SNP (Single Nucleotide Polymorphism) site related to salt tolerance character of wheat and application of SNP site in predicting salt tolerance of wheat

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to the salt tolerance character of wheat and application of the SNP site in predicting the salt tolerance of the wheat, and belongs to the technical field of molecular marker breeding. According to the invention, the SNP site is located at TaHKT1; at the 1655th site of the CDS region of the 1-B gene, when the basic group of the site is G, the corresponding wheat is wheat with salt tolerance; when the basic group of the site is A, the corresponding wheat is wheat without salt tolerance character. The method for predicting the salt tolerance of the wheat is developed based on the SNP site, the maximum relative root length of the wheat after salt stress can be predicted, the cost is saved, the selection efficiency is improved, and therefore the breeding process is accelerated. And a new potential opportunity is provided for efficient screening of excellent alleles and cultivation of salt-tolerant and drought-resistant wheat varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker breeding, and in particular relates to a SNP site related to the salt tolerance trait of wheat and an application thereof in predicting the salt tolerance of wheat. Background Art

[0002] As one of the world's major food crops, wheat yield and quality are directly related to food security. However, soil salinization is one of the important factors limiting wheat production. About 20% of the world's irrigated farmland is affected by salinization, resulting in a significant decrease in wheat yield. Therefore, breeding salt-tolerant wheat varieties is an important way to cope with the challenge of salinization and increase wheat yield.

[0003] Wheat salt tolerance is a complex quantitative trait regulated by multiple genes. These genes are involved in multiple physiological processes such as ion balance, osmotic regulation, and antioxidant defense. Traditional breeding methods rely on phenotypic selection, but because salt tolerance is greatly affected by the environment, phenotypic selection is inefficient and time-consuming. Therefore, the development of molecular markers related to salt tolerance can accelerate the breeding process of salt-tolerant wheat varieties.

[0004] Molecular marker technology is an important tool in modern agricultural breeding, which can directly detect genes or genomic regions related to target traits. Commonly used molecular markers include SSR (simple sequence repeats), SNP (single nucleotide polymorphism), AFLP (amplified fragment length polymorphism), etc. These marker technologies have been widely used in wheat genetic diversity analysis, gene positioning and molecular marker-assisted selection (MAS).

[0005] In recent years, with the rapid development of genomics and bioinformatics technologies, researchers have identified multiple QTLs (quantitative trait loci) and candidate genes related to salt tolerance in wheat. However, the number of existing molecular markers is limited, and the stability and applicability of most markers still need to be further verified. Therefore, the development of molecular markers related to wheat salt tolerance traits will not only provide efficient and stable molecular tools for wheat salt tolerance breeding; the application of these markers will also significantly improve the efficiency and accuracy of wheat salt tolerance breeding, making important contributions to addressing the global challenge of soil salinization and ensuring food security. Summary of the invention

[0006] In view of the problems existing in the prior art, the object of the present invention is to provide SNP sites related to the salt tolerance trait of wheat and their application in predicting the salt tolerance of wheat.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A SNP site associated with the salt tolerance trait of wheat, the SNP site is located at the 1655th position of the CDS region of the TaHKT1;1-B gene. When the base of the site is G, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:1, and the corresponding wheat is wheat with salt tolerance trait; when the base of the site is A, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:2 or SEQ ID NO:3, and the corresponding wheat is wheat without salt tolerance trait.

[0009] Application of the above-mentioned SNP loci related to wheat salt tolerance in predicting wheat salt tolerance.

[0010] On the basis of the above scheme, the salt tolerance trait is that the maximum relative root length of wheat is longer after salt stress during the germination period.

[0011] A method for predicting salt tolerance of wheat, comprising determining the base category at position 1655 of a CDS region of a wheat TaHKT1;1-B gene, wherein when the base at the position is G, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:1, and the corresponding wheat is wheat with a salt tolerance trait; and when the base at the position is A, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:2 or SEQ ID NO:3, and the corresponding wheat is wheat without a salt tolerance trait.

[0012] On the basis of the above scheme, the cDNA of the wheat to be tested was used as a template and specific primers were used to PCR amplify the nucleic acid fragment containing the 1655th base in the CDS region of the TaHKT1;1-B gene. By detecting the type of the base at this site, it was determined whether the wheat to be tested was wheat with salt tolerance.

[0013] Based on the above scheme, the specific primers are composed of two left primers shown in SEQ ID NO:4 and SEQ ID NO:5 and one right primer shown in SEQ ID NO:6.

[0014] On the basis of the above scheme, different fluorescent labels were set at the 5' ends of the two left primers; after the PCR amplification was completed, the data was read using fluorescent typing software.

[0015] On the basis of the above scheme, the 5' ends of the two left primers, Allele-specific primer 1 and Allele-specific primer 2, are respectively provided with two different fluorescent labels, FAM and HEX.

[0016] Based on the above scheme, the PCR reaction system is: 5 μL cDNA of the wheat sample to be tested with a concentration of 100 ng / μL, 5 μL HiGeno 2x Probe Mix and 0.14 μL SNP-Specific Primers, supplemented to 10 μL with ddH2O;

[0017] Among them, the preparation method of SNP-Specific Primers is as follows: mix 12μL of 100μM Allele-specific primer 1-FAM, 12μL of 100μM Allele-specific primer 2-HEX and 30μL of 100μM Common, reverse primer, and add ddH2O to make up to 100μL.

[0018] Based on the above scheme, the PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 40 s, 10 cycles, decreasing 0.6°C per cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, 28 cycles, and storage at 4°C.

[0019] Advantages of the technical solution of the present invention:

[0020] Based on the genetic variation analysis of the TaHKT1;1-B gene in natural wheat populations, the present invention obtained a SNP site related to the salt tolerance trait of wheat, and developed a method for predicting wheat salt tolerance, which provided a new tool for wheat breeding and helped achieve new breakthroughs and developments in the field of wheat breeding.

[0021] The method of the present invention can predict the maximum relative root length of wheat after salt stress, saves costs, improves selection efficiency, and thus accelerates the breeding process, providing new potential opportunities for efficient screening of excellent alleles and breeding of salt-tolerant and drought-resistant wheat varieties.

[0022] In addition, by analyzing the superior allele variation of the TaHKT1;1 gene, we can gain a deeper understanding of the specific function and mechanism of action of this gene in wheat salt stress response. This will help to improve the molecular regulatory network of wheat salt tolerance and reveal the physiological and biochemical change mechanisms of wheat under salt stress conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The genotyping results of the tested wheat varieties read by the fluorescence typing software;

[0024] Figure 2 Comparison results of maximum relative root length of different genotypes of tested wheat varieties after salt stress during germination period. DETAILED DESCRIPTION

[0025] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention will be further described in detail below in conjunction with specific examples and with reference to data. The following examples are intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0026] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The experimental materials, reagents, drugs, etc. used in the following examples, unless otherwise specified, can all be purchased through general channels.

[0027] In the following examples, the maximum relative root length refers to the ratio of the maximum root length mean value measured in the treatment group to the maximum root length mean value measured in the control group; the calculation formula is: maximum relative root length = maximum root length mean value of the treatment group / maximum root length mean value of the control group.

[0028] Example 1

[0029] A SNP site associated with the salt tolerance trait of wheat, the SNP site is located at the 1655th position of the CDS region of the TaHKT1;1-B gene, when the base of the site is G, the CDS sequence of the TaHKT1;1-B gene is shown in SEQ ID NO:1, the genotyping result is TaHKT1;1-B-Hap I, the corresponding wheat is wheat with salt tolerance, and the maximum relative root length of the wheat after salt stress during the germination period is longer. When the base of the site is A, the CDS sequence of the TaHKT1;1-B gene is shown in SEQ ID NO:2 or SEQ ID NO:3, the genotyping result is TaHKT1;1-B-Hap II or TaHKT1;1-B-Hap III, the corresponding wheat is wheat without salt tolerance, and the maximum relative root length of the wheat after salt stress during the germination period is shorter.

[0030] SEQ ID NO:1(5'→3')

[0031]

[0032] SEQ ID NO:2(5’→3’)

[0033]

[0034] SEQ ID NO:3(5’→3’)

[0035]

[0036] Example 2

[0037] The primer set for detecting the SNP site in Example 1 comprises two left primers shown in SEQ ID NO:4 and SEQ ID NO:5 and a right primer shown in SEQ ID NO:6; different fluorescent markers are respectively provided at the 5' ends of the two left primers, and the specific sequences are as follows:

[0038] Allele-specific primer 1-FAM:

[0039] 5'-FAM-GAAGGTGACCAAGTTCATGCTGGTTCAAGCGTACACCCTCAG-3' (SEQ ID NO: 4);

[0040] Allele-specific primer 2-HEX:

[0041] 5'-HEX-GAAGGTCGGAGTCAACGGATTGGTTCAAGGCGTACACCCTCAA-3' (SEQ ID NO: 5);

[0042] Common, reverse primer: 5'-CGGTGCTGTCCTTCTACATGGATGC-3' (SEQ ID NO: 6).

[0043] The nucleic acid sequence amplified by Allele-specific primer 1-FAM left primer and Common, reverse primer right primer is shown in SEQ ID NO:7.

[0044] SEQ ID NO:7(5'→3')

[0045] GAAGGTGACCAAGTTCATGCTGGTTCAAGGCGTACACCCTCAGAGGGAAGAAAAC CCTGAATGTGCATCCATGTAGAAGGACAGCACCG

[0046] The nucleic acid sequence amplified by the Allele-specific primer 2-HEX left primer and the Common, reverse primer right primer is shown in SEQ ID NO:8.

[0047] SEQ ID NO:8(5'→3')

[0048] GAAGGTCGGAGTCAACGGATTGGTTCAAGGCGTACACCCTCAAAGGGAAGAAAA CCTGAATGTGCATCCATGTAGAAGGACAGCACCG

[0049] Example 3

[0050] Application of the SNP site of Example 1 and the primer set of Example 2 in predicting salt tolerance of wheat

[0051] (1) Extracting total RNA from wheat leaves to be tested, and reversely transcribing it into cDNA as a template; the extraction method can adopt the existing method, or the following method can be adopted:

[0052] ① Take fresh wheat leaves, quickly freeze them in liquid nitrogen, and then grind them into powder using a mortar and pestle.

[0053] ② Transfer the ground powder to an RNase-free centrifuge tube, add 1 mL of TRIzol reagent, mix thoroughly, and let stand at room temperature for 5 minutes.

[0054] ③ Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes. Centrifuge at 12,000 × g for 15 minutes at -4°C. The sample is separated into three layers, with RNA in the upper aqueous phase.

[0055] ④ Transfer the upper aqueous phase to a new centrifuge tube, add 0.5 mL of isopropanol, mix gently, and let stand at room temperature for 10 minutes. Centrifuge at 12,000 × g for 10 minutes at -4°C, and the RNA will precipitate at the bottom of the tube.

[0056] ⑤Discard the supernatant, add 1 mL of 75% ethanol, mix gently, centrifuge at 7,500 × g for 5 minutes at -4°C, and discard the supernatant.

[0057] ⑥ Dry the RNA precipitate at room temperature for 5-10 minutes and add 20-50 μL DEPC water to dissolve the RNA.

[0058] ⑦ Use a spectrophotometer or fluorometer to measure RNA concentration and purity. The A260 / A280 ratio should be between 1.8-2.0.

[0059] ⑧Prepare the reverse transcription reaction system: Prepare the following reaction system in an RNase-free centrifuge tube (for example, a 20 μL system): 1-5 μL RNA template; 1 μL Oligo (dT) primer / random primer; 1 μL dNTPs (10 mM each); DEPC water to 12 μL. Mix gently and centrifuge briefly.

[0060] ⑨ Place the reaction tube in a 65℃ water bath or PCR instrument and incubate for 5 minutes to melt the RNA secondary structure. Immediately place the reaction tube on ice to cool for 2 minutes.

[0061] ⑩Add reverse transcriptase and buffer: 4 μL 5× reverse transcription buffer; 1 μL RNase inhibitor; 1 μL reverse transcriptase; DEPC water to 20 μL. Mix gently and centrifuge briefly.

[0062] Place the reaction tube in a PCR instrument or water bath and perform the reaction under the following conditions: 25°C, 5-10 minutes (primer annealing), 42°C, 50-60 minutes (cDNA synthesis), 70°C, 15 minutes (enzyme inactivation). After the reaction is completed, immediately place the reaction tube on ice.

[0063] After reverse transcription, cDNA can be directly used in subsequent experiments. If long-term storage is required, cDNA can be placed at -20℃ or -80℃.

[0064] (2) Using the cDNA of the wheat sample to be tested obtained above as a template, PCR amplification was performed using the primer set of Example 2.

[0065] The PCR reaction system was: 5 μL cDNA (100 ng / μL) of the wheat sample to be tested, 5 μL HiGeno 2x Probe Mix (Beijing Jiacheng Biotechnology Co., Ltd.) and 0.14 μL SNP-Specific Primers, and ddH2O was added to make up to 10 μL.

[0066] The preparation method of SNP-Specific Primers is as follows: 12 μL of 100 μM Allele-specific primer 1-FAM, 12 μL of 100 μM Allele-specific primer 2-HEX, and 30 μL of 100 μM right primer (Common, reverse primer) were mixed, and ddH2O was added to make up to 100 μL;

[0067] The specific PCR amplification procedure was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 40 s, 10 cycles, with a decrease of 0.6°C per cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, 28 cycles. Store at 4°C.

[0068] (3) After the reaction is completed, the PCR amplification products are genotyped according to the fluorescence signal in a real-time quantitative instrument (Bio-Rad C1000 Touch Thermal Cycler), with the excitation wavelength of FAM being 485 nm and the emission wavelength being 520 nm; the excitation wavelength of HEX being 535 nm and the emission wavelength being 556 nm; and the excitation wavelength of the system reference fluorescence ROX being 575 nm and the emission wavelength being 610 nm. The post-typing data are read using the commonly used fluorescence typing software (Bio-Rad CFX Maestro software).

[0069] Specifically: the PCR amplification products of the left primer Allele-specific primer 1-FAM carrying the fluorescent sequence FAM and the right primer Common, reverse primer are represented by red dots after being analyzed by software, indicating that the cDNA sample to be tested is TaHKT1; 1-B-HapⅠ type; the maximum relative root length of this sample wheat after salt stress during the germination period is longer, and it is salt-tolerant wheat.

[0070] The PCR amplification products of the left primer Allele-specific primer 2-HEX carrying the fluorescent sequence HEX and the right primer Common, reverse primer were represented by blue dots after analysis by software, indicating that the cDNA sample to be tested was TaHKT1; 1-B-HapⅡ type or TaHKT1; 1-B-HapⅢ type; the maximum relative root length of the wheat sample after salt stress during the germination period was short, and it was salt-intolerant wheat.

[0071] Example 4

[0072] Testing of actual wheat samples

[0073] 110 wheat samples were tested using the method of Example 3, and the typing results of the TaHKT1;1-B gene of the tested wheat samples were obtained as shown in Table 1.

[0074] Table 1 Typing results of TaHKT1;1-B gene in 110 natural wheat populations

[0075]

[0076]

[0077]

[0078] (Note: HapⅠ represents TaHKT1; 1-B-Hap I, Hap II and III represent TaHKT1; 1-B-Hap II or TaHKT1; 1-B-HapⅢ).

[0079] The fluorescence typing software (QuantStudio Design & Analysis Software) was used to read the typing results of some wheat samples in Table 1. Figure 1 As shown, the red dots indicate that the DNA sample to be tested is TaHKT1; 1-B-Hap I type, and the blue dots indicate that the sample to be tested is TaHKT1; 1-B-Hap II type or TaHKT1; 1-B-Hap III type.

[0080] The wheat materials in Table 2 were taken and treated with 160 mmol salt for three days after germination. Wheat that was not treated with salt stress was used as the control group. The maximum root length of wheat with different genotypes before and after salt stress during germination was measured, and the maximum relative root length after salt stress was calculated. The results are shown in Figure 2. Figure 2 As shown, the maximum relative root length of TaHKT1;1-B-Hap I haplotype wheat after salt stress during germination was significantly greater than the maximum relative root length of TaHKT1;1-B-Hap II / HapⅢ haplotype wheat after salt stress during germination.

[0081] The above test results show that the typing results are good and the SNP sites in Example 1 can be further applied to breeding material detection.

[0082] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A SNP locus associated with salt tolerance in wheat, characterized in that: The SNP site is located at TaHKT1; 1-B gene CDS region No. 1655, when the base at this site is G, the TaHKT1; The CDS sequence of the 1-B gene is shown in SEQ ID NO: 1, and the corresponding wheat is wheat with salt tolerance trait; when the base at this site is A, the TaHKT1; The CDS sequence of the 1-B gene is shown in SEQ ID NO: 2 or SEQ ID NO: 3, and the corresponding wheat is wheat that does not have the salt tolerance trait.

2. Use of the SNP loci associated with the salt tolerance trait of wheat as described in claim 1 in predicting the salt tolerance of wheat.

3. The use according to claim 2, characterized in that: The salt tolerance trait is that the maximum relative root length of wheat is longer after salt stress during the germination period.

4. A method for predicting salt tolerance of wheat, characterized in that: The base type at position 1655 of the CDS region of the wheat TaHKT1;1-B gene was determined. When the base at the position was G, the TaHKT1; The CDS sequence of the 1-B gene is shown in SEQ ID NO: 1, and the corresponding wheat is wheat with salt tolerance trait; when the base at this site is A, the TaHKT1; The CDS sequence of the 1-B gene is shown in SEQ ID NO: 2 or SEQ ID NO: 3, and the corresponding wheat is wheat that does not have the salt tolerance trait.

5. The method for predicting salt tolerance of wheat according to claim 4, characterized in that: Using the cDNA of the wheat to be tested as a template, specific primers were used to PCR amplify the nucleic acid fragment containing the 1655th base in the CDS region of the TaHKT1;1-B gene. By detecting the type of the base at this site, it was determined whether the wheat to be tested was salt-tolerant.

6. The method for predicting salt tolerance of wheat according to claim 5, characterized in that: The specific primers are composed of two left primers shown in SEQ ID NO:4 and SEQ ID NO:5 and a right primer shown in SEQ ID NO:

6.

7. The method for predicting salt tolerance of wheat according to claim 6, characterized in that: The 5' ends of the two left primers are respectively provided with different fluorescent labels; after the PCR amplification is completed, the data is read using fluorescent typing software.

8. The method for predicting salt tolerance of wheat according to claim 7, characterized in that: The 5' ends of the two left primers, Allele-specific primer 1 and Allele-specific primer 2, are respectively provided with two different fluorescent labels, FAM and HEX.

9. The method for predicting salt tolerance of wheat according to claim 8, characterized in that: The PCR reaction system is: 5 μL cDNA of the wheat sample to be tested with a concentration of 100 ng / μL, 5 μL HiGeno 2x Probe Mix and 0.14 μL SNP-Specific Primers, and ddH2O is added to make up to 10 μL; Among them, the preparation method of SNP-Specific Primers is as follows: mix 12μL of 100μM Allele-specific primer 1-FAM, 12μL of 100μM Allele-specific primer 2-HEX and 30μL of 100μM Common, reverse primer, and add ddH2O to make up to 100μL.

10. The method for predicting salt tolerance of wheat according to claim 8, characterized in that: The PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 40 s, 10 cycles, decreasing 0.6°C per cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, 28 cycles, and storage at 4°C.

Images