Screening method of potential medicine for treating acute lung injury

Abstract

The invention provides a screening method of a potential drug for treating acute lung injury. Specifically, by performing low-oxygen treatment on the mesenchymal stem cells, the curative effect of the MSC cells on the ALI can be effectively improved; meanwhile, potential drugs for treating the acute lung injury are screened by detecting the expression of drugs on HIF-1a / Wnt / beta-catenin signal channels in activated MSC cells, and technical support is provided for finding more potential drugs for treating the acute lung injury.

Description

Technical Field

[0001] The present invention relates to the field of medicine, and in particular to the technical field of drugs for treating acute lung injury. Background Art

[0002] Acute lung injury (ALI) is acute non-cardiogenic hypoxic respiratory failure caused by intrapulmonary and extrapulmonary etiologies. It has an acute onset, rapid progression, and critical condition. It is one of the most common acute and critical illnesses. It is reported that the incidence of ALI in the United States is as high as 86 per 100,000, causing billions of dollars in medical burden each year. With the progress of drug therapy and mechanical ventilation technology, the mortality rate of ALI has decreased, but the mortality rate of moderate to severe ALI is still over 40%, so it is urgent to find drugs that can effectively relieve or treat ALI.

[0003] Damage to the alveolar epithelium is the pathophysiological essence and treatment difficulty of ALI. Direct repair of damaged alveolar epithelium by stem cells is expected to fundamentally reverse the condition and prognosis of ALI patients. After the alveolar epithelium is damaged, alveolar type I epithelial cells (AECII) can migrate and differentiate into alveolar type 1 epithelial cells (AECI) to repair lung damage. However, the number of residual AECI in moderate to severe ALI is small, which affects the repair process and requires the supplementation of exogenous seed cells to complete the process. Mesenchymal stem cells (MSC) have become ideal seed cells for tissue repair due to their wide sources, few ethical controversies, and low immunogenicity. A large number of cell and animal studies have confirmed that supplementation of exogenous MSC can reduce pulmonary edema, improve lung inflammation, restore alveolar epithelial barrier function, alleviate lung injury and fibrosis, and reduce the mortality of ALI model animals. However, the results of clinical studies on MSC treatment of ALI patients are disappointing. Studies have shown that MSC transplantation did not improve the mortality, mechanical ventilation time and hospitalization time of ALI patients, and could only slightly reduce the levels of inflammatory factors such as -6 and IL-8. Therefore, it is crucial to clarify the factors that affect the repair ability of MSCs in real-world clinical studies and to deal with them in a targeted manner in order to promote MSC repair of ALI. It is also expected to provide an effective screening approach for more drugs for the treatment of acute lung injury.

[0004] Therefore, in view of the above problems existing in the prior art, it is necessary to develop a method for screening potential drugs for treating acute lung injury using MSCs. Summary of the invention

[0005] The purpose of the present invention is to overcome the above technical problems and provide a method for screening potential drugs for treating acute lung injury. Specifically, by subjecting mesenchymal stem cells to hypoxia treatment, the efficacy of mesenchymal stem cells MSC on ALI can be effectively improved; after mesenchymal stem cells were treated with hypoxia, it was found that the HIF-1a / Wnt / β-catenin signaling pathway can be regulated. At the same time, potential drugs effective for treating acute lung injury are screened by detecting the effect of drugs on activating the HIF-1a / Wnt / β-catenin signaling pathway in mesenchymal stem cells.

[0006] In a first aspect, the present invention provides a method for screening potential drugs for treating acute lung injury.

[0007] In some embodiments, the screening process involves treating MSCs with candidate drugs; further, examining the effect of candidate drug treatment at a safe dose on the HIF-1a / Wnt / β-catenin signaling pathway of MSC cells; further, using WB to detect the effect of candidate drug treatment at a safe dose on the expression of HIF-1α and β-catenin proteins in MSC cells.

[0008] In some embodiments, if the expression levels of HIF-1α and β-catenin are significantly downregulated after treatment with a candidate drug, the candidate drug is excluded; if the expression levels of HIF-1α and β-catenin are significantly upregulated after treatment with a candidate drug, the candidate drug is determined to be a potential drug for the treatment of ALI.

[0009] In some embodiments, the candidate drug is a small molecule compound, a macromolecular drug or a gene drug.

[0010] In some embodiments, the treating comprises co-culturing the candidate drug at a safe dose with MSC cells.

[0011] In some embodiments, the MSC cells are bone marrow mesenchymal stem cells.

[0012] In some embodiments, the MSC cells are treated with hypoxia, and the hypoxic condition is preferably 1% O2 or 5% O2.

[0013] In some embodiments, the potential drug can upregulate the expression of HIF-1α and β-catenin.

[0014] In some embodiments, the excluded candidate drugs are HIF-1α inhibitors and Wnt / β-catenin inhibitors, which can significantly inhibit MSCs from repairing lung tissue damage.

[0015] In some embodiments, the Wnt / β-catenin inhibitor is LGK-974.

[0016] In a second aspect, the present invention provides a method for improving the therapeutic effect of MSC cells on ALI, comprising subjecting mesenchymal stem cells to hypoxia treatment.

[0017] In some embodiments, the hypoxic condition is preferably 1% O2 or 5% O2.

[0018] In some embodiments, the MSC cells are treated with hypoxia to promote their paracrine effects.

[0019] In some embodiments, the MSC cells are treated with hypoxia to increase the expression of HIF-1α or β-catenin in the HIF-1α / Wnt / β-catenin signaling pathway to enhance the ability to repair ALI, thereby improving the therapeutic effect.

[0020] In some embodiments, hypoxia treatment of the MSC cells promotes the repair of ALI through the HIF-1α / Wnt / β-catenin signaling pathway, thereby improving the therapeutic effect.

[0021] In some embodiments, the hypoxia-treated MSC cells are capable of upregulating HIF-1a expression.

[0022] The beneficial effects achieved by the present invention are as follows:

[0023] (1) The present invention transplanted hypoxic cultured MSCs into LPS-ALI mice, confirming that hypoxic culture can promote MSCs to repair ALI; and confirming that hypoxic cultured MSCs can enhance MSC biological behavior and paracrine effects.

[0024] (2) The present invention clarifies that the HIF-1a / Wnt / B-catenin pathway is the mechanism by which hypoxia-cultured MSCs promote ALI repair.

[0025] (3) Based on the above findings, the present invention has developed a method for screening potential drugs for treating acute lung injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 :Effects of hypoxia on mouse bone marrow mesenchymal stem cells (MSCs). A. Flow cytometry detection of MSC cell surface marker CD14 - 、CD34 - 、CD44 + 、CD29 + Positive ratio; B. WB experiment detected the expression of HIF-1α and β-catenin in MSC cells after being treated with different hypoxia concentrations for different time periods; C. Flow cytometry detection of DIR labeling of MSC cells. *, p<0.05; **, p<0.01.

[0027] Figure 2 :The effects of bone marrow mesenchymal stem cells (MSC) on lung injury (ALI) in mice treated with hypoxia were investigated at the animal level. A. In vivo imaging of small animals was used to track the homing of MSC cells; B. The dry-wet weight ratio of mouse lungs; C. HE staining was used to detect the damage of mouse lung tissues; D. Masson staining was used to detect the damage of mouse lung tissues; E. WB was used to detect the expression of tight junction protein (Occludin) in mouse lung tissues; F. ELISA was used to detect the expression levels of TP, ALB, IL-1β, IL-6, and IL-10 proteins in mouse bronchoalveolar lavage fluid. *, p<0.05; **, p<0.01.

[0028] Figure 3 : Effects of hypoxic culture on the biological functions and paracrine effects of MSC (MSC-N represents MSC normoxia, MSC-N+LSS-CCG represents MSC normoxia + normal lung monocytes, MSC-N+LPS-ALI-LSS-CCG represents MSC normoxia + LPS lung monocytes, MSC-Hypo+LPS-ALI-LSS-CCG represents MSC hypoxia + LPS lung monocytes). A. MTT assay to detect the proliferation of normoxic and hypoxic MSC cells after co-culture with lung single cell suspension; B. Transwell assay to detect the vertical migration ability of normoxic and hypoxic MSC cells after co-culture with lung single cell suspension; C. Scratch assay to detect the horizontal migration ability of normoxic and hypoxic MSC cells after co-culture with lung single cell suspension; D. Flow cytometry assay to detect apoptosis of normoxic and hypoxic MSC cells after co-culture with lung single cell suspension; E. WB assay to detect the expression levels of AECII marker protein AQP5 and SPC protein after co-culture with lung single cell suspension; F. ELISA assay to detect the expression levels of related proteins in the supernatant after co-culture with lung single cell suspension. *, p<0.05; **, p<0.01.

[0029] Figure 4 : Animal level verification that hypoxic cultured MSCs promote the repair of ALI through the HIF-1α / Wnt / β-catenin pathway. A. Small animal in vivo imaging to track MSC cell homing; B. HE staining to detect mouse lung tissue damage; C. Masson staining to detect mouse lung tissue damage; D. Mouse lung dry-wet weight ratio; E. ELISA to detect the expression of TP, ALB, IL-1β, IL-6, and IL-10 proteins in mouse bronchoalveolar lavage fluid; F. WB to detect the expression of tight junction protein (Occludin) in mouse lung tissue. *, p<0.05; **, p<0.01.

[0030] Figure 5: Hypoxic culture of MSCs promotes the repair of ALI through the HIF-1α / Wnt / β-catenin pathway. A. WB was used to verify the interference efficiency of MSCs transfected with sh-HIF-1α; B. MTT was used to detect the cell viability of MSCs treated with LGK-974; C. WB was used to detect the expression of β-catenin protein in MSCs treated with LGK-974; D. WB was used to detect the expression of HIF-1α and β-catenin in MSCs treated with hypoxia alone or hypoxia combined with HIF-1α silencing and LGK-974; E. Flow cytometry was used to detect the labeling of MSCs with DIR. *, p<0.05: **, p<0.01.

[0031] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation to the present invention. Detailed implementation manners

[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0033] The experimental methods in the following embodiments are all conventional methods unless otherwise specified; the test materials used in the following embodiments are all obtained from commercial channels unless otherwise specified.

[0034] Related reagents and animals:

[0035] BALB / c mice, feed, and bedding were purchased from Shanghai SLAC Laboratory Animal Co., Ltd., license number: SCKK (Shanghai) 2022-0004.

[0036] LGK-974 was purchased from selleck, product number S7143

[0037] LPS lipopolysaccharide was purchased from sigma, product number L2630

[0038] sh-HIF-1α was purchased from Tsingke Biotechnology

[0039] sh-HIF-1α-1: GATCGTGGATAGCGATATGGTCAATGCTCGAGCATTGACCATATCGCTATCCATTTTTT

[0040] Extraction, normoxic / hypoxic culture, and detection of mouse bone marrow-derived MSCs:

[0041] Extraction: BALB / c mice weighing 18-22g and aged 6-8 weeks were purchased, and the femurs and tibias of the mice were taken after being killed. The mouse bone marrow-derived MSCs were isolated by the adherence method, and the cell morphology was closely observed.

[0042] Normoxic / hypoxic culture: adjust MSC density to 1x10 5 / ml and inoculated into culture dishes, and cultured in normoxic constant temperature incubator (37°C, 5% CO2, 21% O2) and hypoxic constant temperature incubator (37°C, 5% CO2, 1% or 5% O2), respectively. The culture medium was replaced every 3 days until the cell confluence reached 80% for subculture.

[0043] Detection: Transfer the cell suspension into a centrifuge tube, centrifuge at 1500rpm for 5min to collect the cells, and discard the supernatant; add 1ml of 4℃ pre-cooled PBS to completely resuspend the cells, centrifuge at 1500rpm for 5min, and discard the supernatant; add 100μL of direct-labeled antibody diluent (prepared in PBS) and stain for 30min in the dark; add 500μL of 4℃ pre-cooled PBS to completely resuspend the cells, centrifuge at 1500rpm for 5min, and discard the supernatant; shake and mix the precipitate, resuspend the cells with 200μL of 4℃ pre-cooled PBS, and mix the precipitate by pipetting; select the appropriate channel for on-machine detection according to the fluorescent dye on the antibody, and use Attune NxTSoftware to analyze the cell positivity rate and the average fluorescence intensity of the positive area.

[0044] Acute lung injury model construction:

[0045] Several BALB / c mice weighing 18-22g and aged 6-8 weeks were purchased and adapted to the laboratory for one week; the mice were randomly divided into groups and injected with PBS or LPS (5 mg / kg) via the tail vein with a sterile syringe; in accordance with the principles of animal welfare, the mice were killed after small animal imaging on the 3rd, 7th, and 14th days of the experiment, and lung tissue, alveolar lavage fluid, and serum (for backup) were collected for subsequent testing. The respiratory condition and mental state of the mice were observed during the experiment.

[0046] Preparation of lung single cell suspension

[0047] After killing the mice, the complete lungs of the mice were collected under sterile conditions, the surface blood stains were cleaned and the bronchi were removed, and the lung tissue was cut into 1 mm 2 After homogenizing for 1 min, collagenase V was added and digested in a 37°C water bath for 60 min. The cells were sieved and centrifuged at 1000 rpm for 5 min to extract the supernatant to lyse the red blood cells. The supernatant was removed by centrifugation again and PBS containing 1% BSA was added to resuspend the cells to obtain a lung single cell suspension.

[0048] Statistical analysis:

[0049] All data are expressed as mean ± standard error (Mean ± SD). Graphpad6.02 software was used for statistical analysis. The results were analyzed using t-test, and p < 0.05 was considered to be significantly different, and p < 0.01 was considered to be extremely significantly different (*, p < 0.05; **, p < 0.01).

[0050] Example 1 Effect of hypoxia treatment on mouse bone marrow mesenchymal stem cells (MSC)

[0051] Mouse bone marrow-derived MSCs were isolated by adherence method, and MSC cell surface marker CD14 was detected by flow cytometry. - 、CD34 - 、CD44 + 、CD29 + The results showed that ( Figure 1 A), the expression rate of CD29 was 98.08%, which was positive; the expression rate of CD14 was 0.00%, which was negative; the expression rate of CD44 was 99.98%, which was positive; the expression rate of CD34 was 0.09%, which was negative, confirming that the separation and extraction of MSCs was successful.

[0052] To further screen the optimal hypoxic treatment conditions for MSCs, the MSCs were treated with normoxia, 1% O2, and 5% O2 for different periods of time, and the expression of HIF-1α and β-catenin was detected by WB. The results showed that after 24 hours of treatment with 1% O2 hypoxia, the protein expression levels of HIF-1a and β-catenin were significantly upregulated ( Figure 1 B). After using DIR dye to label MSC cells, flow cytometry was used to detect the staining effect. The results showed that the proportion of DIR-labeled MSC cells was >65%, which can be used for subsequent animal experiments ( Figure 1 C).

[0053] Example 2 Effect of hypoxia-treated mouse bone marrow mesenchymal stem cells (MSC) on lung injury (ALI)

[0054] In vivo experiments were used to investigate the effects of hypoxia-cultured mouse bone marrow mesenchymal stem cells (MSC) on lung injury (ALI). First, a mouse lung injury model was established using LPS, and 6 hours later, DIR-labeled MSC cells were instilled into the airways. The effects of MSC on lung injury were observed through small animal live imaging, pathological staining, WB and ELISA experiments.

[0055] Obvious fluorescence signals can be seen in the in vivo imaging of small animals, especially in the lungs of mice, suggesting that stem cells can home to damaged lung tissues ( Figure 2A). The results of lung dry-wet weight ratio showed that compared with the control group, the dry-wet weight ratio of mice in the LPS model group was significantly lower, indicating that pulmonary edema damage occurred; as time went on, the degree of edema gradually decreased; the model group mice recovered after MSC cell airway instillation, and the recovery effect was more obvious in the low MSC group ( Figure 2 B).

[0056] HE staining results showed that compared with the control group, there was alveolar expansion after LPS modeling, indicating pulmonary edema, which was restored after MSC cell airway instillation. The most effective short-term effect was 3 days, and the recovery effect was more obvious in the low MSC group (1%) ( Figure 2 C); Masson staining results showed that the lung tissue structure of mice in the control group was clear, the alveolar wall was intact, and very few fibers were blue-stained; the lung tissue of mice in the LPS model group showed varying degrees of fibrosis, with collagen fiber deposition, continuous blue-stained areas, abnormal proliferation of fibroblasts, severe destruction of the alveolar wall structure, and thickening of the alveolar septum. After treatment with MSC cells, there was some recovery, and the recovery effect was more obvious in the hypoxia group (1%) ( Figure 2 D).

[0057] WB was used to detect the expression of tight junction protein (Occludin) in lung tissue. The results showed that compared with the control group, the expression of Occludin in the lung tissue of the model group mice was downregulated, with the most significant downregulation at 7 days and a slowing trend at 14 days. The model group mice recovered after MSC cell airway instillation, and the recovery effect was more obvious in the low MSC group, indicating that MSC can improve pulmonary edema and lung inflammation in mice after hypoxia treatment ( Figure 2 E).

[0058] ELISA was used to detect the expression of related proteins in the bronchoalveolar lavage fluid of mice. The results showed that compared with the control group, the total protein (TP) and albumin (ALB) in the bronchoalveolar lavage fluid of the mice in the LPS model group were upregulated, the pro-inflammatory factors 1β and IL-6 were upregulated, and the anti-inflammatory factor IL-10 was downregulated significantly; the mice in the model group recovered after MSC cell airway instillation, and the recovery effect of the hypoxic MSC group was more obvious ( Figure 2 F).

[0059] In conclusion, hypoxia-treated mouse bone marrow mesenchymal stem cells (MSCs) can effectively improve lung injury (ALI).

[0060] Example 3 Effects of hypoxic culture on MSC biological functions and paracrine effects

[0061] To investigate the effects of hypoxic culture on the biological functions and paracrine effects of MSCs, lung single cell suspensions were prepared from control and LPS-induced mice and co-cultured with normoxic or hypoxic MSCs for subsequent experiments.

[0062] In the experiment to explore the biological function of MSCs under hypoxia culture, the MTT test results showed that there was no significant difference in the proliferation rate of MSC cells, but the growth rate of MSC cells increased faster under hypoxia treatment than under normoxia treatment ( Figure 3 A).

[0063] In the Transwell and scratch tests of MSC cell migration ability and flow cytometry tests of apoptotic cells in the cell supernatant, the results showed that compared with the control group, the horizontal migration ability of MSC cells was enhanced after co-culture with normal lung single cell suspension, but apoptosis was upregulated. It is speculated that the upregulation of apoptosis may be caused by the influence of cell debris in the lung single cell suspension. Compared with the normal lung single cell suspension co-culture group, the MSC cell migration ability of the LPS lung single cell suspension co-culture group was inhibited, and the number of apoptotic cells increased, which recovered after low treatment ( Figure 3 B~D).

[0064] In the paracrine effect detection experiment, WB results showed that after MSC cells were treated with hypoxia, they were co-cultured with LPS lung single cell suspension for 7 days. The AECII marker protein AQP5 in MSC cells was slightly upregulated, and the SPC expression was significantly upregulated, which preliminarily indicated that after 7 days of co-culture, MSC differentiated into AECII type cells; after 14 days of co-culture, the expression of AQP5 and SPC proteins in MSC cells was significantly upregulated, indicating that long-term co-culture may induce MSC to continue to differentiate from AECII type cells to AECI type cells ( Figure 3 E).

[0065] ELISA test results showed that compared with the control group, after MSC cells were co-cultured with normal lung single cell suspension, IL-10 and ANG-1 in the MSC cell supernatant were slightly downregulated, and the downregulation was more significant in the LPS lung single cell suspension co-culture group. There was no significant change in PEG2, SOD and KGF. MSC had a certain recovery effect after hypoxia treatment ( Figure 3 F).

[0066] Example 4 Hypoxia-cultured MSCs promote the repair of ALI via the HIF-1α / Wnt / β-catenin pathway

[0067] According to the experimental groups, mice were injected with LPS in the tail vein to create a model and MSC labeled with PKH-26 fluorescent dye was instilled in the airway. Small animal imaging was performed on the 3rd, 7th and 14th days respectively. The results showed that there was no obvious fluorescence signal in the blank group and the model group mice (there were weak mixed signals), the fluorescence signal in the mice in the hypoxia-treated MSC cell instillation group was the strongest, and the fluorescence signal in the HIF-1α knockdown group and the inhibitor group mice was weak. After 3 days of instillation, the fluorescence signal was distributed throughout the mouse body, gradually concentrated in the mouse lungs on the 7th day, and mainly concentrated in the mouse lungs on the 14th day, indicating the existence of MSC cell homing phenomenon ( Figure 4 A).

[0068] In the experiment of HE and Masson staining to detect mouse lung tissue injury, HE results showed that compared with the control group, the model group had more obvious alveolar dilatation and pulmonary vascular wall thickening, indicating the occurrence of pulmonary edema; after treatment with hypoxic MSC cells, there was a significant recovery, and the recovery effect of mice in the HIF-1α knockdown group and inhibitor group was weakened ( Figure 4 B). Masson staining results showed that the lung tissue structure of mice in the control group was clear, the alveolar wall was intact, and very few fibers were stained blue; the lung tissue of mice in the LPS model group showed varying degrees of fibrosis, with collagen fiber deposition, continuous blue-stained areas, abnormal proliferation of fibroblasts, severe destruction of the alveolar wall structure, and thickening of the alveolar septum. After treatment with MSC cells, there was a certain recovery, and the recovery effect of mice in the HIF-1α knockdown group and inhibitor group was weakened. The difference between the groups was most obvious at 14 days ( Figure 4 C) The above results suggest that hypoxia culture promotes MSCs to repair ALI through the HIF-1α signaling pathway.

[0069] The results of the dry-wet weight ratio test of the mouse lungs showed that compared with the control group, the dry-wet weight ratio of the mice in the model group was significantly reduced, indicating that pulmonary edema injury occurred. The hypoxic MSC group had a recovery effect, while the recovery effect of the mice in the HIF-1α knockdown group and the inhibitor group was weakened ( Figure 4 D). The results of ELISA detection of inflammatory factors in mouse bronchoalveolar lavage fluid showed that ( Figure 4 E), compared with the control group, albumin (ALB) in the alveolar lavage fluid of mice in the LPS model group was upregulated, pro-inflammatory factors IL-1β and IL-6 were upregulated, and anti-inflammatory factor IL-10 was downregulated: the mice in the model group recovered after treatment with hypoxic MSC cells, and the recovery effect of mice in the HIF-1α knockdown group and inhibitor group was weakened; there was no significant change in total protein (TP) among the groups. WB detection of tight junction protein (Occludin) expression in lung tissue showed that compared with the control group, the expression of Occludin in the lung tissue of mice in the model group was downregulated at 14 days, and recovered after treatment with hypoxic MSC cells, and the recovery effect of mice in the HIF-1α knockdown group and inhibitor group was weakened ( Figure 4 F). The above results suggest that low culture promotes MSCs to repair ALI through the HIF-1α / Wnt / β-catenin pathway.

[0070] Example 5: Interference efficiency of MSC cells transfected with sh-HIF-1α and its effect on the HIF-1α / Wnt / β-catenin pathway

[0071] After immortalized MSC cells were transfected with sh-HIF-1α, the interference efficiency of sh-HIF-1α in MSC cells was verified by WB. The results showed that the knockdown effect of sh-HIF-1a-3 was stable ( Figure 5A). Then, MTT was used to detect the effect of LGK-974 (Wnt / β-catenin inhibitor) on MSC cell activity. The results showed that LGK-974 treatment could inhibit cell activity, with an IC50 of 77.10 μM at 24h and 47.93 μM at 48h. Figure 5 B).

[0072] After MSC cells were treated with LGK-974 at IC50 and 1 / 2IC50 doses, the expression of β-catenin protein in MSC cells was detected by WB. The results showed that after MSC cells were treated with 39μM LGK-974 for 24h, the expression of β-catenin was significantly downregulated. Figure 5 C).

[0073] After MSC cells were treated with hypoxia alone or hypoxia combined with HIF-1α silencing and LGK-974, the expression of HIF-1α and β-catenin was detected by WB. The results showed that compared with the normoxic control group, the expression of HIF-1a in the hypoxia group was significantly upregulated, while that in the HIF-1a knockdown group and the inhibitor group was downregulated, confirming that hypoxia can affect the HIF-1α / Wnt / β-catenin pathway in MSC cells ( Figure 5 D). The MSC cells treated as above were collected for DIR labeling, and then the staining effect was detected by flow cytometry. The cells successfully labeled with DIR were used for subsequent animal experiments. The results showed that the positive rate of the four groups of cells was about 85%, which confirmed that the labeling was effective and could be used for animal experiments after labeling. Figure 5 E).

[0074] Example 6 Screening for Potential Drugs for the Treatment of Acute Lung Injury

[0075] Referring to the method of treating MSCs with sh-HIF-1α and LGK-974, the candidate drug was used to treat MSCs. The expression of HIF-1α and β-catenin proteins in MSC cells was detected by WB at a safe dose. If the expression of HIF-1α and β-catenin was significantly downregulated after treatment with the candidate drug, the candidate drug should not be considered for ALI treatment; if the expression of HIF-1α and β-catenin was significantly upregulated after treatment with the candidate drug, the candidate drug should be considered for ALI treatment.

[0076] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only and are not intended to limit the content of this application.

Claims

1. A method for screening potential drugs for treating acute lung injury, comprising: After treating mesenchymal stem cells MSC cells with candidate drugs at a safe dose, the effect of the candidate drugs on the HIF-1a / Wnt / β-catenin signaling pathway of MSC cells was examined, and the candidate drugs were excluded or identified as potential drugs for the treatment of acute lung injury ALI based on the impact.

2. The method for screening potential drugs for treating acute lung injury according to claim 1, characterized in that: The effect of the candidate drug on the HIF-1a / Wnt / β-catenin signaling pathway of MSC cells is investigated, and the effect is the upregulation or downregulation of HIF-1a and / or β-catenin protein expression in MSC cells.

3. A method for screening potential drugs for treating acute lung injury according to claim 2, characterized in that: After treatment with the candidate drug, if the expression of HIF-1α and / or β-catenin protein is downregulated, it is an excluded candidate drug; if the expression of HIF-1α and / or β-catenin protein is upregulated after treatment with the candidate drug, the candidate drug is determined as a potential drug for the treatment of ALI.

4. A method for screening potential drugs for treating acute lung injury according to any one of claims 1 to 3, characterized in that: The candidate drug is a small molecule compound, a macromolecular drug or a gene drug.

5. The method for screening potential drugs for treating acute lung injury according to any one of claims 1 to 3, characterized in that: The treatment involves co-culturing the candidate drug at a safe dose with MSC cells.

6. The method for screening potential drugs for treating acute lung injury according to any one of claims 1 to 3, characterized in that: The MSC cells are bone marrow mesenchymal stem cells.

7. A method for screening potential drugs for treating acute lung injury according to any one of claims 1 to 3, characterized in that: The MSC cells are treated with hypoxia, and the hypoxic condition is preferably 1% O2 or 5% O2.

8. The method for screening potential drugs for treating acute lung injury according to any one of claims 1 to 3, characterized in that: The potential drugs for ALI treatment can upregulate HIF-1α or β-catenin expression.

9. The method for screening potential drugs for treating acute lung injury according to any one of claims 1 to 3, characterized in that: The excluded candidate drugs are HIF-1α inhibitors and Wnt / β-catenin inhibitors.

10. A method for improving the therapeutic effect of MSC cells on ALI, characterized in that: The MSC cells are treated with hypoxia to increase the expression of HIF-1α or β-catenin in the HIF-1α / Wnt / β-catenin signaling pathway to improve the ability to repair ALI, and the hypoxic condition is selected from 1% O2 or 5% O2.

Images