KASP molecular marker of wheat scab resistance QTL Qfhb.jaas-2AL and application of KASP molecular marker

Abstract

The invention belongs to the field of wheat breeding, and discloses an application of a QTL (quantitative trait loci) Qfhb.jaas-2AL derived from a local variety centipede wheat in improving wheat scab resistance, or an application in preparing / cultivating a plant with scab resistance. The QTL locus is jointly identified through whole genome association analysis of 314 natural wheat populations and QTL linkage analysis of a centipede wheat * Ningmai 166 double haploid population, is located in the interval of 671.2-672.1 Mb on a 2A chromosome, can explain 13.53% of phenotypic variation and 8.1% of phenotypic variation respectively, and is named as Qfhb.jaas-2AL. A KASP molecular marker is screened and developed from the site interval, and the KASP molecular marker is named as KASP-Q2A-2. The KASP molecular marker has relatively high correlation with the gibberellic disease resistance, and can be used for molecular marker-assisted selective breeding of wheat gibberellic disease resistance.

Description

Technical Field

[0001] The invention belongs to the field of wheat breeding and relates to a KASP molecular marker of wheat fusarium head blight resistance QTL Qfhb.jaas-2AL and an application thereof. Background Art

[0002] Fusarium head blight (FHB) is a fungal ear disease caused by Fusarium graminearum (Fg) that seriously affects wheat yield and quality worldwide. The occurrence of Fusarium head blight not only causes a serious reduction in wheat yield, but also accumulates fungal toxins such as deoxynivalenol in the grains, thereby affecting the quality of wheat. Relying solely on chemical agents to control Fusarium head blight will not only lead to pesticide residues and environmental pollution, but also increase production costs. Therefore, the most economical, effective and environmentally friendly measure to prevent and control wheat Fusarium head blight is to use resistant wheat varieties.

[0003] Wheat resistance to Fusarium head blight is a quantitative trait controlled by multiple genes, and its genetic mechanism is highly complex. To date, nearly 500 Fusarium head blight resistance loci have been located, covering 44 segments on 21 chromosomes of wheat. Since the effects of most loci are small, major resistance genes that can be used for breeding are still extremely rare. At present, there are 9 QTLs with strong effects and formal names, including Fhb1 on Sumai 3 3BS, Fhb2 on BW278 (Sumai 3 derivative) 6BS, Fhb3 on Leymus racemosus 7Lr#1S, a wheat relative, Fhb4 on Wangshuibai 4BL and Fhb5 on 5AL, Fhb6 on Lymus tsukushiensis 1E(ts)#1S, Fhb7 on Thinopyrum pontium 7EL, Fhb8 on Wangshuibai 7D, and Fhb9 on chromosome 2D of Shi 4185. However, there is still a lack of resistance sources available for breeding, and genetic improvement of wheat fusarium resistance is still very challenging.

[0004] Wheat local varieties are very important genetic resources in wheat breeding, and may contain excellent genes that are lacking in bred varieties. After a long period of natural selection and artificial domestication, the resistance level of local varieties in the wheat-growing areas of the middle and lower reaches of the Yangtze River to Fusarium head blight is generally high. At present, multiple QTLs for Fusarium head blight resistance have been discovered from local varieties in the middle and lower reaches of the Yangtze River (Wangshuibai, Ambered Wheat, Long Ambered Wheat, Huangfangzhu, and Jianzimai). There are still undiscovered resistance resources in local varieties with good resistance to Fusarium head blight. Therefore, continuing to discover and locate genes for resistance to Fusarium head blight from local varieties will provide new sources of resistance for wheat breeding. Summary of the invention

[0005] The purpose of the present invention is to provide a KASP molecular marker of a QTL site Qfhb.jaas-2AL capable of improving plant resistance to fusarium head blight and its application.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The invention discloses an application of a SNP site in identifying wheat resistance to fusarium ergot disease, wherein the SNP site is located at 676457882 bp of wheat 2A, and its polymorphism is T / C.

[0008] A KASP molecular marker tightly linked to a major QTL for wheat fusarium head blight resistance, wherein the KASP molecular marker is located on wheat chromosome 2A, the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.4, and the 1145 bp position of the nucleotide sequence is T or C; wheat with the genotype of the KASP molecular marker being the TT genotype is a wheat variety resistant to fusarium head blight; and wheat with the genotype of the KASP marker being the CC genotype is a wheat variety susceptible to fusarium head blight.

[0009] The present invention also provides primers for detecting the above-mentioned KASP molecular markers, and the primer sequences are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0010] The present invention also provides the above-mentioned KASP molecular marker detection reagent or detection kit, comprising the primers described in claim 3.

[0011] The present invention also provides the use of the above primers or the above detection reagents or detection kits in identifying wheat breeding.

[0012] The present invention also provides the use of the above primers or the above detection reagents or detection kits in identification of wheat fusarium head blight resistance.

[0013] The present invention also provides the use of the above primers or the above detection reagents or detection kits in breeding wheat strains or lines with high ergot resistance.

[0014] The present invention also provides a method for identifying wheat fusarium head blight resistance, comprising: using the wheat genome DNA to be tested as a template, using the above primers to perform PCR amplification on the template, and performing genotyping identification according to the amplification result;

[0015] If the identified genotype is TT, the wheat to be tested has high resistance to ergot disease, and if the identified genotype is CC, the wheat to be tested has low resistance to ergot disease.

[0016] Furthermore, the PCR reaction procedure included: pre-denaturation at 95°C for 15 min; denaturation at 94°C for 20 s, gradient PCR at 62°C–57°C, decreasing by 0.5°C per cycle, for a total of 10 cycles; denaturation at 95°C for 10 s, annealing and amplification at 57°C for 60 s, for a total of 26 cycles; and storage at 10°C.

[0017] On the one hand, the QTL site Qfhb.jaas-2AL from the local variety Centipede wheat in the middle and lower reaches of the Yangtze River was located in the 671.2-672.1Mb interval of chromosome 2A of Centipede wheat through association analysis of natural populations and linkage positioning of genetic populations; the candidate genes TaNLR1-2A and TaRLK1-2A in the QTL interval, and the KASP molecular marker developed based on the sequence variation of the TaNLR1-2A gene; the KASP molecular marker is KASP-Q2A-2.

[0018] Furthermore, the 671.2-672.1Mb interval of chromosome 2A is the chromosome physical interval corresponding to Chinese spring wheat and centipede wheat, or a physical interval that is colinear with this interval in other wheat genera.

[0019] Beneficial Effects

[0020] The present invention uses a natural population containing 314 local varieties of wheat for association analysis, combined with genetic linkage positioning in a double haploid (DH) population of the local variety Wugongmai × Ningmaizi 166 resistant to ergot, to identify a new QTL locus located in the 671.2–672.1Mb interval on chromosome 2A, which can explain 13.53% and 8.1% of the phenotypic variation, respectively, and is named Qfhb.jaas-2AL. The Qfhb.jaas-2AL locus discovered by the present invention is from the local variety Wugongmai in the middle and lower reaches of the Yangtze River, and is different from all the ergot resistance loci studied by previous researchers. The KASP molecular marker screened and developed at this locus can be used to detect the genotype of the Qfhb.jaas-2AL locus, and is applied to molecular marker-assisted selection breeding for ergot resistance.

[0021] The whole genome association analysis of 314 natural wheat populations combined with QTL linkage analysis of the double haploid population of Wugongmai×Ningmaizi 166 jointly identified a new locus Qfhb.jaas-2AL located on chromosome 2A (671.2–672.1Mb). This locus originated from the Wugongmai local variety in the middle and lower reaches of the Yangtze River. It is different from the previously identified resistance source interval and is a new ergot resistance gene resource. It is of great significance for wheat breeders to breed wheat varieties with high ergot resistance.

[0022] The KASP marker KASP-Q2A-2 was developed by screening sequence variations from the Qfhb.jaas-2AL locus interval. The above KASP marker can divide the DH population of centipede wheat into two types with significant differences in resistance and susceptibility to ergot disease. This locus can be used for molecular marker-assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The frequency distribution of phenotypic resistance to Fusarium head blight in 314 wheat germplasms and the correlation analysis between different years. The distribution of (a) the number of diseased spikelets (nds) and (b) the percentage of diseased spikelets (pds) in the natural population; (c) the correlation analysis of phenotypes between different years;

[0024] Figure 2 Population structure analysis of natural populations for association analysis. (a) Phylogenetic analysis of natural populations; (b) Principal component analysis; (c) Dividing natural populations into four optimal taxa based on delta K values, Group I–Group IV; (d) Joint analysis of geographic distribution and population structure Q values; (e) STRUCTURE analysis;

[0025] Figure 3 This is a genome-wide association analysis of the Fusarium head blight phenotype (BLUE value) of 314 wheat accessions. (a) Manhattan plot showing the SNP clusters associated in GWAS; (b) Q_Q plot based on the Blink model in the association analysis; (c) LD heat map of the Qfhb-2A locus on chromosome 2A; (d) Loci that are stably associated with the number of diseased spikelets in different years; (e) Loci that are stably associated with the diseased spikelet rate in different years;

[0026] Figure 4 The initial location of Qfhb.jaas-2AL in the centipede wheat × Ningmaizi 166DH population; (a) Genetic map of linkage location in the DH population; (b) The location of the Qfhb.jaas-2AL locus in the DH population in the genetic map and physical map; (c) QTL linkage analysis positioning of Qfhb.jaas-2AL in the centipede wheat × Ningmaizi 166DH population;

[0027] Figure 5Figure 3 Genotyping and identification of KASP markers in the Wheat × Ningmaizi 166 DH population; (a) Frequency distribution of fusarium head blight phenotypes in the DH population; (b) Fusarium head blight phenotypes of Wheat (WGM) and Ningmaizi 166 (NMZ166) in a greenhouse; (c) Correlation analysis of the fusarium head blight resistance phenotypes in the DH population over two years; (d) Genotyping results of KASP markers in the DH population, T:T genotype is resistant, and C:C genotype is susceptible. DETAILED DESCRIPTION

[0028] The following examples define the present invention and describe the development and validation of the present invention in locating the Qfhb.jaas-2AL locus, the KASP molecular marker. Based on the following description and these examples, those skilled in the art can determine the essential characteristics of the present invention and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to adapt it to different uses and conditions.

[0029] Example 1

[0030] Location of the Qfhb.jaas-2AL locus

[0031] 1.1 Genotyping and population structure analysis of natural populations

[0032] The applicant analyzed 314 natural wheat populations. Figure 1 As shown, 30 germplasms without Fhb1 were found, which may be new resistance resources. The natural population mainly consists of 63 samples from the middle and lower reaches of the Yangtze River wheat area, 83 samples from the Huanghuai wheat area, 83 samples from the southwest wheat area, 15 local varieties, and 70 mixed subtypes. The DNA of the natural wheat population was extracted by the CTAB method, and 314 natural populations were genotyped using the 660KSNP chip. After quality control of the typing results using Plink software, 196,447 high-quality SNPs were retained for subsequent association analysis. Linkage disequilibrium (LD) analysis was performed using Plink software, and non-linked SNPs (r 2 =0) for population structure analysis. Combining phylogenetic analysis, principal component analysis and STRUCTURE analysis, such as Figure 2 As shown, 314 wheat populations were divided into four optimal taxonomic groups.

[0033] 1.2 Localization of Qfhb.jaas-2AL in natural and genetic populations

[0034] The genome-wide association analysis of the best linear unbiased estimate (BLUE) values ​​of the number of diseased spikelets (nds) and the rate of diseased spikelets (pds) was performed, such as Figure 3As shown, four stable signal sites significantly associated with resistance to ergot were identified on chromosomes 2A, 3B, 4A, and 5B. Among them, Qfhb-3B on chromosome 3B is a known Fhb1 site. After haplotype analysis of the associated population, it was found that the site located on chromosome 2A had the most significant phenotypic differences between haplotypes. The physical interval size of this site on the chromosome is about 5.9Mb, and after LD block analysis within the interval, it was further narrowed to about 1Mb. Subsequently, as Figure 4 As shown, linkage analysis was used to locate the same physical interval of the site again in the local variety Wugongmai×Ningmaizi 166DH population, and it was named Qfhb.jaas-2AL. The molecular marker is located on chromosome 2A of wheat, at chr2A:676457881, and the genome version is Chinese Spring v2.1; the sequence of the KASP marker is shown in SEQ ID No, 4; the 1145th base of SEQ ID No.4 is T or C; the wheat with the genotype of the KASP marker being the TT genotype is a wheat variety resistant to scab, and the sequence is shown in SEQ ID No.4; the wheat with the genotype of the KASP marker being the CC genotype is a wheat variety susceptible to scab, and the sequence is shown in SEQ ID No.6.

[0035] Example 2

[0036] Development and validation of KASP markers

[0037] 2.1 KASP primer design

[0038] By comparing the TaNLR1-2A gene sequence in the association analysis population, the SNP site was selected to obtain the sequence of 100 bp before and after. According to the sequence information, the KASP marker was designed using the PolyMarker website (https: / / www.polymarker.info / ), and a FAM or HEX fluorescence detection sequence linker was added before the two forward primer sequences to obtain the KASP marker sequence shown in the following table.

[0039]

[0040]

[0041] 2.2 Identification of resistance to fusarium scurf

[0042] The double haploid (DH) population material constructed by hybridization of centipede wheat × Ningmaizi 166 was used as a sample and planted in a greenhouse. Normal wheat plants at the early flowering stage were selected, and 15 wheat ears of the same line were randomly selected. Using the single flower drip method, 10 μl of spore mixture of four fusarium spore strains (F0609, F0301, F0908, F1126) was dripped into the florets in the middle of the wheat ears. Each material was inoculated with 15 to 20 wheat ears, and the spore concentration was 100 spores / μl. After inoculation, the bags were covered with moisture for 3 days. The number of diseased spikelets and the total number of spikelets were investigated 21 days after inoculation, and the diseased spikelet rate was calculated.

[0043] Percentage of diseased spikelet (PDS) = (number of diseased spikelets / total number of spikelets per spikelet) × 100%

[0044] The severity of the disease of the wheat materials was investigated and the grade classification was based on the agricultural industry standard of the People's Republic of China (Technical Specifications for Evaluation of Disease and Pest Resistance of Wheat NY / T 1443.4-2007): Wheat Fusarium Scab Severity Grading and Resistance Evaluation Standards, see the table below.

[0045]

[0046] Evaluation criteria for resistance of Fusarium fusiformis to single flower drop inoculation

[0047]

[0048] 2.3 Genotyping using KASP primers

[0049] Primer preparation: dilute the newly synthesized primer to a concentration of 100 μmol / ml and prepare the primer working solution according to the following table:

[0050] Element Volume (μl) Final concentration (μmol / ml) Forward Primer 1 120 12 Forward Primer 2 120 12 Reverse primer 300 30 Purified water 460 Total volume 1000

[0051] PCR reaction system: DNA 3ul (about 100ng),

[0052] KASP primer mix 0.825 μl,

[0053] 2×KASP Master Mix 3.0μl,

[0054] PCR reaction program: pre-denaturation at 95°C for 15 min; denaturation at 94°C for 20 s, gradient PCR at 62°C–57°C, decreasing 0.5°C per cycle, for a total of 10 cycles; denaturation at 95°C for 10 s, annealing and amplification at 57°C for 60 s, for a total of 26 cycles; storage at 10°C.

[0055] KASP marker genotyping: The fluorescence signal was detected using a real-time fluorescence quantitative PCR system, and the genotyping results were exported using LaunchKluster Caller software;

[0056] Phenotypic test: GraphPad Prism 9.0.1 software was used to perform statistical analysis on the phenotypic data of the genotypes to determine the correlation between the KASP marker and resistance to fusarium head blight.

[0057]

[0058] Among the populations tested, there was a significant difference in resistance to fusarium wilt between the T:T genotype and the C:C genotype.

[0059] like Figure 5 As shown in the results, the KASP marker KASP-Q2A-2 can divide the DH population into two types with significant differences in resistance and susceptibility to fusarium spores, among which the T:T genotype has higher resistance to fusarium spores, the C:C genotype has lower resistance to fusarium spores, and no heterozygous T / C genotype was found. The typing results fully demonstrated that the KASP molecular marker has a high correlation with fusarium spores resistance, and the KASP-Q2A-2 molecular marker can be applied to molecular marker-assisted selection breeding of wheat.

[0060] The nucleotide sequence of the TaNLR1-2A gene of the present invention is shown in SEQ ID NO.4:

[0061] SEQ ID NO.4

[0062]

[0063] The amino acid sequence of the TaNLR1-2A protein of the present invention is shown in SEQ ID NO.5:

[0064] SEQ ID NO.5

[0065] MAEMIAISLSAKVAATLSRSPAADISSLVAVRSGIAAAARDLELLRAFLRFADSRRGADALVSAWVDQIRDVGFELEDAADEYAFLSGGGFVRACANFGAWLALARRLGKARVRLRDLSDAKERYGIRPASASASSSAPDGGTGPVVGQKLAEAAHFVEHGEIVGVAAHRRLLMKWLTEDLDFRRSLVAVCGMGGVGKTTLVTSVYKEVAASRYFDCAAWVSVSKNFTTDDLLRKIAKELHRDARAGMPDIDEMDYRSLVEALRGHLANKRYLLLLDDVWDANAWYEIRNALVDDGTGSRIIITTRSQDVASLAASTRIIMLEPLCEQEAWSLFCNTTFRKDDNRECPHHLEHWAVKILGRCCGLPLAIVSVGNLLALKDRTEFAWKNVHDSLDWNESSVRGIGQVSSILNLSIDDLPYHLKRCLLYCSIYPEDFLIKRKILIRLWIAEGYIEEKGQGTLEEIADDYLNQLVQRSLLQVTLTNEFGRVKRLCIHDLIRDLILQRSMKEGFIVFSKCSPALESSKKIRHLILDRCETDHITVPKLTSIRSFNAFMADMDSSVLSGFRLLTVLNLWFVQIDKLPSSLTNLLNLRYLGIRSTLIKELPQELGKLHHLQTLDTKWSMVQRLPPSIAKLKSLRHLILYRRRSADFRYPGPGSAIVFPQGLQNLTCLQTLKYVEADENMVKSLGSLKHMKSLEIFGVHESILVHLPSSISKMSGLLRLGIVSRDANVSLDLEPFSQPPIKLQRLSLTGMLARGKLPSWVGRLDSLVQLRLCSSELKGDSVGLLSSLPRLLHLTLNNAYSDKSLTFPEGCFPVLKKLSLHDLPNLSHVEFQKGSLVHLNELILGRCDDLTEIPQGIENLTQLDNLELFEMPSEIIQKIQDGETLQGNYEDSQRATTVKNIHWYNGQLLQKTIYTNLFTVQM*。

[0066] SEQ ID NO.6

[0067]

[0068] TGGTTCGTTCAGATAGACAAACTACCTAGCTCACTGACCAATCTTCTTAATC

[0069] TGCGGTATCTTGGCATCCGGTCCACTCTCATTAAAGAGCTTCCACAGGAAT

[0070] TGGGGAAATTACATCACTTGCAAACTTTAGACACCAAGTGGTCCATGGTCC

[0071] AGAGGTTACCGCCTAGCATCGCGAAGCTCAAGAGCCTGCGCCACCTGATAT

[0072] TGTATAGACGCCGATCTGCAGATTTTAGGTATCCAGGGCCTGGTTCAGCAAT

[0073] TGTATTTCCACAGGGACTACAAAACCTAACCTGCCTGCAGACCCTTAAATA

[0074] CGTCGAAGCTGATGAGAACATGGTCAAATCCTTAGGAAGCTTGAAACATAT

[0075] GAAGAGCTTAGAGATATTTGGTGTGCATGAGAGCATTCTTGTTCATTTGCCC

[0076] TCATCCATCTCCAAAATGAGTGGCCTTCTGCGCTTGGGAATTGTCAGTCGA

[0077] GATGCTAATGTATCATTGGACTTGGAGCCATTTTCTCAACCACCAATAAAGC

[0078] TACAGAGACTTTCATTGACAGGGATGTTAGCAAGAGGTAAGTTGCCTTCAT

[0079] GGGTTGGCCGCCTTGATAGCCTCGTGCAGTTGCGTTTATGTTCATCTGAGCT

[0080] CAAGGGAGATTCAGTTGGATTGCTCTCATCACTTCCCAGGCTGTTACATCTT

[0081] ACTCTGAACAATGCATACAGCGACAAGAGCTTGACCTTTCCAGAAGGCTG

[0082] TTTTCCAGTTCTTAAGAAGCTGAGTTTACATGACTTGCCTAACCTTTCTCAT

[0083] GTAGAGTTTCAAAAAGGGAGTCTTGTACATCTAAATGAGCTAATCTTAGGC

[0084] CGTTGTGATGACCTAACTGAAATACCCCAAGGCATCGAGAACCTCACACA

[0085] GCTTGACAACCTTGAGCTTTTTGAAATGCCAAGTGAGATAATACAGAAGAT

[0086] TCAAGATGGAGAAACATTACAGGGGAATTATGAAGATTCTCAGCGCGCTAC

[0087] AACTGTTAAGAACATCCACTGGTATAATGGACAATTGTTGCAGAAAACAAT

[0088] TTACACCAACCTATTCACAGTTCAAATGTAG。

Claims

1. Application of SNP loci in identifying wheat scab resistance, characterized in that: The SNP site is located at 676457882bp of wheat 2A, and its polymorphism is T / C.

2. A KASP molecular marker tightly linked to a major QTL for wheat fusarium head blight resistance, characterized in that: The KASP molecular marker is located on the wheat chromosome 2A, and the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.4, and the 1145bp position of the nucleotide sequence is T or C; the wheat whose genotype of the KASP molecular marker is the TT genotype is a wheat variety resistant to ergot; the wheat whose genotype of the KASP marker is the CC genotype is a wheat variety susceptible to ergot.

3. A primer for detecting the KASP molecular marker according to claim 2, characterized in that: The primer sequences are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

4. A KASP molecular marker detection reagent or detection kit according to claim 2, characterized in that: Comprising the primers described in claim 3.

5. Use of the primer according to claim 3 or the detection reagent or detection kit according to claim 4 in identifying wheat breeding.

6. Use of the primers according to claim 3 or the detection reagent or detection kit according to claim 4 in identifying resistance to wheat fusarium head blight.

7. Use of the primers according to claim 3 or the detection reagent or detection kit according to claim 4 in breeding wheat strains or lines with high resistance to ergot disease.

8. A method for identifying wheat scab resistance, characterized in that: include: Using the wheat genomic DNA to be tested as a template, using the primers described in claim 3 to perform PCR amplification on the template, and performing genotyping identification according to the amplification results; If the identified genotype is TT, the wheat to be tested has high resistance to ergot disease, and if the identified genotype is CC, the wheat to be tested has low resistance to ergot disease.

9. The method according to claim 8, characterized in that The PCR reaction program included: pre-denaturation at 95°C for 15 min; denaturation at 94°C for 20 s, gradient PCR at 62°C–57°C, decreasing 0.5°C per cycle, for a total of 10 cycles; denaturation at 95°C for 10 s, annealing and amplification at 57°C for 60 s, for a total of 26 cycles; and storage at 10°C.

Images