Detection system for detecting duck hepatitis A virus type 3 based on RPA-CRISPR-Cas13a

Abstract

The invention discloses a detection system for detecting a duck hepatitis A virus type 3 on the basis of RPA-CRISPR-Cas13a. The detection comprises a primer probe combination for detecting the duck hepatitis A virus type 3 based on RPA-CRISPR-Cas13a, wherein the primer probe combination comprises an RPA amplified primer pair, crRN and an RNA probe; a primer pair for RPA (recombinase polymerase amplification) amplification comprises a forward primer RPA-VP1-F and a reverse primer RPA-VP1-R. The detection system established by the invention has an on-site detection function, can directly carry out detection in a practical application environment, and does not need to depend on a standard professional laboratory and expensive experimental equipment thereof. The system innovatively promotes further development of a DH AV-3 diagnosis technology, and provides effective technical support for prevention and control of DHAV-3 diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of poultry and livestock virus detection, and in particular to a detection system for detecting duck hepatitis A virus type 3 based on RPA-CRISPR-Cas13a. Background Art

[0002] Duck hepatitis A virus type 3 (DHAV-3) mainly infects ducklings under 3 weeks old. It is an acute, highly contagious and lethal infectious disease that has caused serious economic losses to the poultry industry. In recent years, the outbreak of DHAV-3 and the frequent mutation and recombination of its strains have further aggravated the prevalence of the disease, bringing unprecedented challenges to its diagnosis, prevention and control. Therefore, it is urgent to innovate and upgrade the existing detection methods to effectively respond to the increasingly severe prevention and control situation.

[0003] At present, conventional virus detection methods, such as virus culture, neutralization test, enzyme-linked immunosorbent assay, RT-PCR and RT-qPCR, have been widely used in DHAV-3 clinical monitoring and epidemiological screening. Although these methods have made significant progress in detection sensitivity and accuracy, they generally have the limitations of cumbersome operation, long time consumption, high cost, and high requirements for technical level and experimental environment, which can hardly meet the urgent needs of on-site rapid detection. TM Although the RT-iiPCR method used in the system has achieved portability on a micro-device (weighing less than 0.83 pounds) and reduced dependence on traditional PCR instruments and real-time fluorescence PCR equipment, its high equipment cost is still a common constraint. Therefore, developing a rapid, accurate and low-cost detection method for DHAV-3, especially in providing an efficient solution in field monitoring and emergency response, has significant practical significance and application value.

[0004] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and its associated proteins (Cas) have become important technology platforms in the field of genome editing and molecular diagnosis. CRISPR / Cas systems can be divided into two categories according to their composition and functional characteristics: the first type of system consists of multiple RNA-guided Cas protein complexes that can recognize and cut exogenous nucleic acids, mainly including type I, type III and type IV (such as Cas3, Cas10). The second type of system relies on a single multi-domain Cas protein to edit specific gene sequences through RNA guidance. Representative proteins include Cas9, Cas12 and Cas13. Because the Cas proteins in the second type of system have higher functional singularity and specificity, they are more suitable as gene editing tools. Cas13a is an RNA-guided RNA endonuclease that can efficiently and specifically cut single-stranded RNA (ssRNA). This unique feature makes Cas13a an ideal tool for RNA detection, gene silencing and virus monitoring. In the CRISPR / Cas13a-based molecular detection system, a single guide RNA (sgRNA) guides the Cas13a enzyme to recognize and bind to a specific RNA target. When Cas13a binds to the target RNA, it activates its nonspecific trans-cleavage activity, leading to the degradation of surrounding RNA molecules. This phenomenon can be used as the basis for signal amplification, significantly enhancing the sensitivity of diagnostic analysis. Although the CRISPR-Cas13a system has made important progress in many application fields, there is currently a lack of accurate detection methods for DHAV-3. Summary of the invention

[0005] In view of the above-mentioned prior art, the object of the present invention is to provide a duck hepatitis A virus type 3 detection method and its detection system based on the combined application of RPA-CRISPR-Cas13a system. The present invention overcomes the limitations existing in the existing DHAV-3 detection technology and develops a rapid, sensitive and specific detection scheme suitable for grassroots detection. The detection system proposed in the present invention has significant advantages and can realize on-site detection without relying on expensive experimental equipment and standardized professional laboratory environment. It provides strong technical support for the efficient diagnosis of DHAV-3, promotes the progress of DHAV-3 diagnostic technology, and provides a faster and more reliable detection means for the prevention and control of the epidemic.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a primer-probe combination for detecting duck hepatitis A virus based on RPA-CRISPR-Cas13a, comprising a primer pair for RPA amplification, crRNA and RNA probe;

[0008] The primer pair for RPA amplification includes a forward primer RPA-VP1-F and a reverse primer RPA-VP1-R, the sequence of the forward primer RPA-VP1-F is shown in SEQ ID NO.1, and the sequence of the reverse primer RPA-VP1-R is shown in SEQ ID NO.2;

[0009] The sequence of the crRNA is shown in SEQ ID NO.7;

[0010] The RNA probe is a single-stranded RNA with labeling groups at both ends, and its sequence is rUrUrUrUrUrUrU.

[0011] The RNA probe is a single-stranded RNA with a fluorescent group labeled at one end and a fluorescent quenching group or a biotin group labeled at the other end;

[0012] The fluorescent group is carboxyfluorescein or fluorescein isothiocyanate, the fluorescence quenching group is BHQ-1, and the biotin group is Biotin.

[0013] The second aspect of the present invention provides use of the primer-probe combination described above in preparing a visualization product for detecting or diagnosing duck hepatitis A virus.

[0014] The visual product for detecting or diagnosing duck hepatitis A virus is a fluorescent detection kit for detecting or diagnosing duck hepatitis A;

[0015] Alternatively, a test strip kit for detecting or diagnosing duck hepatitis A.

[0016] In a third aspect of the present invention, a duck hepatitis A fluorescence detection kit based on the RPA-CRISPR-Cas13a system is provided, wherein the fluorescence detection kit contains the above-mentioned primer probe combination and a duck hepatitis A virus positive plasmid standard.

[0017] The RNA probe in the fluorescent detection kit is a single-stranded RNA with FAM labeled at the 5' end and BHQ-1 labeled at the 3' end.

[0018] The preparation method of the duck hepatitis A virus positive plasmid standard comprises the following steps:

[0019] The duck hepatitis A virus VP1 gene was amplified to obtain an amplified product, which was connected to a pMD18-T vector, positive clones were screened, plasmid DNA was extracted, and a duck hepatitis A virus positive plasmid standard was prepared.

[0020] In a fourth aspect, the present invention provides a detection method of a duck hepatitis A fluorescence detection kit based on an RPA-CRISPR-Cas13a system, comprising the following steps:

[0021] (1) Extract RNA from the sample to be tested and reverse transcribe it into cDNA;

[0022] (2) Using the cDNA obtained in step (1) as a template, the duck hepatitis A fluorescence detection kit is used to perform real-time PCR amplification on the sample to be tested, and the amplification curve is observed.

[0023] In a fifth aspect, the present invention provides a test strip detection kit for duck hepatitis A based on the RPA-CRISPR-Cas13a system, wherein the test strip kit contains the above-mentioned primer-probe combination.

[0024] The RNA probe in the test strip detection kit is a single-stranded RNA with FITC labeled at the 5' end and Biotin labeled at the 3' end.

[0025] In a sixth aspect, the present invention provides a detection method of a duck hepatitis A test strip kit based on an RPA-CRISPR-Cas13a system, comprising the following steps:

[0026] (1) Extract RNA from the sample to be tested and reverse transcribe it into cDNA;

[0027] (2) Using the cDNA obtained in step (1) as a template, product amplification is performed based on the RPA-CRISPR-Cas13a system to obtain a reaction solution, and the reaction solution is dripped onto the test strip binding pad. After the reading area is soaked, the result is read within 10 minutes.

[0028] In step (2), the result interpretation criteria are:

[0029] If a red band appears at the detection line of the sample to be tested, or if red bands appear at both the detection line and the quality control line of the sample to be tested, it indicates that the sample to be tested is DHAV-3 positive;

[0030] If no red band appears at the test line of the sample to be tested, but a red band appears on the quality control line, it means that the sample to be tested is DHAV-3 negative;

[0031] If no red strips appear at the test line and quality control line of the sample to be tested, it means that the test strip or reaction solution is damaged or ineffective, or it is caused by improper operation during the test.

[0032] The setting of the quality control line can reflect the concentration of duck hepatitis A virus in the sample to be tested;

[0033] When a red stripe appears on the test line but no stripe appears on the quality control line, it indicates that the concentration of DHAV-3 virus in the sample is high; when red stripes appear on both the test line and the quality control line, it indicates that the concentration of DHAV-3 virus in the sample is low.

[0034] The definition of the quality control line of the present invention is significantly different from that of the traditional quality control line. By observing the performance of the test line and the quality control line at the same time, the concentration of the sample can be effectively judged, which can not only improve the sensitivity, but also ensure the reliability of the detection, avoid the occurrence of false positives or false negatives, and make the detection results more accurate and reliable. This design helps to ensure the accuracy of the detection, adapt to samples of different concentrations, and improve the controllability of the operation.

[0035] Beneficial effects of the present invention:

[0036] The present invention designs a DHAV-3 detection system with strong specificity and high sensitivity based on the RPA-CRISPR-Cas13a enzyme molecular detection system. The detection system can accurately detect 10 0 The detection method provided by the present invention has a detection performance comparable to that of the RT-qPCR method, avoids the occurrence of false positives or false negatives, can adapt to samples of different concentrations, and has high sensitivity and specificity.

[0037] The detection system of the present invention combines portable lateral flow test strip technology, can realize on-site detection, does not need expensive equipment and complicated operation process, and is suitable for grassroots on-site rapid detection. The system not only effectively supports the detection of DHAV-3, but also provides technical guarantee for later epidemiological investigation, and has important prevention and control guiding significance. The technical scheme provided by the present invention breaks through the limitations of traditional detection methods, provides an effective solution for the rapid, sensitive and specific detection of DHAV-3, and has important application value in disease monitoring and prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Schematic diagram of detection based on the RPA-CRISPR-Cas13a system.

[0039] Figure 2 Schematic diagram of the sequence design of DHAV-3 crRNA.

[0040] Figure 3 DNA gel electrophoresis diagram of RPA primer amplification screening (A) and 50-min fluorescence value measurement results of positive plasmid CRISPR-Cas13a detection of DHAV-3VP1 gene sequence by two crRNAs (B).

[0041] Figure 4The detection principle of the test strips, (A) the detection principle of the conventional test strips, (B) the schematic diagram of the lateral flow detection of the portable test strips based on RPA-CRISPR-Cas13a.

[0042] Figure 5 The specific result diagram based on fluorescence detection of the RPA-CRISPR-Cas13a system: (A) the change of fluorescence value of each sample over time; (B) comparison of the highest fluorescence value of each sample.

[0043] Figure 6 The sensitivity results of fluorescence detection based on the RPA-CRISPR-Cas13a system; (A) The change of fluorescence value of standard plasmids with different concentrations over time; (B) Comparison of the maximum fluorescence values ​​of standard plasmids with different concentrations.

[0044] Figure 7 This is a graph showing the specificity results of the RPA-CRISPR-Cas13a portable test strip detection.

[0045] Figure 8 This is a sensitivity result chart based on RPA-CRISPR-Cas13a portable test strip detection.

[0046] Fig. 9 This is a graph showing the results of using the RPA-CRISPR-Cas13a system to detect clinical samples. DETAILED DESCRIPTION

[0047] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0048] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.

[0049] Example 1: Construction of DHAV-3 fluorescence detection system

[0050] (1) RPA primer design and screening

[0051] Considering that the duck hepatitis A virus VP1 gene is often used in the genetic evolution analysis of the virus, the conserved nucleotide region of the VP1 gene (GenBank: KM361878.1) in the whole genome sequence of the DHAV-3 virus isolate was selected as the attachment site of the RPA primer.

[0052] RPA primer design principles:

[0053] The design of primers requires that their length be controlled between 30 and 50 bases. Too long or too short may affect the amplification efficiency. The primer sequence should avoid the presence of palindromic sequences or other special structural sequences to ensure its specificity and amplification performance. At the same time, the GC content should be controlled within the range of 30% to 70% to avoid the formation of secondary structures or hairpin structures by the primers, thereby affecting the amplification effect. The size of the selected amplification target fragment is most suitable between 100 and 200 bp to obtain the best amplification efficiency and detection sensitivity.

[0054] According to the above RPA amplification primer design principles, three pairs of specific RPA primer sequences were designed. At the same time, the designed primers were specifically screened on NCBI PrimerBLAST, and T7 RNA polymerase promoter was added to the 5' end of the forward primer. The sequences of each RPA primer pair were designed as follows:

[0055] Forward primer RPA-VP1-F1 (SEQ ID NO.1):

[0056] TAATACGACTCACTATAGGGAAGTGATTCTGACCATTGTCAATAATGGAACAA;

[0057] Reverse primer RPA-VP1-R1 (SEQ ID NO.2):

[0058] GCGTAAAGGTGTGACAGAATAAAATGGAATA;

[0059] Forward primer RPA-VP1-F2 (SEQ ID NO.3):

[0060] TAATACGACTCACTATAGGGGTCAGCTTGGCGATGATGAACCAGTGTGTTTT;

[0061] Reverse primer RPA-VP1-R2 (SEQ ID NO.4):

[0062] AGAGATGCATGACCCTGGTCAGGCACTGGCAA;

[0063] Forward primer RPA-VP1-F3 (SEQ ID NO.5):

[0064] TAATACGACTCACTATAGGGGCTTGGTGATGATGAACCAGTGTGTTTTCTCAA;

[0065] Reverse primer RPA-VP1-R3 (SEQ ID NO.6):

[0066] CACCAGTATGTTGAACAGTACGAACCAGCCA;

[0067] The above three pairs of RPA primers were used to amplify the DHAV-3VP1 gene sequence, and the nucleic acid amplification effect of each pair of primers was analyzed by DNA gel electrophoresis. Figure 3 As shown in A, after comparison, the primer pair RPA-VP1-F1 / RPA-VP1-R1 with the best amplification effect was finally selected as the RPA amplification primers.

[0068] (2) Designing crRNA

[0069] The core of the CRISPR-Cas13a detection method lies in crRNA, whose quality directly affects the sensitivity and accuracy of the detection method. In order to screen out the most efficient crRNA, two crRNAs were designed and synthesized for the highly conserved VP1 target region (227-339bp) of DHAV-3, and their specific sequence information is shown in Table 1.

[0070] The design of crRNA requires that it does not overlap with the RPA primer to ensure compatibility between the two. The spacer sequence of crRNA (length 28nt) is the reverse complementary sequence of any position on the transcribed target single-stranded RNA (ssRNA). Subsequently, the complete crRNA (such as Figure 2 And as shown in Table 1). In order to realize in vitro transcription to generate crRNA, the promoter sequence of T7 RNA polymerase is added upstream of the crRNA sequence so that T7 RNA polymerase can perform a transcription reaction. Finally, by using the reverse complementary DNA sequence of the entire sequence as a template, a single-stranded DNA template for in vitro transcription is obtained (as shown in Table 1).

[0071] Table 1 crRNA, crRNA in vitro transcription template and T7 promoter nucleotide sequences

[0072]

[0073]

[0074] Note: The underline is the 5' repeat sequence (length 36nt). According to the WIPOST.26 standard, uracil "U" in the sequence in Table 1 is represented by "T" in the sequence table.

[0075] (3) In vitro transcription and purification of crRNA

[0076] Anneal the T7-3G oligonucleotide with the crRNA in vitro transcribed single-stranded DNA template to generate double-stranded DNA for T7 in vitro transcription. The specific steps are as follows: Use Taq DNA polymerase (Biyuntian, cat. no. D7205) to prepare the annealing reaction system, and the reaction conditions are: incubate at 37°C for 30 minutes, then incubate at 95°C for 5 minutes, and cool to 25°C at a rate of 5°C per minute for annealing. As shown in Table 2. Subsequently, use T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, cat. no. E2050S) to prepare the in vitro transcription reaction system with reference to Table 3. After centrifuging and mixing the reaction solution, incubate at 37°C for 4 hours to complete the synthesis of cRNA. After the reaction is completed, add 1μLDNase I (Shanghai Shangbao Biotechnology Co., Ltd., Cat. No. T11015, Specification 1mL) to the system, mix and incubate at 37°C for 20 minutes to remove residual DNA. Finally, crRNA was purified using Spin Column RNAClean Kit (Shanghai Bioengineering, cat. no. B518688) according to the instructions.

[0077] Table 2 Annealing reaction system

[0078]

[0079] Table 3 In vitro transcription reaction system

[0080]

[0081] (4) Screening crRNA

[0082] CRISPR-Cas13a fluorescence detection was performed by running the reaction on a Roche LightCycler 96 real-time fluorescence quantitative PCR instrument for 50 minutes. Figure 3 As shown in B, for the two crRNAs, crRNA1 showed the highest fluorescence signal, indicating that it had the best amplification effect and the highest sensitivity. Therefore, crRNA1 with the best amplification effect was selected as the final crRNA.

[0083] (5) Synthesize target cDNA

[0084] The present invention uses a nucleic acid rapid release agent (EZassay, cat. no. LYS-RD-100) to extract the total RNA of the DHAV-3 strain. The method only requires two steps, and the total operation time is 21 minutes. The specific steps are as follows:

[0085] Step 1: Add the sample to be tested into a 1.5 mL centrifuge tube and centrifuge at 12,000 rpm for 10 minutes.

[0086] Step 2: Discard the supernatant, add 50 μL of nucleic acid release agent to the precipitate, vortex mix, and let stand for 10 minutes; then, centrifuge at 12,000 rpm for 1 minute to collect the sample.

[0087] Then, the extracted RNA was reverse transcribed into cDNA using HiFiScript cDNA synthesis kit (KANGWEI, cat. no. CW2569M).

[0088] (6) Preparation of target positive plasmid standards

[0089] In the present invention, forward and reverse primers for DHAV-3VP1 gene were designed, and VP1 genome was amplified by PCR method. After the amplified product was purified by gel extraction kit (Omega Bio-tek, cat.no.D2500-02), the purified PCR product was connected to pMD18-T vector according to classical molecular cloning technology to obtain recombinant plasmid pMD18-T-VP1. Then, the recombinant plasmid pMD18-T-VP1 was transformed into Escherichia coli DH5α competent cells, and positive clones were obtained by screening and sequence verification. The successfully screened positive clones were extracted with TIANprep Mini Plasmid Kit (TIANGEN, cat.no.DP105). In order to determine the concentration of the extracted plasmid, the plasmid was quantitatively analyzed by DS-11 spectrophotometer, and the copy number of pMD18-T-VP1 plasmid standard was calculated according to the optical density value.

[0090] (7) Synthesis of RNA reporter probes for fluorescence detection

[0091] By labeling the two ends of the RNA sequence with a FAM fluorescent group and a BHQ1 fluorescent quenching group, an RNA reporter probe for fluorescence detection was constructed. The sequence of the probe is specifically: FAM-rUrUrUrUrUrU-BHQ1, which was synthesized by Hunan Aikerui Biotechnology Co., Ltd.

[0092] (8) Nucleic acid detection system based on RPA-CRISPR-Cas13a system

[0093] Table 4: RPA-CRISPR-Cas13a detection system

[0094]

[0095]

[0096] Add the above 60 μL mixed solution into the reaction tube containing RAA Basic Kit (HuicH, cat. no. HP80201, containing RAA freeze-dried vacuum-packed components), and repeatedly resuspend the RPA freeze-dried vacuum-packed components on an ice box until they are completely dissolved.

[0097] Example 2: Specificity test of fluorescence detection of RPA-CRISPR-Cas13a system

[0098] Test objects: Reovirus (ARV), H9N2 subtype avian influenza virus (H9N2 AIV), Tembusu virus (TMUV), goose astrovirus (AstV), all of which were isolated, identified and preserved by the Poultry Disease Laboratory of Shandong Agricultural University.

[0099] RNA was extracted from the above virus samples and DHAV-3 samples using a commercially available nucleic acid rapid release agent (EZassay, cat. no. LYS-RD-100). Subsequently, the extracted RNA was reverse transcribed into cDNA using a HiFiScript cDNA synthesis kit (KANGWEI, cat. no. CW2569M). The reverse transcribed cDNA was used as a template, and the reaction system was prepared in an ice box with reference to step (7) in Example 1.

[0100] The following reaction conditions were used: incubation at 37°C for 50 minutes, recording fluorescence signals every 5 minutes, and using the Roche LightCycler96 real-time fluorescence quantitative PCR instrument to test the specificity of fluorescence detection of the RPA-CRISPR-Cas13a system. The test results are as follows: Figure 5 As shown, the fluorescence signal of the DHAV-3 sample increased rapidly over time, and compared with ARV, H9N2-AIV, TMUV and AstV samples, the difference was significant (P<0.001). The above results show that the DHAV-3 detection method established in the present invention is highly specific and does not cross-react with other viruses.

[0101] Example 3: Sensitivity test of fluorescence detection of RPA-CRISPR-Cas13a system

[0102] The pMD18-T-VP1 standard plasmid was diluted 10-fold (concentration range: 10 8 copies / μL-10 0 The reaction system was prepared in an ice box according to step (7) of Example 1. The reaction conditions were: incubation at 37°C for 50 minutes and recording the fluorescence signal every 5 minutes. The RPA-CRISPR-Cas13a system was tested for fluorescence using a Roche LightCycler96 real-time fluorescence quantitative PCR instrument to evaluate its sensitivity. The results are shown in Figure 6 As shown, the fluorescence signal gradually weakened with the increase of sample dilution.

[0103] When the plasmid standard was diluted to 10 0 When the fluorescence signal was 10 copies / μL, it showed a significant difference compared with the negative control (P < 0.001). The above results show that the minimum detection limit of the DHAV-3 detection method established in the present invention is 10 0 copies / μL.

[0104] Example 4: Construction of DHAV-3 test strips

[0105] The difference from Example 1 is that: Step (6) synthesizes RNA reporter probes for lateral flow test strip detection:

[0106] The RNA reporter probe for lateral flow test strip detection can be formed by labeling FITC fluorescent group and Biotin at both ends of the RNA sequence. Its sequence is: FITC-rUrUrUrUrUrU-Biotin, which is synthesized by Hunan Aikerui Biotechnology Co., Ltd.

[0107] The RPA-CRISPR-Cas13a detection system is the same as Table 4 of Example 1.

[0108] like Figure 4 As shown in B, goat anti-rabbit IgG antibody (detection line) is fixed on the test strip by strip mode, and the antibody is fixed on a nitrocellulose membrane. After the sample is added dropwise to the sample conjugate pad, if the concentration of duck hepatitis A virus type 3 in the sample is high, crRNA and RPA amplification product are complementary and bound, activating the cutting activity of Cas13a protein, and then cutting the RNA probe labeled with fluorescent biotin. Under the chromatography of the test strip, the cut fluorescent probe will migrate toward the absorbent paper. At this time, the rabbit anti-FITC monoclonal antibody labeled with gold nanoparticles binds to the FITC end on the cut fluorescent biotin probe, and then migrates to the detection area of ​​the goat anti-rabbit IgG antibody, forming a specific binding and aggregation in this area, thereby generating a red precipitation line that can be observed by the naked eye at the detection line.

[0109] If the sample contains a small amount of DHAV-3 or does not contain this virus, the gold nanoparticle-labeled rabbit anti-FITC monoclonal antibody, the fluorescent biotin probe and the biotin-ligand will combine to form a complex, thereby forming a red precipitation line at the quality control line. In addition, the gold nanoparticle-labeled rabbit anti-FITC monoclonal antibody and the FITC terminal conjugate on the cut fluorescent biotin probe continue to migrate to the goat anti-rabbit IgG antibody area and form a specific binding in this area, thereby forming a red precipitation line at the test line. The color development result can be clearly observed by the naked eye.

[0110] Result interpretation:

[0111] like Figure 4 As shown in B, if a red stripe appears at the detection line of the sample to be tested, or red stripes appear at both the detection line and the quality control line of the sample to be tested, it indicates that the sample to be tested is DHAV-3 positive.

[0112] If no red band appears at the detection line of the sample to be tested, but a red band appears on the quality control line, it means that the sample to be tested is DHAV-3 negative.

[0113] If no red strips appear at the test line and quality control line of the sample to be tested, it may be due to damage or failure of the test strip or reaction solution, or improper operation during the test.

[0114] The definition of the quality control line of the present invention is significantly different from that of the traditional quality control line. Specifically, Figure 4 In the first test strip shown in B, when a red strip appears on the test line but no strip appears on the quality control line, it does not mean that the test strip is faulty, but rather that the concentration of DHAV-3 virus in the sample is high. In the second test strip, both the test line and the quality control line are colored, indicating that the virus concentration in the sample is low. This CAS13a test strip detection setting can effectively judge the concentration of the sample by observing the performance of the test line and the quality control line at the same time, which can not only improve the sensitivity, but also ensure the reliability of the detection, avoid the occurrence of false positives or false negatives, and make the test results more accurate and reliable. This design helps to ensure the accuracy of the detection, adapt to samples of different concentrations, and improve the controllability of the operation.

[0115] Example 5: Specificity test based on portable test strip detection of RPA-CRISPR-Cas13a system

[0116] Using retroviral cDNA as a template, use a test strip to detect the reporter probe, and refer to step (7) of Example 1 to prepare the reaction system on an ice box. After the reaction system was incubated at 37°C for 50 minutes, 80 μL of HybriDetect Assay Buffer was added to the reaction mixture and incubated for another 5 minutes. Subsequently, a lateral flow test strip was used to perform a portable test strip test of the RPA-CRISPR-Cas13a system for specificity testing.

[0117] The test results are as follows Figure 7As shown, the color development of the test strip was observed only on the test strip for DHAV-3, while the test strips for other virus samples did not show any positive bands. This result shows that the DHAV-3 detection method established by the present invention has high specificity, can effectively distinguish DHAV-3 from other viruses, and there is no cross reaction.

[0118] Example 6: Sensitivity test based on portable test strip detection of RPA-CRISPR-Cas13a system

[0119] The pMD18-T-VP1 standard plasmid was diluted in 10-fold series (10 8 copies / μL up to 10 0 The reaction system was prepared in an ice box with 100 μL of 50 μL of HybriDetect Assay Buffer (0.1 μg / mL) as a template and a test strip to detect the reporter probe. The reaction system was incubated at 37°C for 50 minutes, and then 80 μL of HybriDetect Assay Buffer was added and incubated for another 5 minutes. Subsequently, a lateral flow test strip was used to perform a portable test strip test of the RPA-CRISPR-Cas13a system for sensitivity testing.

[0120] The test results are as follows Figure 8 As shown, the minimum detection limit of the DHAV-3 detection method established by the present invention is 10 0 copies / μL, indicating that this method has high sensitivity and can effectively detect low concentrations of DHAV-3 virus.

[0121] Application example: RPA-CRISPR-Cas13a detection of clinical samples

[0122] The fluorescence detection system and RT-PCR (see Chen X, Chen Y, Liu C, Li X, Liu H, Yin X, Bai X, Ge M, Chen H, Liu M, Du Y, Fan G, Zhang Y. Improved one-tube RT-PCR method for simultaneous detection and genotyping of duck hepatitis Avirus subtypes 1and 3. PLoS One. 2019Aug 1; 14(8): e0219750. doi: 10.1371 / journal.pone.0219750. PMID: 31369566; PMCID: PMC6675107) of Example 1 and fluorescence quantitative PCR (see Meng C, Huang Y, Rehman ZU, Hu W, Li C, Liang R, Chen Z, Song K, Wei T, Liu G. Development of an MCA-Based Real Time RT-qPCR Assay for the Simultaneous Detection and Differentiation of Duck Hepatitis AVirus Types 1and 3.Virol Sin.2020Oct;35(5):666-669.doi:10.1007 / s12250-020-00211-8.Epub 2020Apr 8.PMID:32270426;PMCID:PMC7736386)Thirty liver tissues of ducks suspected of DHAV-3 infection were tested and the test results were compared.

[0123] like Fig. 9 As shown, 18 DHAV-3 samples were tested positive by RPA-CRISPR-Cas13a, RT-qPCR and RT-PCR. For the remaining 12 DHAV-3 specimens, 4 of them were still positive by RPA-CRISPR-Cas13a and RT-qPCR. The above results show that the consistency of RPA-CRISPR-Cas13a and RT-qPCR in clinical sample detection reached 100%, and RPA-CRISPR-Cas13a was superior to the RT-PCR method in overall sensitivity.

[0124] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A primer-probe combination for detecting duck hepatitis A virus based on RPA-CRISPR-Cas13a, characterized in that: Including primer pairs, crRNA and RNA probes for RPA amplification; The primer pair for RPA amplification includes a forward primer RPA-VP1-F and a reverse primer RPA-VP1-R, the sequence of the forward primer RPA-VP1-F is shown in SEQ ID NO.1, and the sequence of the reverse primer RPA-VP1-R is shown in SEQ ID NO.2; The sequence of the crRNA is shown in SEQ ID NO.7; The RNA probe is a single-stranded RNA with labeling groups at both ends, and its sequence is rUrUrUrUrUrUrU.

2. The primer-probe combination according to claim 1, characterized in that: The RNA probe is a single-stranded RNA with a fluorescent group labeled at one end and a fluorescent quenching group or a biotin group labeled at the other end; The fluorescent group is carboxyfluorescein or fluorescein isothiocyanate, the fluorescence quenching group is BHQ-1, and the biotin group is Biotin.

3. Use of the primer-probe combination according to claim 1 or 2 in preparing a visualization product for detecting or diagnosing duck hepatitis A virus.

4. The use according to claim 3, characterized in that The visual product for detecting or diagnosing duck hepatitis A virus is a fluorescent detection kit for detecting or diagnosing duck hepatitis A; Alternatively, a test strip kit for detecting or diagnosing duck hepatitis A.

5. A duck hepatitis A fluorescence detection kit based on RPA-CRISPR-Cas13a system, characterized in that: The fluorescent detection kit contains the primer-probe combination according to claim 1 or 2 and a duck hepatitis A virus positive plasmid standard.

6. A detection method for a duck hepatitis A fluorescence detection kit based on the RPA-CRISPR-Cas13a system, characterized in that: The steps include: (1) Extract RNA from the sample to be tested and reverse transcribe it into cDNA; (2) Using the cDNA obtained in step (1) as a template, using the duck hepatitis A fluorescence detection kit described in claim 5 to perform real-time PCR amplification on the sample to be tested, and observing the amplification curve.

7. A test strip kit for duck hepatitis A based on the RPA-CRISPR-Cas13a system, characterized in that: The test strip kit contains the primer-probe combination according to claim 1 or 2.

8. A detection method for a duck hepatitis A test strip kit based on the RPA-CRISPR-Cas13a system, characterized in that: The steps include: (1) Extract RNA from the sample to be tested and reverse transcribe it into cDNA; (2) Using the cDNA obtained in step (1) as a template, product amplification is performed based on the RPA-CRISPR-Cas13a system to obtain a reaction solution, and the reaction solution is dripped onto the test strip binding pad. After the reading area is soaked, the result is read within 10 minutes.

9. The detection method of the duck hepatitis A test strip kit according to claim 8, characterized in that: In step (2), the result interpretation criteria are: If a red band appears at the detection line of the sample to be tested, or if red bands appear at both the detection line and the quality control line of the sample to be tested, it indicates that the sample to be tested is DHAV-3 positive; If no red band appears at the test line of the sample to be tested, but a red band appears on the quality control line, it means that the sample to be tested is DHAV-3 negative; If no red strips appear at the test line and quality control line of the sample to be tested, it means that the test strip or reaction solution is damaged or ineffective, or it is caused by improper operation during the test.

10. The detection method of the duck hepatitis A test strip kit according to claim 9, characterized in that: The setting of the quality control line can reflect the concentration of duck hepatitis A virus in the sample to be tested; When a red stripe appears on the test line but no stripe appears on the quality control line, it indicates that the concentration of DHAV-3 virus in the sample is high; when red stripes appear on both the test line and the quality control line, it indicates that the concentration of DHAV-3 virus in the sample is low.

Images