QTL for regulating and controlling corn stem rot resistance, SNP molecular marker closely linked with QTL and application of QTL

Abstract

The invention relates to the technical field of molecular markers, in particular to a QTL (quantitative trait loci) for regulating corn stem rot resistance, an SNP (single nucleotide polymorphism) molecular marker closely linked with the QTL and application of the QTL. The QTL for regulating and controlling the corn stalk rot resistance can be used for improving the corn stalk rot resistance and breeding corn with the corn stalk rot resistance. The SNP molecular marker closely linked with the corn stem rot resistance QTL can be used for identifying the corn stem rot resistance, has high accuracy, can also be used for corn stem rot resistance assisted breeding and germplasm resource improvement, and has important significance for improving the corn stem rot resistance breeding efficiency and breeding level.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to QTLs for regulating corn stalk rot resistance, tightly linked SNP molecular markers thereof and applications thereof. Background Art

[0002] Corn (Zea mays L.) is a major food and feed crop, as well as an important industrial raw material and energy plant. It plays a pivotal role in the national economy and agricultural production. Corn stalk rot is a global soil-borne disease that seriously harms corn production. It mainly causes premature aging of plants, stalk lodging, and insufficient grain filling, resulting in reduced yields and restricting mechanized corn harvesting. Fusarium graminearum and Pythium inflatum are the main dominant pathogens that cause corn stalk rot.

[0003] Corn resistance to stalk rot is a complex quantitative trait controlled by multiple quantitative trait loci. Since stalk rot is greatly affected by pathogens, environment, and genotype, and it is difficult to find high-resistance and multi-resistance sources, the occurrence of corn stalk rot has become more serious year by year. At present, most of the stalk rot resistance loci that have been located have low effects, and few corn stalk rot resistance genes have been cloned. Therefore, it is still necessary to further explore the maize stalk rot resistance QTL and resistance genes, and develop molecular markers closely linked to QTL, in order to provide strong support for the molecular breeding of stalk rot resistance to aggregate multiple resistance genes and improve maize stalk rot resistance. Summary of the invention

[0004] The invention provides QTL for regulating corn stalk rot resistance, its tightly linked SNP molecular marker and application thereof.

[0005] The present invention uses a corn recombinant inbred line population to identify stalk rot resistance under multiple environments, combines high-density genetic maps and fine positioning, and locates a stable QTL controlling corn stalk rot resistance on corn chromosome 2 bin2.02. Based on this, the present invention provides a corn genome region and its corresponding DNA fragment that can improve corn stalk rot resistance. In addition, the present invention also provides nucleotide sequence polymorphisms and SNP molecular markers that are closely linked to the above-mentioned QTL site. Using the SNP molecular markers provided by the present invention, the stalk rot resistance site can be efficiently and quickly introduced into other susceptible materials to produce corn stalk rot resistance germplasm, and the genotype of the corn material to be tested can also be accurately identified with high throughput to screen stalk rot resistance materials.

[0006] Specifically, the present invention provides the following technical solutions:

[0007] The present invention provides a QTL for regulating corn stalk rot resistance, wherein the QTL is a DNA fragment located on corn chromosome 2, and with reference to the B73 AGP_V3 genome, the DNA fragment comprises a nucleotide sequence at positions 12360575-14116693 of corn chromosome 2.

[0008] In some embodiments of the present invention, the QTL regulating corn stalk rot resistance is located between molecular markers Ks1 and Ks3, with a physical distance of 1.75 Mb; wherein the polymorphic site of molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0009] The present invention provides the use of the QTL for regulating corn stalk rot resistance described above in improving corn stalk rot resistance or in breeding stalk rot-resistant corn.

[0010] In the present invention, the stem rot is preferably Fusarium graminearum stem rot.

[0011] The present invention provides a method for breeding corn resistant to stalk rot, which comprises the step of making the corn chromosome contain the QTL regulating corn stalk rot resistance.

[0012] Preferably, the method comprises the step of crossing corn comprising the QTL with corn not comprising the QTL.

[0013] In some embodiments of the invention, the method comprises the following steps:

[0014] 1) crossing a corn plant containing the QTL with a corn plant not containing the QTL to obtain an F1 population;

[0015] 2) performing one or more rounds of self-pollination on the F1 population, and / or hybridizing plants from the F1 population to obtain a next generation population;

[0016] 3) Selecting maize plants containing the QTL using molecular markers tightly linked to the QTL.

[0017] The present invention provides SNP molecular markers associated with corn stalk rot resistance, wherein the SNP molecular markers include molecular marker Ks1 and / or molecular marker Ks3; with reference to the B73 AGP_V3 genome, the polymorphic site of molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0018] Those skilled in the art will appreciate that, based on the polymorphic sites of the above-mentioned SNP molecular markers and their upstream and downstream genomic sequences, sequence fragments of different lengths can be developed as molecular markers for the amplification and detection of polymorphic sites. Therefore, the present invention has no special restrictions on the length of the sequence fragments of SNP molecular markers, and all SNP molecular markers containing the above-mentioned polymorphic sites and the upstream and / or downstream genomic sequences of the polymorphic sites are within the protection scope of the present invention.

[0019] The present invention provides SNP molecular markers associated with corn stalk rot resistance, wherein the SNP molecular markers include molecular marker Ks1 and / or molecular marker Ks3; wherein the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at the 50th position of the sequence as shown in SEQ ID NO.1, and the molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at the 50th position of the sequence as shown in SEQ ID NO.2.

[0020] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence as shown in SEQ ID NO.13;

[0021] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 60 of the sequence shown in SEQ ID NO.14.

[0022] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence shown in SEQ ID NO.15;

[0023] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 70 of the sequence shown in SEQ ID NO.16.

[0024] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence shown in SEQ ID NO.17;

[0025] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 80 of the sequence as shown in SEQ ID NO.18.

[0026] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence as shown in SEQ ID NO.19;

[0027] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 90 of the sequence shown in SEQ ID NO.20.

[0028] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence shown in SEQ ID NO.21;

[0029] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 100 of the sequence shown in SEQ ID NO.22.

[0030] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence shown in SEQ ID NO.23;

[0031] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 150 of the sequence shown in SEQ ID NO.24.

[0032] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing a polymorphism of A / G at position 200 of the sequence shown in SEQ ID NO.25;

[0033] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 200 of the sequence shown in SEQ ID NO.26.

[0034] The above SNP molecular markers are closely linked to the maize stalk rot resistance QTL locus.

[0035] Specifically, the molecular marker Ks1 is obtained by PCR amplification using a primer set with a sequence as shown in SEQ ID NO.3-5 and corn genomic DNA as a template;

[0036] The molecular marker Ks3 is obtained by PCR amplification using a primer set with sequences as shown in SEQ ID NO.6-8 and corn genomic DNA as a template.

[0037] SEQ ID NO.3: CAGCTTATAGACAGGGGTTTGGG;

[0038] SEQ ID NO.4: CAGCTTATAGACAGGGGTTTGGA;

[0039] SEQ ID NO.5: GGCACCACAACCATTATTTTAGTTTCC;

[0040] SEQ ID NO.6:AGTTGGTCATCAGCTTGTCAAAAA;

[0041] SEQ ID NO.7:AGTTGGTCATCAGCTTGTCAAAAC;

[0042] SEQ ID NO. 8: GGTAAAGACTAGTTTCGCAAGCCG.

[0043] In some embodiments of the present invention, the SNP molecular marker associated with corn stalk rot resistance is Ks1 or Ks3.

[0044] In some embodiments of the present invention, the SNP molecular markers associated with corn stalk rot resistance are a combination of Ks1 and Ks3.

[0045] The present invention has been verified through a large sample size of corn materials and found that the molecular markers Ks1 and Ks3 alone can be used to identify corn stalk rot resistance, and the combined use of molecular markers Ks1 and Ks3 can significantly improve the accuracy of corn stalk rot resistance identification.

[0046] In the molecular marker Ks1 described above, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot;

[0047] In the molecular marker Ks3 described above, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

[0048] The invention provides a primer set for amplifying the SNP molecular marker associated with corn stalk rot resistance.

[0049] According to the genomic location of the polymorphic site of the SNP molecular marker provided above and its upstream and downstream sequences, those skilled in the art can develop various types of primer sets for amplifying the SNP molecular marker.

[0050] The above primer set may include any primers that can be used to detect the genotype of SNP molecular markers.

[0051] Preferably, the primer set includes primers having sequences shown as SEQ ID NOs. 3-5, and / or primers having sequences shown as SEQ ID NOs. 6-8.

[0052] Among them, the primers with sequences shown in SEQ ID NO.3-4 are forward primers, and the primers with sequences shown in SEQ ID NO.5 are reverse universal primers; the primers with sequences shown in SEQ ID NO.6-7 are forward primers, and the primers with sequences shown in SEQ ID NO.8 are reverse universal primers.

[0053] KASP (competitive allele-specific PCR) technology does not require typing according to the size of DNA fragments, and does not rely on traditional gel electrophoresis and other relatively cumbersome, low-throughput, and expensive detection methods, and is more suitable for the high-throughput molecular detection platform that is rapidly developing at this stage. Therefore, the present invention develops a low-cost KASP primer set suitable for high-throughput molecular detection platforms for corn stalk rot resistance detection.

[0054] Among them, the KASP primer set used to amplify the Ks1 includes a first forward primer, a second forward primer and a reverse universal primer, wherein the sequence of the first forward primer is a specific fluorescent label sequence connected in sequence and a sequence shown in SEQ ID NO.3, and the sequence of the second forward primer is a specific fluorescent label sequence connected in sequence and a sequence shown in SEQ ID NO.4; the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO.5.

[0055] Among them, the KASP primer set used to amplify the Ks3 includes a third forward primer, a fourth forward primer and a reverse universal primer, wherein the sequence of the third forward primer is a specific fluorescent label sequence connected in sequence and a sequence shown in SEQ ID NO.6, and the sequence of the fourth forward primer is a specific fluorescent label sequence connected in sequence and a sequence shown in SEQ ID NO.7; the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO.8.

[0056] The fluorescent labels of the first forward primer and the second forward primer described above are different, and the fluorescent labels of the third forward primer and the fourth forward primer are different. There is no special limitation on the fluorescent labels, and commonly used fluorescent labels can be selected.

[0057] In some embodiments of the present invention, the KASP primer set for amplifying the Ks1 includes primers with sequences as shown in SEQ ID NOs. 9-10 and 5, wherein the primers with sequences as shown in SEQ ID NOs. 9-10 are forward primers, and the primer with sequence as shown in SEQ ID NO. 5 is a reverse universal primer;

[0058] In some embodiments of the present invention, the KASP primer set for amplifying the Ks3 includes primers with sequences as shown in SEQ ID NOs.11-12 and 8, wherein the primers with sequences as shown in SEQ ID NOs.11-12 are forward primers, and the primer with sequence as shown in SEQ ID NO.8 is a reverse universal primer.

[0059] The present invention also includes a kit of the above-mentioned primer set.

[0060] To facilitate detection, the kit may also contain other reagents for PCR amplification, including but not limited to DNA polymerase, PCR reaction buffer, probe, dNTP, Mg 2+ , water, etc.

[0061] The above reagents can be packaged separately or provided as a premix after mixing.

[0062] The present invention provides any of the following uses of the QTL regulating corn stalk rot resistance or the SNP molecular marker associated with corn stalk rot resistance or the primer set or the kit:

[0063] (1) Application in identifying or assisting in identifying resistance to corn stalk rot;

[0064] (2) Application in the preparation of products for identifying or assisting in identifying resistance to corn stalk rot;

[0065] (3) Application in early prediction of corn stalk rot resistance;

[0066] (4) Application in screening corn resistant to stalk rot;

[0067] (5) Application of molecular marker-assisted breeding for maize resistance to stalk rot;

[0068] (6) Application in the preparation of products for molecular marker-assisted breeding of corn stalk rot resistance;

[0069] (7) Application in improving maize germplasm resources resistant to stalk rot;

[0070] Among them, the SNP molecular markers related to corn stalk rot resistance include Ks1 and / or Ks3, the polymorphic site of Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0071] In the Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

[0072] In some embodiments of the present invention, the Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 as shown in SEQ ID NO.1, and the Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 as shown in SEQ ID NO.2.

[0073] The present invention provides a method for identifying corn stalk rot resistance, the method comprising:

[0074] Using the genomic DNA of the maize to be identified as a template, PCR amplification of SNP molecular markers associated with maize stalk rot resistance was performed;

[0075] Analyzing the genotype of the SNP molecular marker associated with corn stalk rot resistance in the PCR amplification product, and judging the stalk rot resistance of the corn to be identified according to the genotype;

[0076] Among them, the SNP molecular markers related to corn stalk rot resistance include Ks1 and / or Ks3, the polymorphic site of Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0077] In some embodiments of the present invention, the Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 as shown in SEQ ID NO.1, and the Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 as shown in SEQ ID NO.2.

[0078] Specifically, in the Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

[0079] In some embodiments of the present invention, PCR amplification of SNP molecular markers associated with corn stalk rot resistance is performed using a primer set with sequences such as SEQ ID NOs. 3-5 and / or a primer set with sequences such as SEQ ID NOs. 6-7.

[0080] In some embodiments of the present invention, the SNP molecular markers associated with corn stalk rot resistance are PCR amplified using a primer set with sequences such as SEQ ID NOs. 9-10, 5 and / or a primer set with sequences such as SEQ ID NOs. 11-12, 8.

[0081] The present invention provides a method for obtaining a corn plant having increased resistance to stalk rot, the method comprising the steps of:

[0082] (1) A first corn plant is provided, which comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or

[0083] The present invention comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.2, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.14, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.16, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.18, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.20, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.22, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.24, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.26;

[0084] wherein said first corn plant is resistant to stalk rot;

[0085] (2) hybridizing the first corn plant with the second corn plant to obtain a progeny plant; the second corn plant does not contain or contains the chromosome interval described in step (1);

[0086] (3) Selecting progeny plants containing the chromosome interval of step (1) from the progeny plants by isolating nucleic acid from the progeny plants and detecting it in the nucleic acid, thereby obtaining corn plants with increased resistance to stalk rot.

[0087] The present invention provides a method for producing a corn plant having stalk rot resistance, the method comprising the steps of:

[0088] (1) Isolating nucleic acids from corn plants;

[0089] (2) detecting the SNP molecular marker in the nucleic acid;

[0090] (3) selecting corn plants having stalk rot resistance based on the presence of the SNP molecular marker detected in step (2);

[0091] The selection means selecting the corn plant when the genotype of the site with the polymorphism in the SNP molecular marker Ks1 in the isolated nucleic acid is AA; and / or

[0092] When the genotype of the site where the SNP molecular marker Ks3 in the isolated nucleic acid has the polymorphism is AA, the corn plant is selected.

[0093] The present invention provides a method for conferring corn stalk rot resistance, the method comprising: 1) providing a nucleic acid molecule from a corn chromosome having stalk rot resistance, and 2) inserting the nucleic acid molecule into a chromosome of a recipient corn, thereby producing a corn plant having increased stalk rot resistance compared with the recipient corn; the nucleic acid molecule comprises a nucleotide sequence at positions 12360575-14116693 of corn chromosome 2 or any part thereof, and the nucleic acid molecule is capable of conferring corn stalk rot resistance.

[0094] The present invention provides a corn plant obtained by the above method.

[0095] The present invention provides a corn plant obtained by hybridizing a first corn plant with a second corn plant, wherein the first corn plant comprises any of the following chromosome intervals in its genome:

[0096] A nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or

[0097] The present invention comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.2, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.14, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.16, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.18, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.20, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.22, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.24, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.26;

[0098] The first corn plant is resistant to stalk rot;

[0099] The second corn plant contains none or any of the chromosome intervals described above.

[0100] Preferably, the chromosome region of the above-mentioned corn plant contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.1, and / or contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.2.

[0101] The beneficial effects of the present invention include at least: the LOD value of the QTL for regulating corn stalk rot resistance provided by the present invention is between 3.67-8.79, and the explained phenotypic variation is 5.40%-15.60%, which can be used to improve corn stalk rot resistance and breed stalk rot-resistant corn.

[0102] The SNP molecular markers tightly linked to the maize stalk rot resistance QTL provided by the present invention can be used to identify the stalk rot resistance of maize, with a high accuracy rate, and can also be used for auxiliary breeding and germplasm resource improvement of maize stalk rot resistance. The SNP molecular markers of the present invention can be used to identify and assist in screening maize stalk rot resistance at the seedling stage. In maize breeding, the SNP molecular markers of the present invention can improve the selection efficiency of maize breeding and accelerate the breeding process, which is of great significance for improving the breeding efficiency and breeding level of maize stalk rot resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0104] Figure 1 The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows: The results are as follows:

[0105] Figure 2 This is a frequency distribution diagram of the disease classification of Fusarium graminearum stem rot under the conditions of single environment and multi-environment joint analysis in Example 1 of the present invention.

[0106] Figure 3 This is the QTL location for the disease classification of Fusarium graminearum stem rot under the conditions of single environment and multi-environment joint analysis in Example 1 of the present invention. In the QTL location result diagram, the lines represent the QTL location results of Fusarium graminearum stem rot-related traits on chromosome 2 of maize under different environments; the X-axis represents the genetic map position in cM; and the Y-axis represents the LOD value. In the additive effect analysis of QTL, the lines represent the additive effect values ​​shown by different QTLs; the X-axis represents the genetic map position in cM; the Y-axis represents the additive effect value, and the positive and negative values ​​represent the direction of action.

[0107] Figure 4 The effect verification and fine positioning of the QTL for resistance to Fusarium graminearum stem rot in Example 1 of the present invention; wherein A is the effect verification of the QTL; and B is the fine positioning of the QTL. The QTL effect verification and fine positioning were performed using the recombinant progeny verification method, and the t test was used to analyze whether there was a difference in the DSI between the homozygous progeny of the disease-resistant allele and the homozygous progeny of the disease-susceptible allele of each recombinant plant. If there is a significant difference in DSI between the two groups of genotypes (P<0.05), it is inferred that the parental recombinant individual carries the disease-resistant gene, which is represented by R; on the contrary, if there is no significant difference between the two groups of genotypes (P>0.05), it is inferred that the parental recombinant individual does not carry the disease-resistant gene, which is represented by S. The black rectangle represents the homozygous disease-resistant allele segment; the gray rectangle represents the heterozygous allele segment. The molecular marker is the marker used when analyzing the results. The bar graph represents the DSI distribution of plants with different genotypes. * indicates P<0.05, ** indicates P<0.01, and *** indicates P<0.001. DETAILED DESCRIPTION

[0108] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0109] Example 1 Location of maize stalk rot resistance QTL and development of its tightly linked molecular markers

[0110] 1. Materials and methods

[0111] 1.1 Test materials

[0112] Test corn materials:

[0113] 215 F clones from the disease-resistant inbred line KA105 and the disease-susceptible inbred line HZ4 and their combinations 7:8 Recombinant Inbred Line (RIL) population.

[0114] The detailed information of the RIL families is shown in Table 1 .

[0115] Table 1 RIL pedigrees (215 copies)

[0116]

[0117]

[0118]

[0119] KA105 is an inbred line independently bred by the maize genetics and breeding team of Northwest A&F University (Wang Boxin, Wang Yahui, Chen Pengfei, et al. Analysis of combining ability of maize inbred lines derived from Shaanxi A group and Shaanxi B group under different density conditions [J]. Acta Agronomica Sinica, 2017, 43(9): 1328-1336.). HZ4 is a backbone maize inbred line in China, jointly bred by Beijing Academy of Agricultural and Forestry Sciences and Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (Zhao Jiuran, Li Chunhui, Zhang Ruyang, et al. Exploration of the origin of the backbone maize inbred line Huang Zao Si [J]. Journal of Plant Genetic Resources, 2021, 22(1): 6.). The seeds of the parental inbred lines of the test materials were provided by the maize breeding team of the College of Agriculture, Northwest A&F University.

[0120] Pathogen: The Fusarium graminearum strain was provided by Associate Researcher Long Shusheng from the College of Plant Protection, Northwest Agriculture and Forestry University. This pathogen is the dominant pathogen of stem rot in northern China (Wang Xiaoming, Jin Qiming, Li Xiao, et al. Field Manual of Corn Pests and Diseases [M]. China Agricultural Science and Technology Press, 2010.).

[0121] 1.2 Test methods

[0122] 1.2.1 Field design

[0123] The 215 RIL populations of the parents KA105 and HZ4 and their combinations were inoculated and identified in Yangling and Sanyuan in 2020-2021. The location and year were uniformly defined as the environment, abbreviated as "year + location initials", such as 2020YL. The field experiment adopted an incomplete randomized block design, with 2 replications set for each environment, single-row planting, 4m row length, 0.6m row spacing, and a density of 5500 plants / mu. The field management measures were the same as the local field corn production management.

[0124] 1.2.2 Pathogen culture

[0125] Propagation of Fusarium graminearum: Inoculate the pathogenic bacteria strain isolated from a single spore onto PDA (Potato Dextrose Agar) medium and culture it in a constant temperature incubator at 25°C for 5-7 days in the dark. When the mycelium covers the surface of the medium, cut it into equal parts together with the medium and inoculate it onto sterilized corn kernel medium to propagate the Fusarium graminearum inoculum.

[0126] Preparation of PDA solid culture medium: Select fresh potatoes, wash and peel them, cut them into small pieces of about 1cm×1cm, weigh 200g, put them into a pot, add appropriate amount of pure water and boil for 30min, filter with 8 layers of gauze, collect the filtrate into a 1L beaker; add 20g glucose and stir to dissolve, weigh 15g agar powder, heat and dissolve, pour into the filtrate, stir evenly and make up the volume to 1L, sterilize at 121℃ and high temperature and high pressure for 20min, divide into culture dishes on the clean bench, cool and solidify for use, or store in a 4℃ refrigerator for later use.

[0127] Propagation of Fusarium graminearum inoculated materials: Select healthy and plump corn kernels and soak them in water for 20h-22h, boil them in boiling water for 100min, lay the cooked corn kernels flat and dry them; pack them into high temperature resistant inoculation bags of 500g each, sterilize them at 121℃ and autoclave for 50min; after cooling, inoculate the Fusarium graminearum grown on PDA culture medium and seal them with breathable sealing film; culture them in the dark at 25℃ for 15-20 days until the mycelium covers the surface of the corn kernels. During this period, rub the bag every two days to make the corn kernels and the fungus blocks fully contact. Dry the grown inoculated materials in the shade for 3-4 days, put them into sacks and put them in the cold storage for use.

[0128] 1.2.3 Intra-field bacteria

[0129] During the tasseling period of corn, the field inoculation method of burying the roots is used. Before inoculation, the cultivated seed inoculation material is stirred and mixed. During inoculation, a pit is dug 5-10 cm near the root of the plant, some fibrous roots are cut off to create wounds, 75-85 corn kernels with bacteria are placed in the pit, and the soil is covered and compacted. After the inoculation is completed, the field is irrigated to keep the soil moist to promote the reproduction and infection of pathogens.

[0130] 1.2.4 Characteristic Investigation

[0131] 50-55 days after inoculation, the occurrence of corn stalk rot in the field was identified by the stem splitting method. The plants were cut at the cob attachment point and split longitudinally along the stem to observe the pathogen infection at the root and stem base and the degree of pith tissue necrosis. The disease rating scale (DRS) was used to identify the phenotype of stalk rot, which was divided into 5 levels:

[0132] Level 1: Highly resistant, normal plants, no obvious symptoms;

[0133] Level 3: disease-resistant, the plant stem surface is normal, and brown lesions appear at the stem tip;

[0134] Level 5: Moderate resistance, the base of the plant stem becomes soft and faded, with obvious water stains; the medullary tissue between the first and second internodes at the base of the stem shrinks and decomposes, and browning symptoms appear;

[0135] Level 7: Infected, the lower stem nodes of the plant gradually turn from green to brown, the stem becomes soft and severely dehydrated, the internal stem pith tissue decomposes into filaments and shrinks severely, and white or rose-red hyphae appear on the stem nodes; the root system becomes soft, dry, and sparse but does not fall over; the fruit clusters begin to droop;

[0136] Level 9: Highly susceptible, the stem of the plant is hollow and constricted, with only necrotic vascular tissue remaining inside the stem, the nodes and internodes turn black and have rose-red marks; the root system is sparse, rotten and hollow, the plant is bent or lodged; the bracts of the female ear are dry and loose, and the female ear droops.

[0137] Select 10 plants with the same growth in each family, observe and record the disease grade of stem rot one by one, and use the average value as the phenotypic value of each family. Investigate and record the number of days from sowing to 50% of the plants shedding pollen in each family.

[0138] 1.2.5 Phenotypic data analysis

[0139] In order to evaluate the significance of genotype and environment variance and the interaction between the two, the variance components were calculated using the "PROC MIXED" program in SAS (V9.2) software. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype was used as a fixed effect, flowering date as a covariate, and environment, replication within environment, and interaction between genotype and environment as random effects. The results of variance analysis were used to calculate the broad-sense heritability (H) of stem rot resistance. 2 ): in, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effect of environmental variation on phenotypes, the best linear unbiased prediction (BLUP) of each family (all families included in the mapping population) was estimated using the SAS (V9.2) mixed linear model, and the BLUP value was used as the data for multi-environment joint analysis to draw the phenotypic distribution histogram and multi-environment joint QTL positioning.

[0140] 1.2.6 Linkage map construction

[0141] At the 5-6 leaf stage of maize, 5 young leaves of each family (all families included in the mapping group) with consistent growth were selected and mixed, and genomic DNA was extracted using the conventional CTAB method. Genotype data were generated by Liaoning East Asia Crop Seed Quality Inspection and Testing Co., Ltd., and genotyping analysis was performed using the Maize6H-60K chip independently developed by the Maize Research Center of Beijing Academy of Agricultural and Forestry Sciences. The linkage map was constructed using QTL ICImapping 4.2 software. The "*.snp" function was used to filter and screen markers, and markers with the same parents (P1=P2), missing or heterozygous parents, and no polymorphism in the offspring were deleted. The "*.bin" function (the threshold was set to a missing rate greater than 15% and a partial separation P value less than 0.001) was used to delete redundant markers to obtain Bin markers; the ".map" function was used to construct a linkage map, and the Kosambi function was selected to estimate the genetic distance. Finally, a total of 40,812 polymorphic SNP markers were screened, and redundant markers were removed and merged into 8,257 bin markers.

[0142] 1.2.7 QTL positioning

[0143] Based on the constructed high-density linkage map, combined with the disease grading phenotypic values ​​of the recombinant inbred line population in single environment and multiple environments, QTL detection for Fusarium graminearum stem rot resistance was performed. The composite interval mapping method (CIM) of Windows QTL Cartographer V2.5 software was used for preliminary positioning and genetic effect analysis. The LOD threshold was set to 1000 simulation operations (Permutation), and the significant level P value was less than 0.05. Finally, LOD=3 was used as the threshold line, and the confidence interval of the target QTL was determined by decreasing 2 LOD values ​​on both sides of the LOD value peak. QTLs identified simultaneously in multiple environments or QTLs with an explanation rate of phenotypic variation greater than 10% in a single environment were selected for effect verification and fine positioning.

[0144] In the QTL mapping of maize stalk rot resistance, the phenotypic identification of the RIL families in the mapping population was based on the following: 10 plants with consistent growth in each family were selected under a single environment, the incidence of stalk rot was observed and recorded one by one, and finally the average value of the 10 materials was used as the family phenotypic value; the phenotypic means of each family in a single environment were used to calculate the best linear unbiased prediction (BLUP) of the phenotypic values ​​of the RIL population under multiple environments.

[0145] 1.2.8 Molecular marker development and QTL effect verification

[0146] The polymorphic SNP located in the target QTL segment was selected to develop KASP markers for effect verification. The design parameters of KASP marker primers are as follows: primer length is 20-27bp, GC content is between 40%-60%, and annealing temperature is between 59℃-65℃ (optimum temperature is 63℃). A fluorescent linker sequence is added to the 5' end of the designed forward primer. The FAM linker sequence is 5'-gaaggtgaccaagttcatgct-3', and the HEX linker sequence is 5'-gaaggtcggagtcaacggatt-3'. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0147] The PCR reaction system is as follows: the total system is 4 μL, including 2 μL HiGeno 2×Probe Mix, 1 μL DNA template (20–50 ng / μL), 0.944 μL ddH2O and 0.056 μL primer mixture (preferred primer mixture ratio: 12 μL each (100 μM) of forward primer PrimerX and Primer Y, 30 μL reverse primer Primer R (100 μM), 46 μL ddH2O).

[0148] The PCR reaction program was as follows: pre-denaturation at 94°C for 15 min, first step amplification reaction, denaturation at 94°C for 20 s, annealing at 61°C for 60 s, set for 10 cycles, second step amplification reaction, denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, set for 38 cycles.

[0149] The PCR reaction products were scanned and the fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). The SNP typing software KclusterCaller (V 3.4.1.36; LGC Hoddesdon, UK) was used to read the genotype data and perform cluster analysis. The genotype of the FAM allele was X:X, the genotype of the HEX allele was Y:Y, and the heterozygous genotype was X:Y.

[0150] 1.2.9 QTL effect verification and fine positioning

[0151] The QTL effect verification and fine positioning were carried out by the recombinant progeny verification method. According to the initial QTL positioning results, the target segment was heterozygous in the RIL population, and the remaining heterozygous lines with fixed background genotypes were screened. The KASP marker was developed to screen the individuals that exchanged in the target segment. The key recombinant individuals were verified by the genotype and stem rot phenotype of the offspring for effect verification and fine positioning. 60-180 plants of each recombinant individual were planted for genotype and stem rot disease classification, and the disease severity index (DSI) of each genotype was calculated. The difference in resistance to Fusarium graminearum stem rot of corn between different genotypes was analyzed by a one-tailed t test. If the difference between different genotypes was significant (P < 0.05), it means that the major effect QTL is located in the heterozygous region, and vice versa.

[0152] The calculation formula of DSI is as follows: DSI (%) = Σ (disease grade × number of plants with corresponding grade) × 100 / (maximum disease grade × total number of plants with identified stem rot phenotype).

[0153] 2. Results and Analysis

[0154] 2.1 Phenotypic variation of resistance to Fusarium graminearum stem rot in maize

[0155] Identification of resistance to Fusarium graminearum stem rot in RIL populations and parental materials under different environments ( Figure 1), the results of statistical analysis showed that there were extremely significant differences in disease grading between parental materials in different populations (Table 2). In the RIL population, the disease grading showed a wide range of continuous variation between different environments, indicating that stem rot resistance is a quantitative trait controlled by multiple genes. The variation range of disease grading was 1.00-9.00, the mean was between 4.21-4.50, and the coefficient of variation was 40.92%-51.49%. After calculating the BLUP value to eliminate the environmental influence, the coefficient of variation of the disease grading of the RIL population was reduced to 33.52%, and the disease grading in a single environment showed a skewed normal distribution ( Figure 2 ), the BLUP values ​​of joint analysis of multiple environments were normally distributed.

[0156] The results of the joint variance analysis showed (Table 3) that the differences between genotypes in the RIL population were extremely significant, and the differences between environments and the interactions between genotypes and environments were extremely significant. The estimated genetic variance was greater than the estimated variance of the environments and the interactions between genotypes and environments, indicating that genetic factors were the main source of variation and were greatly affected by the environment. The heritability of stem rot resistance was 81.01%.

[0157] Table 2

[0158]

[0159] Table 3 Variance and heritability analysis of stem rot phenotypic indicators in multiple environments

[0160]

[0161] 2.2 Linkage map construction

[0162] A linkage map was constructed using 215 RIL families combined with 8,257 bin markers. The total length of the map was 6,541 cM, and the average genetic distance between adjacent markers was 0.79 cM. Chromosome 1 was the longest at 926.78 cM, with the largest number of markers distributed at 1,191; chromosome 10 was the shortest at 385.39 cM, with the smallest number of markers distributed at 393.

[0163] 2.3 QTL mapping for resistance to Fusarium graminearum stem rot in maize

[0164] Using the phenotypic data of disease classification in single environment and multi-environment joint analysis, WinQTLCart V 2.5 The composite interval mapping method was used to locate the QTL for resistance to Fusarium graminearum stalk rot in maize. A QTL ( Figure 3), with a physical position between 10,606,703bp-14,892,011bp and a confidence interval of approximately 4.29Mb (referenced to the B73AGP_V3 genome). This QTL was co-located in 2020YL and 2021YL, explaining 5.40%-15.60% of the phenotypic variation. The disease resistance allele originated from KA105, and the site was environmentally specific (Table 4).

[0165] Table 4 QTL analysis of disease classification of Fusarium graminearum stem rot under single and multiple environmental conditions

[0166]

[0167]

[0168] 2.4 Verification and fine mapping of QTL effects for resistance to Fusarium graminearum stem rot

[0169] Among 215 F7 RIL families, one heterozygous genotype in the target QTL candidate interval and a relatively fixed background genotype was screened, and the remaining heterozygous line material KHRIL-187 was self-pollinated to obtain seeds of the segregating population progeny. The developed molecular markers (Table 5) were used to screen individuals that exchanged in the target segment. The key recombinant individuals were finely positioned by progeny testing. For each recombinant individual, 100-200 plants were planted to identify the genotype and stem rot resistance phenotype. The effect verification of the target QTL showed that the homozygous allele from the disease-resistant parent can significantly improve the field resistance to stem rot (P<0.001)( Figure 4 A). Among them, the average DSI of the homozygous disease-resistant KA105 / KA105 genotype plants was 31.48%, and the average DSI of the homozygous disease-susceptible HZ4 / HZ4 genotype plants was 55.42%. The t test results in the population showed that there was a very significant difference in DSI between the homozygous disease-resistant and disease-susceptible genotypes (P<0.001). In summary, the remaining heterozygous line material KHRIL-187 was used to detect the resistance QTL effect, and the test results reached a significant difference, indicating that the genetic effect of the site on the resistance to Fusarium graminearum stem rot is real. The QTL site with homozygous disease-resistant alleles can reduce the DSI by about 23.94%, significantly improving the field resistance of plants to Fusarium graminearum stem rot.

[0170] Three molecular markers were encrypted in the candidate interval of the target QTL, and the molecular marker primers were designed with reference to the V3 version sequence of the maize B73 reference genome. The molecular markers Ks1 and Ks3 at both ends of the candidate interval, Ks1 is located at position 12360575 of maize chromosome 2, and the mutant base is A or G; Ks3 is located at position 14116693 of maize chromosome 2, and the mutant base is A or C. The newly developed markers were used to divide the offspring of the segregating population into two recombinant types, and the target QTL was finely located by the progeny test method. The results showed that the DSI of plants carrying the homozygous KA105 genotype and the homozygous HZ4 genotype in type I and II reached extremely significant differences (P<0.001)( Figure 4 B), indicating that the target QTL is carried in the heterozygous segments of the two types of recombination. Among them, in type II, the molecular marker Ks2 is a heterozygous genotype, and the molecular markers Ks1 and Ks3 are homozygous susceptible genotypes. It is speculated that the QTL candidate interval is located between the molecular markers Ks1 and Ks3, with a physical distance of about 1.75Mb (B73 AGP_V3).

[0171] The specific information of the molecular markers closely linked to the maize stalk rot resistance QTL developed above is as follows (the positions of the molecular markers are all referenced to the B73 AGP_V3 genome):

[0172] (1) Molecular marker Ks1: The polymorphic site is located at nucleotide 12360575 of maize chromosome 2, and the polymorphism is A / G;

[0173] (2) Molecular marker Ks3: The polymorphic site is located at nucleotide 14116693 of maize chromosome 2, and the polymorphism is A / C.

[0174] Among them, the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at the 200th position of the sequence as shown in SEQ ID NO.1, and the molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at the 200th position of the sequence as shown in SEQ ID NO.2.

[0175] Optionally, the nucleotide sequence of molecular marker Ks1 is as shown in SEQ ID NO.1, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.1, and the polymorphism is A / G; the nucleotide sequence of molecular marker Ks3 is as shown in SEQ ID NO.2, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.2, and the polymorphism is A / C.

[0176] SEQ ID NO.1:

[0177] GAAATTTACTGGTTAGCGCCAGACATGCAGCTTATAGACAGGGGTTTTGGRCACCATGTTTATTTTTTTACTATAAATACACAGTGGGAAACTAAAATAAT, where R stands for A / G.

[0178] SEQ ID NO.2:

[0179] AAGTATGTGATAAGAGCTGCGGCAGGAGTTGGTCATCAGCTTGTCAAAAMCCCTCTTTCCAATTGATTGACAGTGCCACCAGGACGGCTTGCGAAACTA, where M represents A / C.

[0180] The information of the KASP primer set developed based on the above SNP molecular markers is shown in Table 5.

[0181] Table 5 Primers of KASP markers for QTL effect verification

[0182]

[0183]

[0184] Note: Lowercase letters gaaggtgaccaagttcatgct are the specific fluorescent tag sequence FAM; lowercase letters gaaggtcggagtcaacggatt are the specific fluorescent tag sequence HEX.

[0185] Example 2 Application of Maize Fusarium graminearum Stem Rot Resistance QTL and Its Tightly Linked Molecular Markers

[0186] The material used for detecting the polymorphism or genotype of the SNP molecular marker locus closely linked to the QTL of resistance to Fusarium graminearum stalk rot of corn has at least the following applications:

[0187] (1) Identify or assist in identifying corn resistant to stalk rot;

[0188] (2) preparing related products for identifying or assisting in identifying corn resistant to stalk rot;

[0189] (3) Maize assisted breeding or preparation of products for maize assisted breeding.

[0190] The method for identifying or assisting in identifying maize stalk rot resistance using molecular markers closely linked to maize stalk rot resistance QTLs is as follows:

[0191] If the genotype of the molecular marker Ks1 in the tested corn is AA, the genotype of the target QTL locus is a disease-resistant gene; if the genotype of the molecular marker Ks1 in the tested corn is GG, the genotype of the target QTL locus is a disease-susceptible gene;

[0192] If the genotype of the molecular marker Ks3 in the tested corn is AA, the genotype of the target QTL locus is a disease-resistant gene; if the genotype of the molecular marker Ks3 in the tested corn is CC, the genotype of the target QTL locus is a disease-susceptible gene;

[0193] In summary, corn with the genotype of molecular marker Ks1 being AA and the genotype of molecular marker Ks3 being AA was selected as stalk rot-resistant parents for breeding.

[0194] The SNP molecular marker developed in Example 1 was used to screen corn stalk rot resistant materials. The test materials were 214 recombinant inbred families in the RIL population except the target QTL fine positioning family KHRIL-187. 55 recombinant inbred lines were screened out with homozygous genotypes at the Ks1 and Ks3 molecular markers. The phenotypic identification of stalk rot was carried out and it was found that when the genotypes of the molecular markers Ks1 and Ks3 were both homozygous disease-resistant alleles AA, 16 of the 20 recombinant inbred lines showed high resistance to stalk rot, with the disease grade between 1.81 and 2.81, and the accuracy rate of stalk rot resistance identification was 80%; when only the molecular marker Ks1 was homozygous disease-resistant When the allele type was AA, 12 out of 24 recombinant inbred lines showed resistance to stem rot, including 9 families with high resistance to stem rot, with disease grades between 1-3, and the accuracy rate of stem rot resistance identification was 50%; when only the molecular marker Ks3 was the homozygous disease-resistant allele type AA, 5 out of 20 recombinant inbred lines showed high resistance to stem rot, with disease grade 1, and the accuracy rate of stem rot resistance identification was 25%; when the genotypes of the molecular markers Ks1 and Ks3 were both homozygous susceptible allele types GG and CC, 18 out of 23 recombinant inbred lines showed high susceptibility to stem rot, with disease grades of 6.83-8.51, and the accuracy rate of stem rot susceptibility identification was 78%. In order to expand the sample size, the phenotypic values ​​of individual plant identification of 12 families were selected for screening of maize stalk rot resistance materials, namely KHRIL-102, KHRIL-149, KHRIL-154, KHRIL-199, KHRIL-168, KHRIL-148, KHRIL-68, KHRIL-205, KHRIL-204, KHRIL-176, KHRIL-099, and KHRIL-123. The identification results are shown in Table 6, where the disease grading of a single family is represented by the BLUP value of multi-environment joint analysis, and the disease grading of a single plant of a family is represented by the phenotypic value of a single plant under the 2021SY environment. The statistical results of the phenotypic identification accuracy are shown in Table 7.

[0195] Table 6 Alleles and phenotypes of molecular markers Ks1 and Ks3

[0196]

[0197]

[0198]

[0199]

[0200] Note: Ks1: AA (disease resistance allele), GG (disease susceptible allele); Ks3: AA (disease resistance allele), CC (disease susceptible allele).

[0201] Table 7 Identification accuracy of molecular markers Ks1 and Ks3 for stem rot resistance

[0202]

[0203] Note: In the estimation of the accuracy of stem rot resistance identification, the families with high resistance and resistance to recombinant inbred lines are considered to be resistant materials. Ks1: AA (disease resistance allele), GG (disease susceptible allele); Ks3: AA (disease resistance allele), CC (disease susceptible allele).

[0204] The above results show that the SNP molecular markers Ks1 and Ks3, which are closely linked to the QTL, can be used for identification of corn stalk rot resistance. When Ks1 is used alone, the accuracy of identification of stalk rot resistance is about 50%; when Ks3 is used alone, the accuracy of identification of stalk rot resistance is about 25%; when both are used for detection, the accuracy of identification of stalk rot resistance is 80%. It can be seen that SNP molecular markers Ks1 and Ks3 have a high accuracy rate for identification of corn stalk rot resistance, and are effective in auxiliary selection of corn stalk rot resistance phenotypes.

[0205] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A QTL regulating corn stalk rot resistance, characterized in that: The QTL is a DNA fragment located on chromosome 2 of maize. Referring to the B73 AGP_V3 genome, the DNA fragment contains the nucleotide sequence at positions 12360575-14116693 of chromosome 2 of maize.

2. Use of the QTL for regulating corn stalk rot resistance according to claim 1 in improving corn stalk rot resistance or in breeding stalk rot-resistant corn.

3. A method for breeding corn resistant to stalk rot, characterized in that: The method comprises the steps of making the maize chromosome contain the QTL regulating maize stalk rot resistance according to claim 1; Preferably, the method comprises the step of crossing corn comprising the QTL with corn not comprising the QTL.

4. A SNP molecular marker associated with corn stalk rot resistance, characterized in that: The SNP molecular markers include molecular marker Ks1 and / or molecular marker Ks3; Wherein, the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 as shown in SEQ ID NO.1; The molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 as shown in SEQ ID NO.

2.

5. The SNP molecular marker associated with corn stalk rot resistance according to claim 4, characterized in that: The molecular marker Ks1 is obtained by PCR amplification using a primer set as shown in SEQ ID NO.3-5 and corn genomic DNA as a template; The molecular marker Ks3 is obtained by PCR amplification using a primer set with sequences as shown in SEQ ID NO.6-8 and corn genomic DNA as a template.

6. The SNP molecular marker associated with corn stalk rot resistance according to claim 4 or 5, characterized in that: In the molecular marker Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; In the molecular marker Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

7. A primer set, characterized in that: The primer set is used to amplify the SNP molecular marker associated with corn stalk rot resistance according to any one of claims 4 to 6; Preferably, the primer set includes primers having sequences shown as SEQ ID NOs. 3-5, and / or primers having sequences shown as SEQ ID NOs. 6-8.

8. A kit, characterized in that The kit comprises the primer set according to claim 7.

9. Any one of the following uses of the QTL regulating corn stalk rot resistance or the SNP molecular marker associated with corn stalk rot resistance according to claim 1, the primer set according to claim 7, or the kit according to claim 8: (1) Application in identifying or assisting in identifying resistance to corn stalk rot; (2) Application in the preparation of products for identifying or assisting in identifying resistance to corn stalk rot; (3) Application in early prediction of corn stalk rot resistance; (4) Application in screening corn resistant to stalk rot; (5) Application of molecular marker-assisted breeding for maize resistance to stalk rot; (6) Application in the preparation of products for molecular marker-assisted breeding of corn stalk rot resistance; (7) Application in improving maize germplasm resources resistant to stalk rot; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and / or molecular marker Ks3. The polymorphic site of the molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

10. A method for identifying corn stalk rot resistance, characterized in that: The method comprises: Using the genomic DNA of the maize to be identified as a template, PCR amplification of SNP molecular markers associated with maize stalk rot resistance was performed; Analyzing the genotype of the SNP molecular marker associated with corn stalk rot resistance in the PCR amplification product, and judging the stalk rot resistance of the corn to be identified according to the genotype; The SNP molecular marker associated with corn stalk rot resistance includes molecular marker Ks1 and / or molecular marker Ks3, the polymorphic site of the molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C; Preferably, in the molecular marker Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the molecular marker Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

11. A method for obtaining a corn plant having increased resistance to stalk rot, characterized in that The method comprises the following steps: (1) A first corn plant is provided, which comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or The present invention comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.2, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.14, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.16, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.18, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.20, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.22, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.24, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.26; wherein said first corn plant is resistant to stalk rot; (2) hybridizing the first corn plant with the second corn plant to obtain a progeny plant; the second corn plant does not contain or contains the chromosome interval described in step (1); (3) Selecting progeny plants containing the chromosome interval of step (1) from the progeny plants by isolating nucleic acid from the progeny plants and detecting it in the nucleic acid, thereby obtaining corn plants with increased resistance to stalk rot.

12. A method for producing corn plants resistant to stalk rot, characterized in that The method comprises the following steps: (1) Isolating nucleic acids from corn plants; (2) detecting the SNP molecular marker according to any one of claims 4 to 6 in the nucleic acid; (3) selecting corn plants having stalk rot resistance based on the presence of the SNP molecular marker detected in step (2); The selection means selecting the corn plant when the genotype of the site with the polymorphism in the SNP molecular marker Ks1 in the isolated nucleic acid is AA; and / or, When the genotype of the site where the SNP molecular marker Ks3 in the isolated nucleic acid has the polymorphism is AA, the corn plant is selected.

13. A method for imparting resistance to corn stalk rot, characterized in that: The method comprises: 1) providing a nucleic acid molecule from a chromosome of corn having stalk rot resistance, and 2) inserting the nucleic acid molecule into a chromosome of a recipient corn, thereby producing a corn plant having increased stalk rot resistance compared to the recipient corn; The nucleic acid molecule comprises the nucleotide sequence at positions 12360575-14116693 of corn chromosome 2 or any part thereof, and the nucleic acid molecule can confer resistance to corn stalk rot.

14. A corn plant obtained by the method of any one of claims 3, 11, 12, and 13.

15. A corn plant, characterized in that The plant is obtained by hybridizing a first corn plant and a second corn plant, wherein the first corn plant comprises any of the following chromosome intervals in its genome: A nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or The present invention comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.2, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.14, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.16, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.18, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.20, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.22, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.24, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.26; The first corn plant is resistant to stalk rot; The second corn plant contains none or any of the chromosome intervals described above.

16. The corn plant of claim 15, wherein: The chromosome interval contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.1, and / or contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.2.

Images