SNP (Single Nucleotide Polymorphism) molecular marker for identifying yellow pulp character of cucumber and application thereof

Abstract

The invention discloses an SNP molecular marker linked with a yf gene and used for identifying the yellow pulp character of cucumber and application of the SNP molecular marker, the sites of the SNP molecular marker are 16th, 433rd and 384bp of the physical position on No.7 chromosome of '9930' cucumber reference genome V2 version, the basic group of the sites is A or G, the cucumber material with the basic group of the sites is yellow pulp cucumber, and the cucumber material with the basic group of the sites is yellow pulp cucumber. The cucumber material with the basic group of G at the site is white pulp cucumber. By adopting the SNP marker obtained by the invention, whether the cucumber candidate material has the yellow pulp characteristic or not can be judged through molecular identification at any stage of the cucumber candidate material, the detection of the marker has the advantages of high efficiency and less limitation, the breeding efficiency of the cucumber material with yellow pulp is improved, and the breeding period can be greatly shortened. The SNP marker provided by the invention is combined with the reported molecular marker for identifying the yellow cucumber pulp, so that the identification accuracy can be improved, and the breeding process can be accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of biotechnology-assisted breeding, in particular to a SNP molecular marker for identifying yellow flesh traits of cucumber and an application thereof. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop in the world, widely used in fresh food, food processing and cooking. With the improvement of people's living standards, people have higher requirements for food quality, especially functional foods are more favored by consumers. Therefore, quality breeding has become one of the important purposes of cucumber breeding. The endocarp and mesocarp of most cucumbers are white (Che and Zhang, 2019), but the content of carotene in the white flesh is often negligible. Studies have shown that the accumulation of carotene (Bo et al, 2012) can cause the cucumber flesh to appear yellow (Kooistra, 1971; Lu et al, 2015) or orange (Simon and Navazio, 1997). Carotene has important nutritional value for the human body. The human body cannot synthesize it by itself and can only be ingested through diet. Among them, β-carotene is an important precursor of vitamin A (Nisar et al, 2015). Vitamin A deficiency can cause dry eyes, increase infant morbidity and mortality, and reduce immune response (Underwood, 2004). Therefore, it is of great significance to study the genetic laws and molecular markers of yellow cucumber flesh and increase the carotene content in cucumber flesh through breeding.

[0003] Regarding the genetic law of yellow flesh of cucumber, Kooistra et al. (1971) conducted the first genetic analysis of cucumber flesh color (orange, yellow, grayish white, bright white) genes and believed that flesh color is controlled by two pairs of genes. Qi et al. (1983) first described Xishuangbanna cucumber (Cucumis sativus L. var. xishuangbannanesis Qi et Yuan), whose ripe fruit flesh color is orange. It conforms to the genetic law of quantitative traits with major effect genes, and light color is dominant compared to dark color (Shen Di, 2009). Cuevas et al. (2010) conducted a genetic analysis of Xishuangbanna cucumber and believed that the orange mesocarp is controlled by two recessive genes and the orange endocarp is controlled by one recessive gene. In addition, PI200815 is described as yellow flesh (Kooistra, 1971). Lu et al. (2015) found that yellow flesh is controlled by a recessive gene (yf) and located it on chromosome 7 (Lu HW, Miao H, Tian GL, Wehner TC, Gu XF, Zhang SP (2015) Molecular mapping and candidate gene analysis for yellow fruit flesh in cucumber. Molecular Breeding 35(2): 64. doi: 10.1007 / s11032-015-0263-z).

[0004] At present, there have been some reports on the molecular level of research on yellow cucumber flesh. Song Hui et al. (2009) conducted QTL positioning for population flesh color, main carotenoid content in flesh, and lutein traits, and detected a total of 3 QTLs controlling the β-carotene content in the endocarp and mesocarp. In the same year, Shen Di also used the β-carotene content in Xishuangbanna cucumber as a morphological indicator for QTL positioning, and detected a total of 8 QTLs. Bo et al. (2012) found that the orange color of Xishuangbanna cucumber flesh was due to high levels of β-carotene accumulation, and located the orange gene on chromosome 3, named ore. Qi et al. (2013) found through GWAS analysis that in Xishuangbanna cucumber, CsaBCH1 can control the accumulation of β-carotene in mature fruits, resulting in orange flesh. Kishor et al. (2021) found through genetic positioning and whole genome sequencing that CsOr can also lead to an increase in the content of β-carotene in orange flesh. Wang et al. (2023) discovered yellow flesh mutants in European greenhouse cucumbers and found that abscisic acid 8'-hydroxylase Csyf2 regulates yellow flesh by regulating carotene synthesis. Summary of the invention

[0005] The purpose of the present invention is to solve the above problems and provide a SNP molecular marker for detecting the yellow flesh trait of cucumber and its application.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a SNP molecular marker linked to the yf gene for identifying the yellow flesh trait of cucumber, the site of the SNP molecular marker is at the physical position 16,433,384bp on chromosome 7 of the '9930' cucumber reference genome V2 version, the base of the site is A or G, the cucumber material with the base A at the site is a yellow flesh cucumber, and the cucumber material with the base G at the site is a white flesh cucumber.

[0008] The second aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular marker, comprising a specific primer pair, wherein the specific primer pair comprises primers SNP-yf-F and SNP-yf-R, and the nucleic acid sequences of the primers are as follows:

[0009] SNP-yf-F: 5'-TGACGCTTGCTTAATGAGAT-3',

[0010] SNP-yf-R: 5'-TATCAAAGTTGGGAATGTCG-3'.

[0011] Preferably, the kit further comprises a cucumber genomic DNA extraction reagent, a PCR amplification reaction reagent, and a PCR amplification product sequencing reagent.

[0012] The third aspect of the present invention provides the use of the SNP molecular marker linked to the yf gene for identifying the yellow flesh trait of cucumber in any of the following (1)-(4):

[0013] (1) Identify or assist in identifying yellow-fleshed cucumber materials;

[0014] (2) Identify or assist in identifying the yellow flesh gene yf in cucumber;

[0015] (3) Screening or assisting in the screening of yellow-fleshed cucumber varieties;

[0016] (4) Cultivate or assist in the cultivation of yellow-fleshed cucumber varieties.

[0017] In the above application, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the base at position 305 is A or G, the cucumber material with the base A at this position is a yellow-fleshed cucumber, and the cucumber material with the base G at this position is a white-fleshed cucumber.

[0018] The application comprises the following steps: extracting genomic DNA of the sample to be tested as a template, using the amplification primers of the SNP molecular marker to perform PCR amplification, sequencing the PCR amplification products, and judging whether the sample to be tested is yellow flesh according to the sequencing results.

[0019] In the above application, the amplification primers of the SNP molecular marker are as follows:

[0020] SNP-yf-F: 5'-TGACGCTTGCTTAATGAGAT-3',

[0021] SNP-yf-R: 5'-TATCAAAGTTGGGAATGTCG-3'.

[0022] In the above application, PCR amplification obtains a 408 bp fragment, wherein the cucumber material whose 305th base is A is a yellow-fleshed cucumber, and the cucumber material whose 305th base is G is a white-fleshed cucumber.

[0023] For the above application, the reaction system for PCR amplification is: total reaction system 20 μL, 5.0 ng·μL -1 Template DNA 2 μL, 50 ng·μL -1 1 μL each of the forward and reverse primers, 10 μL 2×Phanta Max Master Mix, and 6 μL double distilled water.

[0024] In the above application, the reaction procedure of PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 30 seconds, 35 cycles; and incubation at 72°C for 5 minutes.

[0025] The beneficial effects of the present invention are:

[0026] Prior to the present application, there had been no reports of SNP markers located on chromosome VII for identifying yellow flesh of cucumbers. The present invention provides a new molecular marker for the identification of yellow flesh cucumbers, and the SNP marker is closely linked to the yf gene. The SNP marker obtained by the present invention can be used to determine whether a cucumber candidate material has yellow flesh characteristics at any stage through molecular identification. The detection of the marker has the advantages of high efficiency and few restrictions, which improves the efficiency of the selection and breeding of yellow flesh cucumber materials and can greatly shorten the breeding cycle. The use of the SNP marker of the present application in combination with the molecular markers that have been reported for identifying yellow flesh of cucumbers can improve the accuracy of identification and serve to accelerate the breeding process. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific embodiments, but the scope of the present invention is not limited thereto. Unless otherwise specified, the operations used in the following examples are all conventional methods, and the reagents used can all be commercially available.

[0028] Materials and Methods

[0029] The experimental materials used in this study are PI200815 (yellow flesh), 931 (white flesh), and 38 core germplasm materials preserved in this project. The above materials are preserved in this laboratory and guaranteed to be released to the public for verification experiments within 20 years from the date of application.

[0030] PI200815 is an Indian cucumber with no ridges, no veins, sparse white thorns and yellow flesh. It is a known variety and is described in the research paper "Inheritance offlesh and skin colors in powdery mildew resistant cucumbers" published by Kooistra in Euphytica magazine, issue 20, pages 521-523 in 1971. This laboratory has preserved it and guarantees that it will be released to the public for verification experiments within 20 years from the date of application.

[0031] 931 is a North China prickly cucumber, with ridges, fine lines, dense white thorns, and white flesh. It is a homozygous Xintai prickly selection line from the Institute's cucumber research group. It is an existing known variety, and is also recorded in the article "Excellent Varieties in Protected Areas - Introduction to Xintai Prickly Cucumbers" published by Zhang Fengming et al. in the 7th issue of "Northern Horticulture" in 1989. This laboratory has preserved it and guarantees that it will be released to the public for verification experiments within 20 years from the date of application.

[0032] The SNP-yf marker primers were designed by our laboratory based on the genome information of the resequencing, using the Primer 5.0 software, and synthesized at Beijing Bioengineering Co., Ltd. The genome information of the resequencing was detailed in the paper “Agenomic variation map provides insights into the genetic basis of cucumber domestication and diversity” published by Qi et al. in Nature Genetics in 2013.

[0033] Main reagents

[0034] The PCR experiment used 2×Phanta Max Master Mix from Vazyme, and sequencing was performed at Beijing Bioengineering Co., Ltd.

[0035] In previous studies, we used 1 SSR marker, 5 Indel markers and 2 SNP markers to locate the yellow flesh gene yf of cucumber between markers yfSNP1 and yfSNP2 on chromosome 7. The physical distance of this segment is 101.81kb. Based on the above results, we carried out this study. Combining the data of cucumber genome sequence and the resequencing data of the two parents, we analyzed and located the SNPs in this region. Using bioinformatics combined with the phenotypic identification of the F2 genetic population of the PI200815×931 hybrid combination, we found two possible SNP markers closely linked to the yellow flesh gene yf of cucumber: SNP16433384 A / G and SNP16411700 C / T.

[0036] Example 1. SNP marker SNP16433384 A / G linked to cucumber yellow flesh gene

[0037] 1. Acquisition of SNP16433384 A / G marker

[0038] Combining the data of cucumber genome sequence and resequencing data of the two parents, bioinformatics combined with phenotypic identification of genetic populations was used to analyze and locate SNPs in this region, and a SNP marker located at the 16,433,384th nucleotide position on chromosome 7 of the cucumber '9930' reference genome V2 version was found: SNP16433384 A / G. It was found that in the yellow flesh parent material PI200815 (P1), the base at this position was A; in the white flesh parent material 931 (P2), the base at this position was G.

[0039] 2. Detection of SNP16433384 A / G marker

[0040] Based on the obtained SNP marker SNP16433384 A / G of the cucumber yellow flesh gene, the DNA sequence of the above-mentioned segment of chromosome 7 reference genome of the Chinese Long cucumber inbred line '9930' reference genome (V2 version) was downloaded from the cucumber genome database website (http: / / cucurbitgenomics.org / ), and primers were designed using primer design software primer premier 5.0.

[0041] The sequences of the designed primers are as follows:

[0042] Forward primer: SNP-yf-F (SEQ ID NO. 1): 5'-TGACGCTTGCTTAATGAGAT-3', reverse primer: SNP-yf-R (SEQ ID NO. 2): 5'-TATCAAAGTTGGGAATGTCG-3'.

[0043] DNA was extracted from the leaves of the parental materials yellow-fleshed inbred line 'PI200815' and white-fleshed inbred line '931', and the PCR products were amplified and sequenced using primers SNP-yf-F / SNP-yf-R. The PCR reaction system was: total reaction system 20 μL, 2 μL DNA (5.0 ng·μL -1 ), forward and reverse primers (50 ng·μL -1 ) 1 μL each, 10 μL 2xPhanta Max Master Mix (Vazyme), 6 μL double distilled water. The PCR amplification program was: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, 4℃ storage. The sequencing of the amplified product was performed at Beijing Biotech Co., Ltd. The measured sequence was compared with the 9930 (V2) genome sequence to obtain the mutation of the corresponding SNP site.

[0044] A 408 bp band was obtained from the yellow-fleshed inbred line 'PI200815', and its nucleotide sequence is shown in SEQ ID NO.3. The 305th base of the sequence shown in SEQ ID NO.3 is A.

[0045] A 408 bp band was also obtained from the white flesh inbred line '931', and its nucleotide sequence is shown in SEQ ID NO.4. The 305th base of the sequence shown in SEQ ID NO.4 is G.

[0046] The sequence of SEQ ID NO.3 is as follows:

[0047] TGACGCTTGCTTAATGAGATTTCGTTGTTTACTATACGTGAAGGGGTATTTTGATTTAAACATTGTATAATTGTTAAAATATATATATTAAAATGGTTTTGTCTTGGCACATAAGATCTCCAAATGTCTACAAGTTCATAGACTTTTGGAA TGGGTTACCAATATCAAACAAAATTGGTGAATTGAGTAGTTTTTAATGGATGTGGATCAAATAAAGAAAGTGTTAGTGTGTGTTGGACAATTATAATTATAAAAATGGCAAATTAATAGATATTTGAGTTTTCTTAAGCAAAGGGTAGTTAG ATCATTTTCTCCATGGTAAGTGGCTACAAACTGACCAATGCCAAAGGCTTAACCAAAAGGCGACCAATGGTAATGGAAGCTTTTCGACATTCCCAACTTTGATA.

[0055] The sequence of SEQ ID NO.4 is as follows:

[0056] TGACGCTTGCTTAATGAGATTTCGTTGTTTACTATACGTGAAGGGGTATTTTGATTTAAACATTGTATAATTGTTAAAATATATATATTAAAATGGTTTTGTCTTGGCACATAAGATCTCCAAATGTCTACAAGTTCATAGACTTTTGGAA TGGGTTACCAATATCAAACAAAATTGGTGAATTGAGTAGTTTTTAATGGATGTGGATCAAATAAAGAAAGTGTTAGTGTGTGTTGGACAATTATAATTATAAAAATGGCAAATTAATAGATATTTGAGTTTTCTTAAGCAAAGGGTAGTTAG G TCATTTTCTCCATGGTAAGTGGCTACAAACTGACCAATGCCAAAGGCTTAACCAAAAGGCGACCAATGGTAATGGAAGCTTTTCGACATTCCCAACTTTGATA.

[0064] 2. Verification of SNP16433384 A / G

[0065] Using 38 cucumber core germplasm materials preserved in this project, the marker SNP16433384 A / G linked to the yf gene obtained earlier was verified to determine the accuracy of the marker for molecular marker-assisted selection.

[0066] The cucumber material was planted in the field, and three biological replicates were set for each material, with a total of 5 plants in each replicate. The flesh color of the fruit at the same node of each material was visually inspected 30 days after the fruit bloomed. DNA from individual leaves of the plant was extracted, and PCR amplification of SNP-yf-F / SNP-yf-R was performed using the aforementioned primers. The PCR amplification products were sequenced, and a 408 bp band was obtained, confirming the 305th base of the PCR amplification product sequence. The results are shown in Table 1.

[0067] Compared with the flesh color identification phenotype of the selected materials, the genotypes marked in 38 core germplasm materials were basically consistent with the flesh color identification phenotype, with an accuracy rate of 94.74%, indicating that SNP16433384 A / G can be used for the molecular identification of cucumber flesh color.

[0068] Table 1 Field phenotype and genetic testing results of cucumber flesh color

[0069] Cucumber Material No. genotype Flesh phenotype Cucumber Material No. genotype Flesh phenotype CG4 G white CG40 G white CG6 G white CG43 G white CG8 G white CG45 G white CG9 G white CG47 G white CG10 G white CG50 A white CG11 G white CG55 A white CG12 G white CG59 G white CG13 G white CG20 A yellow CG14 G white CG66 A yellow CG15 G white CG70 A yellow CG16 G white CG71 A yellow CG28 G white CG72 A yellow CG29 G white CG77 A yellow CG30 G white CG78 A yellow CG31 G white CG81 A yellow CG32 G white CG82 A yellow CG35 G white CG83 A yellow CG36 G white CG84 A yellow CG37 G white CG85 A yellow

[0070] Example 2. SNP marker SNP16411700 C / T

[0071] 1. Detection of SNP16411700 C / T marker in parental materials

[0072] This example further studies and confirms the possible SNP marker SNP16411700C / T closely linked to the cucumber yellow flesh gene. SNP16411700 C / T is located at the 16,411,700th nucleotide position on chromosome 7 of the cucumber '9930' reference genome V2 version, and the base of this position is C or T.

[0073] Based on the obtained SNP marker SNP16411700 C / T of the cucumber yellow flesh gene, the DNA sequence of the above segment of chromosome 7 of cucumber '9930' reference genome V2 version was downloaded from the cucumber genome database website (http: / / cucurbitgenomics.org / ), and primers were designed using primer design software primer premier 5.0.

[0074] The sequences of the designed primers are as follows:

[0075] Forward primer SNP-2yf-F (SEQ ID NO. 5): 5'-ACTCCCATCAGCATGTTAGC-3', reverse primer SNP-2yf-R (SEQ ID NO. 6): 5'-TCATTCAGTTTGGTCACCC-3'.

[0076] DNA was extracted from the leaves of the parental materials yellow-fleshed inbred line 'PI200815' and white-fleshed inbred line '931', and the PCR products were amplified and sequenced using primers SNP-2yf-F / SNP-2yf-R. The PCR reaction system was: total reaction system 20 μL, 2 μL DNA (5.0 ng·μL -1 ), forward and reverse primers (50 ng·μL -1) 1 μL each, 10 μL 2xPhanta Max Master Mix (Vazyme), 6 μL double distilled water. The PCR amplification program was: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds, 55°C annealing for 15 seconds, 72°C extension for 30 seconds, 35 cycles; 72°C incubation for 5 minutes, 4°C storage. Sequencing of the amplified products was performed at Beijing Biotech Co., Ltd.

[0077] A 515 bp band was obtained from the white flesh inbred line '931', and its nucleotide sequence is shown in SEQ ID NO.7. The 342nd base of the sequence shown in SEQ ID NO.7 is T.

[0078] A 515 bp band was obtained from the yellow flesh inbred line 'PI200815', and its nucleotide sequence is shown in SEQ ID NO.8. The 342nd base of the sequence shown in SEQ ID NO.8 is C.

[0079] The sequence of SEQ ID NO.7 is as follows:

[0080] ACTCCCATCAGCATGTTAGCGACTTCGAGATTGTGATTAGTTGAGCTATGCTTGTCGT

[0081] CTATAATTATTGCTATGTGCTCTTTAAAAAAAATACCCCACCTCACTATCGTCTTCTCC

[0082] GTCACCCATTGCTCCGTAATCATCCACGTTGAATATCTCCGGTGATGCCAAAGGCGAT

[0083] GACGCCATCTTCTCCAACCTCGTCCTCAACATGCTGGAGAATTCAGAGGAGTATTTAT

[0084] AATGTTGACCATCAACTTCTTTATCACCGCTGCTAATTGACGGTAGAGGATTATCAAC

[0085] ATCAGGATACGAGCCGGAGCATGTCGAGAGAATGTCAAAGATGACAACGA T GACGA

[0086] AGAGAAACGTAAGAAGGGAAAGGCAACAAGGACGGCCGAGTAATGGACGACACAT

[0087] ATTGGAATGATATTGTGTGGAGTTTTTAAAAGAGGGAATGGAGTTTGAGGGGGGGG

[0088] AAGGGGAAGAAAAGTAGGGAAAGTTTTGATGGAATAGTGGGTGACCAAACTGAAT

[0089] GA。

[0090] The sequence of SEQ ID NO.8 is as follows:

[0091] ACTCCCATCAGCATGTTAGCGACTTCGAGATTGTGATTAGTTGAGCTATGCTTGTCGT

[0092] CTATAATTATTGCTATGTGCTCTTTAAAAAAAATACCCCACCTCACTATCGTCTTCTCC

[0093] GTCACCCATTGCTCCGTAATCATCCACGTTGAATATCTCCGGTGATGCCAAAGGCGAT

[0094] GACGCCATCTTCTCCAACCTCGTCCTCAACATGCTGGAGAATTCAGAGGAGTATTTAT

[0095] AATGTTGACCATCAACTTCTTTATCACCGCTGCTAATTGACGGTAGAGGATTATCAAC

[0096] ATCAGGATACGAGCCGGAGCATGTCGAGAGAATGTCAAAGATGACAACGA C GACGA

[0097] AGAGAAACGTAAGAAGGGAAAGGCAACAAGGACGGCCGAGTAATGGACGACACAT

[0098] ATTGGAATGATATTGTGTGGAGTTTTTAAAAGAGGGAATGGAGTTTGAGGGGGGGG

[0099] AAGGGGAAGAAAAGTAGGGAAAGTTTTGATGGAATAGTGGGTGACCAAACTGAAT

[0100] GA.

[0101] 2. Verification of SNP16411700 C / T marker in cucumber core germplasm materials

[0102] The 38 core cucumber germplasm materials preserved in this project were used to verify the marker SNP16411700 C / T obtained earlier to determine its accuracy in marker-assisted selection.

[0103] The cucumber material was planted in the field, and three biological replicates were set for each material, with a total of 5 plants in each replicate. The flesh color of the fruit at the same node of each material was visually observed 30 days after the fruit bloomed. DNA from individual leaves of the plant was extracted, and PCR amplification of SNP-2yf-F / SNP-2yf-R was performed using the aforementioned primers. The PCR amplification products were sequenced, and a 515 bp band was obtained, confirming the 342nd base of the PCR amplification product sequence. The results are shown in Table 2.

[0104] Table 2

[0105]

[0106] Compared with the flesh color identification phenotype of the selected cucumber materials, the consistency rate between the SNP16411700C / T marker genotype and the flesh color identification in 38 core germplasm materials was only 34.21%, and the consistency rate at this site in 26 materials with white flesh was only 3.85%, indicating that the SNP16411700 C / T marker is not suitable as a molecular marker for the identification of yellow cucumber flesh color, and the difference at this site cannot indicate the flesh color.

Claims

1. A SNP molecular marker linked to the yf gene for identifying yellow flesh trait of cucumber, characterized by: The site of the SNP molecular marker is at the physical position 16,433,384bp on chromosome 7 of the '9930' cucumber reference genome V2 version. The base of this site is A or G. The cucumber material with the base A at this site is a yellow-fleshed cucumber, and the cucumber material with the base G at this site is a white-fleshed cucumber.

2. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The specific primer pair includes primers SNP-yf-F and SNP-yf-R, and the nucleic acid sequences of the primers are as follows: SNP-yf-F: 5'-TGACGCTTGCTTAATGAGAT-3', SNP-yf-R: 5'-TATCAAAGTTGGGAATGTCG-3'.

3. The kit according to claim 2, characterized in that: The invention also comprises cucumber genomic DNA extraction reagent, PCR amplification reaction reagent and PCR amplification product sequencing reagent.

4. Use of the SNP molecular marker linked to the yf gene for identifying the yellow flesh trait of cucumber according to claim 1 in any of the following (1)-(4): (1) Identify or assist in identifying yellow-fleshed cucumber materials; (2) Identify or assist in identifying the yellow flesh gene yf in cucumber; (3) Screening or assisting in the screening of yellow-fleshed cucumber varieties; (4) Cultivate or assist in the cultivation of yellow-fleshed cucumber varieties.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 305th base is A or G, the cucumber material with the base A at this position is a yellow-fleshed cucumber, and the cucumber material with the base G at this position is a white-fleshed cucumber.

6. The use according to claim 4, characterized in that: The application comprises the following steps: extracting genomic DNA of the sample to be tested as a template, using the amplification primers of the SNP molecular marker to perform PCR amplification, sequencing the PCR amplification products, and judging whether the sample to be tested is yellow flesh according to the sequencing results.

7. The use according to claim 6, characterized in that: The amplification primers of the SNP molecular markers are as follows: SNP-yf-F: 5'-TGACGCTTGCTTAATGAGAT-3', SNP-yf-R: 5'-TATCAAAGTTGGGAATGTCG-3'.

8. The use according to claim 7, characterized in that: The 408 bp fragment was obtained by PCR amplification, and the cucumber material whose 305th base was A was yellow-fleshed cucumber, and the cucumber material whose 305th base was G was white-fleshed cucumber.

9. The use according to claim 6, characterized in that: The reaction system for PCR amplification is: total reaction system 20 μL, 5.0 ng·μL -1 2 μL of template DNA, 50 ng·μL -1 1 μL each of the forward and reverse primers, 10 μL 2×Phanta Max Master Mix, and 6 μL double distilled water.

10. The use according to claim 9, characterized in that: The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 30 seconds, 35 cycles; and insulation at 72°C for 5 minutes.

Images