strains or varieties resistant to corn stalk rot; A7) preparing a product for screening or breeding corn strains, lines or varieties susceptible to corn stalk rot; A8) preparing corn breeding products; The DNA molecule is any of the following: B1) the nucleotide sequence is SEQ ID No. 7 in the sequence listing or the DNA molecule of positions 176 to 244 of SEQ ID No. 7 or positions 178 to 244 of SEQ ID No. 7; B2) the nucleotide sequence is SEQ ID No. 8 in the sequence listing or the DNA molecule at positions 181 to 305 of SEQ ID No. 8 or the DNA molecule at positions 182 to 305 of SEQ ID No. 8; B3) A combination consisting of B1) and B2).

Images