Oligonucleotides

Abstract

The present invention relates to a splice conversion oligonucleotide (SSO) capable of altering the splice of a precursor mRNA encoding a variant of the SLC25A13 gene, and the use of the SSO for the treatment of Hiltein deficiency disease. In one embodiment, the SSO binds to a site within a target region present on a precursor mRNA transcript of the SLC25A13 gene, where the binding of the SSO induces exclusion of SLC25A13-PE5 from a mature mRNA transcript of the SLC25A13 gene. In another embodiment, the target region has at least 95% sequence identity to SEQ ID NO: 28.

Description

Technical Field

[0001] The present invention generally relates to the field of RNA splicing. In particular, the present invention relates to splice switching oligonucleotides (SSOs) that are capable of altering the splicing of pre-mRNA encoding variants of the SLC25A13 gene. The present invention also relates to the use of an SSO as a therapeutic candidate for treating Hittling deficiency. Background Art

[0002] Citrin deficiency is an autosomal recessive urea cycle metabolic disorder caused by pathogenic variants in the SLC25A13 gene encoding the citrin protein, a mitochondrial aspartate-glutamate carrier. The condition can present as neonatal intrahepatic cholestasis of infancy (NICCD) and type II citrullinemia (CTLN2), which is characterized by adult-onset recurrent hyperammonemia with altered mental status and poor response to conventional hyperammonemia therapy. NICCD can often be self-limited and is followed by a relatively symptom-free period in childhood. During the so-called "asymptomatic period," some patients with citrin deficiency may suffer from recurrent hypoglycemia, difficulty eating, or growth restriction. Prior to the onset of CTLN2, affected individuals often have a distinctive eating pattern (preferring high-fat / protein foods and avoiding high-carbohydrate meals) and are generally thin. Identifying individuals at risk during this period is challenging because there are no specific clinical findings or biochemical markers to address disease development. Undiagnosed individuals are at risk for significant growth restriction, hypoglycemia, and life-threatening episodes of hyperammonemia. Therefore, timely diagnosis of Citrin deficiency and development of effective treatments are critical. The detailed mechanisms of the disease remain unclear.

[0003] Currently, the only available treatment for Citrin deficiency is dietary modification with a high protein / fat diet and in some cases the addition of medium chain triglycerides to the diet. In addition, the intake of high carbohydrate diets and alcohol is discouraged because these may cause metabolic decompensation (including hyperammonemia), which may lead to neurological damage. However, while dietary modification can be used to control the symptoms of Citrin deficiency, it cannot cure the underlying genetic cause of the disease. Recent studies have shown that the carrier frequency of Citrin deficiency is relatively high (approximately 1 / 30-40), especially in East Asian countries such as Singapore or Japan. So far, there is no effective treatment for Citrin deficiency except liver transplantation. However, liver transplantation is a major surgery with risks of medical complications such as bleeding and infection. Liver transplantation also carries risks such as immune exclusion, biliary complications, transplant liver failure and the need for lifelong immunosuppressive agents. Therefore, new therapeutic strategies are needed to correct the potential pathogenic genetic variants of the SLC25A13 gene and overcome the shortcomings of the prior art. In addition, in conjunction with the accompanying drawings and the background of the present disclosure, other desired features and characteristics will become apparent from the subsequent detailed description and the appended claims. Summary of the invention

[0004] In one aspect, a method for exon skipping is provided, the method comprising providing a splice switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a SLC25A13 gene, wherein the binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0005] In one embodiment, the target region has at least 95% sequence identity to SEQ ID NO:28.

[0006] In one embodiment, SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0007] In one embodiment, a method as described herein comprises providing a SSO having a binding site located within SLC25A13-PE5.

[0008] In one embodiment, a method as described herein comprises providing a SSO having a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5.

[0009] In one embodiment, a method as described herein comprises providing a SSO having a binding site that overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlaps with the donor splice site of SLC25A13-PE5.

[0010] In one embodiment, the method as described herein comprises providing a SSO having a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 12.

[0011] In one embodiment, the method as described herein comprises providing a SSO having a sequence selected from the group consisting of SEQ ID NO 13 to SEQ ID NO 27.

[0012] In one aspect, a splice switching oligonucleotide (SSO) is provided, wherein the SSO binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity with SEQ ID NO:28, and wherein binding of the SSO induces exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0013] In one embodiment, a SSO as described herein has a binding site located within SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0014] In one embodiment, the SSO as described herein has a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0015] In one embodiment, the SSO as described herein has a binding site that overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlaps with the donor splice site of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0016] In one embodiment, the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 12.

[0017] In one embodiment, the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NO 13 to SEQ ID NO 27.

[0018] In one aspect, there is provided a SSO as described herein for use in treating Citrin deficiency.

[0019] In one aspect, there is provided a use of a SSO as described herein for the manufacture of a medicament for treating Citrin deficiency.

[0020] In one aspect, a method of treating Citrin deficiency is provided, the method comprising administering to a subject a composition comprising a SSO as described herein.

[0021] In one embodiment, a SSO as described herein is between 15 and 40 nucleotides in length.

[0022] In one embodiment, at least one of the nucleotides of the SSO is chemically modified, and the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, a locked nucleic acid substitution, or a phosphorothioate linkage.

[0023] In one embodiment, a SSO as described herein comprises phosphorothioate linkages between all nucleotides of said SSO.

[0024] In one embodiment, each nucleotide of a SSO as described herein comprises a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a locked nucleic acid substitution.

[0025] In one aspect, a pharmaceutical composition is provided, comprising (a) a therapeutically effective amount of a SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order that the invention may be fully understood and readily put into practical effect, preferred embodiments of the invention will now be described, by way of non-limiting example only, with reference to the accompanying illustrative drawings.

[0027] In the diagram:

[0028] Figure 1Schematic diagram of a minigene system with a specific genomic mutation c.469-2922G>T of the SLC25A13 gene (Accession No. NM_001160210.2). The minigene includes the complete sequence of exon 5, the first 2,000 bases of intron 5 (from the exon 5 donor splice site) and the last 4,923 bases (or 4,923 bases before the exon 6 acceptor site), and the complete sequence of exon 6. The relative loci with the G to T substitution are delineated in the figure.

[0029] Figure 2 Shown is the generation of SLC25A13-PE5 (reference NM_001160210.2, c.469-2909 to c.469-2825) recapitulated by CRISPR knock-in and minigene. Figure 2 A is a gel electrophoresis image of PCR products from mRNA extracted from hepatocytes differentiated from human embryonic stem cells (i.e., induced hepatocytes or iHep) with CRISPR knock-in containing the c.469-2922G>T mutation. HET is a heterozygous clone, and HOM1 and HOM2 are two separate homozygous clones containing the c.469-2922G>T mutation. CAPN10 serves as a loading control. The data show that CRISPR knock-in of the c.469-2922G>T mutation recapitulates the retention of the pseudoexon SLC25A13-PE5 in the endogenous SLC25A13 mature mRNA. Figure 2 B is an immunoblot image confirming that the loss of full-length citrin in mutant iHep is due to the incorporation of SLC25A13-PE5 into the SLC25A13 mature transcript. Figure 2 C is a graph indicating the potential loss of urea formation, and Figure 2 D is a graph showing the loss of ammonia scavenging ability in mutant iHep. Figure 2 E is a graph showing that the hepatocyte differentiation markers ALB and ASGR1 were not significantly different in iHep with wild-type or mutated (heterozygous or homozygous for c.469-2922G>T) SLC25A13, indicating that loss of citrin does not affect hepatocyte differentiation and that the loss of ureagenetic potential and ammonia scavenging ability is not attributable to differences in hepatocyte differentiation. Figure 2F is a gel electrophoresis image showing PCR products from three cell lines (HEK293T, Huh7, and HepG2) transfected with pCIT2 (WT minigene construct) or pCIT2mut (mutant minigene construct). Minigenes containing the same mutations recapitulate the retention of the pseudoexon SLC25A13-PE5 in mature messenger RNA (mRNA). All three cell lines show correct splicing of exon 5 to exon 6 when transfected with pCIT2, and all three cell lines show incorporation of the 85 bp pseudoexon when transfected with pCIT2mut. Figure 2 G is sample sequencing data showing incorporation of the pseudoexon SLC25A13-PE5 into mature mRNA from cells transfected with pCIT2mut.

[0030] Figure 3 is a capillary electrophoresis image from a SSO screen against SLC25A13-PE. Huh7 was co-transfected with 500ng pCIT2mut and 25nM SSO, after which PCR was performed on complementary DNA (cDNA) generated from RNA extracted from transfected cells. The data revealed the efficacy of SSO in mediating splicing exclusion of SLC25A13-PE5. Each ribose moiety in SSO is modified with a 2'-O-methyl group attached via a phosphorothioate (PS) backbone.

[0031] Figure 4 Is displayed from Figure 3 Figure 3 shows the SSO concentration response curves of selected SSOs screened in . Huh7 was co-transfected with 500ng pCIT2mut and the indicated amount of SSO, after which PCR was performed on cDNA generated from RNA extracted from transfected cells. Capillary electrophoresis was used on the PCR products to quantify the amount of products with pseudo exons and products without pseudo exons. Efficacy is reflected as the percentage of PCR products without pseudo exons to the total PCR products (splicing corrected %).

[0032] Figure 5 Results of screening of shortened sequences and hybrids are shown. Figure 5 A is a graph showing the splicing correction efficacy of SSOs 2032, 2033, and 2034 modified with 2'O-methyl (2OM) or 2'-O-methoxyethyl (2MOE), all shortened from SSO 2008, when Huh7 cells stably expressing mutant minigenes were treated at 200 nM by free uptake in calcium-rich medium (CEM). SSO 2008 served as a positive control. Figure 5B is a diagram showing the screening of a mixture of sequences derived from No. 2034 when transfected at 10 nM into HepG2 stably expressing a mutant minigene. In two sets of experiments, PCR was performed on cDNA generated from RNA extracted from transfected cells. Capillary electrophoresis was used to quantify the amount of products with pseudo exons and products without pseudo exons for PCR products. Efficacy is reflected as the percentage of PCR products without pseudo exons to the total amount of PCR products (splicing correction %). Each ribose moiety in the mixture is modified by 2'-O-methyl or 2'-O-methoxyethyl substituted by locked nucleic acids (2OML or 2MOL, respectively), and the locked nucleic acids are connected via a phosphorothioate backbone.

[0033] Figure 6 The results show that the free uptake of Figure 5 Screening results for the shortened hybrid used in . Figure 6 A is a graph showing screening of the hybrid by free uptake under CEM on Huh7 or HepG2 cells stably expressing mutant minigenes when treated with 20 nM or 200 nM SSO, respectively. The use of CEM stimulates cellular uptake in vitro and better reflects in vivo efficacy when compared to transfection. The data show that in the absence of transfection agents, the shortened hybrid is able to modulate outward splicing of SLC25A13-PE5. Figure 6 B is a graph showing free uptake dose-response curves for selected SSOs, revealing SSOs with EC in the nanomolar range. 50 The good efficacy of 2034.5 and 2034.15 in Huh7 cells stably expressing mutant minigenes. 50 It is about 10 times lower than their parental SSO (No. 2008) and the single 2'-O-methyl modified No. 2034. Figure 6C is a graph of an MTT assay in which Huh7 cells stably expressing a mutant minigene were treated with different concentrations of SSO by free uptake under CEM for 72 hours; the SSOs with a "C" prefix are additional negative controls whose sequences are the full complement of chemical modifications identical to the corresponding SSO leader No. 2034. Since each SSO with a "C" prefix was chemically modified in a precise pattern to its corresponding hybrid, it served as a negative control in the case of chemical modification. The data indicate that there is no toxicity caused by the sequence and chemical combination. LNA32 with the sequence EAAaggaaacacaEAT (SEQ ID NO: 46) and LNA41 with the sequence EAEattccttgctETG (SEQ ID NO: 47) are gapmers with intact PS backbone bonds, containing natural DNA bases (in lower case) flanked by three LNAs (in upper case) on both ends, which have previously been shown to be correspondingly non-toxic and acutely hepatotoxic in vivo in mouse studies. Therefore, LNA32 served as a negative control, and LNA41 served as a positive control.In SEQ ID NO 46 and SEQ ID NO 47, capital letters represent LNA, lowercase letters represent DNA, and "E" represents 5-methylcytosine.

[0034] Figure 7 Results are shown for asialoglycoprotein receptor-mediated functional uptake of SSOs in iHep homozygous for SLC25A13-PE5 (in the absence of CEM and transfection agent) with 4 μM GalNAc*3 (GN*3) conjugated non-targeting control (NC2 g1.1), 2034.5 (2034.5g1.1), or 2034.15 (2034.15g1.1) in 2'-O-methyl+LNA (2OML) or 2'-O-methoxyethyl+LNA (2MOL) chemical combinations. Three GalNAc molecules GN*3 are chemically bonded to the 5' of each SSO in a trivalent configuration, which allows receptor-mediated uptake of SSOs by asialoglycoprotein receptors (ASGR1 / 2) specifically expressed on hepatocytes ( Figure 2 E). Figure 7 A reveals that GalNAc-conjugated SSOs 2034.5 and 2034.15, but not NC2, can regulate the outward splicing of SLC25A13-PE5 from endogenous SLC25A13 transcripts. Figure 7B shows the expression of total SLC25A13 transcripts in mutant iHep, reflected as relative expression after normalization to WT iHep treated with corresponding NC2g1.1 non-targeting control (2OM for 2OML SSO, or 2MOE for 2MOL SSO). The data indicate that splicing correction by GalNAc-conjugated SSO rescues SLC25A13 transcript levels that were reduced due to nonsense-mediated decay in mutant iHep. Figure 7 C shows the rescue of urea production, while Figure 7 D highlights the rescue of ammonia scavenging when mutant iHep was treated with GalNAc-conjugated SSO. Data shown are for mutant iHep normalized to WT iHep treated with the corresponding NC2g1.1 non-targeting control. Figure 7 E is a graph of the expression of acute toxicity markers CDKN1A, BAX, and PUMA in mutant iHep treated with SSO, shown relative to WT iHep treated with NC2g1.1. The data suggest that there is no acute toxicity in the treated mutant iHep, where the expression of acute toxicity markers CDKN1A, BAX, and PUMA is not significantly increased when compared to WT iHep treated with NC2g1.1. Figure 7 F shows an immunoblot image where the expression of full-length Hitrin protein was rescued in iHep homozygous for SLC25A13-PE5 (HOM1) treated with GalNAc-conjugated 2034.15 2OML (GN*3-2034.15 2OML). This will be confirmed with functional data showing rescue in functional assays ( Figure 7 C and Figure 7 D) may be due to rescue of protein levels and hence protein activity. DETAILED DESCRIPTION

[0035] In one aspect of the present invention, a method for exon skipping is provided, the method comprising providing a splice switching oligonucleotide (SSO), which binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, wherein the binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0036] "Oligonucleotide" is intended to refer to any polynucleotide. "Polynucleotide" is an oligomer composed of nucleotides. A polynucleotide can be composed of DNA, RNA modified forms thereof, or a combination thereof. The term "nucleotide" or its plural form as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art. In some cases, the art uses the term "nucleobase", which encompasses naturally occurring nucleotides and modifications of nucleotides that can be polymerized. Thus, nucleotide or nucleobase means the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturally occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanolcytosine, N',N'-ethanol-2,6-diaminopurine, 5-methylcytosine (mC), 5-(C[3]-C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, inosine and Benner et al., U.S. Pat. No. 5,432,272 and Susan M. Freier and Karl-Heinz Altmann, 1997, Nucleic Acids "Non-naturally occurring" nucleobases described in SEQ ID NO: 11-13. Research, Vol. 25: pp. 4429-4443. The term "nucleobase" also includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogs and tautomers thereof. Other naturally occurring nucleobases and non-naturally occurring nucleobases include those disclosed in U.S. Pat. No. 3,687,808 to Sanghvi (Merigan et al.), Chapter 15, in Antisense Research and Application, ed. S.T. Crooke and B. Lebleu, CRC Press, 1993, Englisch et al., 1991, Angewandte Chemie, International Edition, 30: 613-722 (see especially pages 622 and 623, and in Concise Encyclopedia of Polymer Science and Engineering, ed. J.I. Kroschwitz, John Wiley & Sons, 1990, pages 858-859, Cook, Anti-Cancer Drug Design 1991, 6, 585-607, each of which is hereby incorporated by reference in its entirety).In various embodiments, polynucleotides also include one or more "nucleoside bases" or "base units", which include compounds that can function like nucleoside bases, such as heterocyclic compounds, including certain "universal bases" that are not nucleoside bases in the most classical sense but serve as nucleoside bases. Universal bases include 3-nitropyrrole, optionally substituted indole {e.g., 5-nitroindole) and optionally substituted hypoxanthine. Other desired universal bases include pyrrole and diazole or triazole derivatives, including those universal bases known in the art.

[0037] Polynucleotides can also include modified nucleobases. "Modified bases" are understood in the art to be bases that can be paired with natural bases (e.g., adenine, guanine, cytosine, uracil and / or thymine) and / or can be paired with non-natural bases. Exemplary modified bases are described in EP 1 072 679 and WO 97 / 12896, the disclosures of which are incorporated herein by reference. Modified nucleobases include, but are not limited to, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Other modified bases include tricyclic pyrimidines, such as phenoxazine cytidine (1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one); G-clamps, such as substituted phenoxazine cytidines (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Additional nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, Kroschwitz, JI, ed., John Wiley & Sons, 1990, Englisch et al., 1991, Angewandte Chemie, International Edition, 30:613, and those disclosed in Sanghvi, YS, Chapter 15, Antisense Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., eds., CRC Press, 1993. Certain of these bases can be used to increase the binding affinity of polynucleotides, and include 5-substituted pyrimidines, 6-azapyrimidines, and N-2 substituted purines, N-6 substituted purines, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 degrees, and in certain embodiments, in combination with 2'-O-methoxyethyl sugar modifications. See U.S. Patent No. 3,687,808; U.S. Patent No. 4,845,205; No. 5,130,302; No. 5,134,066; No. 5,175,273; No. 5,367,066; No. 5,432,272; No. 5,457,187; No. 5,459,255; No. 5,484,908; No. 5,502,177; No. 5,525,711 No. 5,552,540; No. 5,587,469; No. 5,594,121; No. 5,596,091; No. 5,614,617; No. 5,645,985; No. 5,830,653; No. 5,763,588; No. 6,005,096; No. 5,750,692 and No. 5,681,941, the disclosures of which are incorporated herein by reference.

[0038] As used herein, the term "splicing switching oligonucleotide" (SSO) or "splicing switching oligomer" is intended to include synthetic antisense nucleic acids that base pair with pre-mRNA and disrupt the splicing process by spatially blocking the RNA-RNA base pairing or protein-RNA binding interactions that occur between components of the splicing machinery and pre-mRNA. SSOs may also be referred to as "antisense nucleotides," "steric blockers," or "sterically hindered antisense nucleotides" that can regulate splicing. SSOs can regulate splicing via steric blocking. In some embodiments, SSOs may be hybrids. The term "hybrid" includes oligomers that have different types of chemical modifications applied to their sugar moieties or to their backbone bonds or to both. Examples of chemical modifications include phosphorothioate bonding, 2'-O-methyl RNA modification, 2'-O-methoxyethyl RNA modification, and locked nucleic acid substitution. The terms "phosphorothioate bonding" and "phosphorothioate bonding" are used interchangeably. Chemical modifications can improve the efficacy, selectivity, and stability of SSOs while exhibiting the excellent toxicity characteristics of SSOs.

[0039] The term "splicing" refers to the RNA processing mechanism that makes a pre-mRNA into a mature mRNA. During splicing, introns are removed and exons are connected. Splicing is catalyzed by the spliceosome complex. As used herein, the term "alternative splicing" is intended to include the process by which a gene can encode a variety of mRNA and protein products by differentially selecting which exons will be included in the mature mRNA transcript. For example, alternative splicing can take the form of one or more skipped exons, variable positions of intron splicing, or intron retention.

[0040] As used herein, the term "intron" refers to a segment of non-coding nucleic acid sequence that is transcribed and present in the pre-mRNA but is excised by the splicing mechanism and is therefore not present in the mature mRNA transcript.

[0041] As used herein, the term "exon" refers to a segment of a nucleic acid sequence that is transcribed into mRNA and present in the mature mRNA after splicing. The term "exon skipping" is intended to include the process of removing an entire exon or a portion thereof from a given pre-mRNA and thereby excluding it from being present in the mature mRNA. For example, a portion of a protein encoded by an otherwise skipped exon is not present in the expressed form of the protein.

[0042] In one embodiment, the target region has at least 95% sequence identity to SEQ ID NO: 28. In various embodiments, the target region may include a variant sequence of SEQ ID NO: 28. The target region may comprise, consist of, consist essentially of, or consist essentially of a sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0043] As used herein, the term "splice site" is intended to include a specific nucleic acid sequence that can be identified by the splicing mechanism as being suitable for excision and / or engaging with the corresponding splice site. Splice site defines an accurate exon-intron boundary, which allows excision of the intron present in the pre-mRNA transcript. As used herein, the term "5' splice site" (also referred to as the donor splice site) refers to the nucleic acid sequence around the exon-intron boundary at the 5' end of an intron, which marks the beginning of an intron and the boundary between it and the exon sequence in the front. As used herein, the term "3' splice site" (also referred to as the acceptor splice site) refers to the nucleic acid sequence around the intron-exon boundary at the 3' end of an intron, which marks the end of an intron and the boundary between it and the exon sequence in the back.

[0044] As used herein, the term "pre-mRNA (pre-mRNA / precursor mRNA)" refers to a messenger ribonucleic acid (mRNA) chain synthesized from a DNA template by transcription. Pre-mRNA consists of exons, introns, and non-translated sequences (before the first exon and after the last exon, respectively). Typically, eukaryotic pre-mRNA only exists briefly before it is fully processed into mature mRNA.

[0045] The term "binding" used in the context of an SSO is intended to include hybridization of an SSO to a site within a target region on a pre-mRNA transcript. The term "hybridize" or "hybridization" may include the binding of a local single-stranded region of a single-stranded nucleic acid or a double-stranded nucleic acid to another single-stranded nucleic acid or a local single-stranded region of a double-stranded nucleic acid having a complementary sequence through pairing of complementary nucleic acids. It is generally known to those skilled in the art that binding or hybridization of one sequence to another sequence does not require complete complementarity of the sequences. For example, the sequence of an SSO may be completely complementary or partially complementary to the target region to which it binds.

[0046] The term "site" refers to a position that is substantially or completely complementary to an SSO. An SSO can bind to this site. In the case of a "site within a target region on a pre-mRNA transcript", the site is located within the target region, and the target region forms part of the pre-mRNA transcript.

[0047] "Variant" in the relevant gene is intended to include any variation or change in the sequence of the gene so that the sequence is different from the sequence that exists naturally or in most people. Similarly, "non-variant" can include any sequence of a gene that can be considered as "wild type", that is, a sequence that is considered normal or typical for the gene. Therefore, the "variant" of a gene means any one or more changes, i.e., substitution, duplication, inversion, insertion and / or deletion, at one or more (several) positions of the polynucleotide of the gene. Substitution can include replacing one or more nucleotides occupying a position with one or more different nucleotides; deletion means removing one or more nucleotides occupying a position; and insertion means adding one or more nucleotides adjacent to the nucleotide occupying a position. The term "variant" can also refer to any variation or change in the sequence of a gene that causes wild-type protein expression and / or loss of function or gain of function.

[0048] In one embodiment, the pre-mRNA transcript of the SLC25A13 gene is a pre-mRNA transcript of a variant of the SLC25A13 gene. The variant of the SLC25A13 gene may comprise a c.469-2922G>T mutation. In one embodiment, the binding site of the SSO as described herein is present in

[0049] The cDNA sequence encoding SEQ ID NO: 28 is

[0050] It will generally be understood that, given SEQ ID NO:44, one skilled in the art will know how to derive the RNA sequence of the target region (i.e., SEQ ID NO:28). SEQ ID NO:28 comprises the sequence of SLC25A13-PE5 (SEQ ID NO:29) and the sequence of the partial intron flanking SLC25A13-PE5. The sequence of the partial intron flanking SLC25A13-PE5 includes the acceptor splice site and the donor splice site of SLC25A13-PE5. The c.469-2922G>T mutation in SEQ ID NO:44 and the corresponding G>U mutation in SEQ ID NO:28 are shown in bold and underlined above. In one embodiment, the binding site of SSO may overlap with the SLC25A13-PE5 acceptor splice site and overlap with SLC25A13-PE5 or a portion of SLC25A13-PE5. In another embodiment, the entire binding site of SSO may be located within SLC25A13-PE5. In yet another embodiment, the binding site of the SSO may overlap with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlap with the SLC25A13-PE5 donor splice site.

[0051] In one embodiment, SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0052] The term "pseudo-exon" refers to a potential exon containing enough 5' and 3' splice sites, which is usually not spliced ​​into mature mRNA by the splicing mechanism. Pseudo-exons are included in mature mRNA, for example, due to mutations that produce / activate or eliminate / reduce splicing motifs or splicing sites, or splicing mechanism disorders caused by the absence or excessive production of one or more components of the spliceosome complex or specific RNA binding proteins that act as splicing enhancers or splicing silencers, which may cause the codon reading frame, the shift of premature stop codons in the frame, or the addition of new amino acid residues, thereby resulting in protein expression / functional loss. For the sake of clarity, the genetic mutation that affects the generation of pseudo-exons does not need to be present in pseudo-exons.

[0053] In one embodiment, the term "pseudoexon" as used herein refers to SLC25A13-PE5 having the RNA sequence 5'-AAUACUUUUCACUGAUGAGAAUGCCUGUCAUUUAUUGAGCACCUACUAUACAUCU AAAGCAUUCUGCUGAGCUGCAUGUAUAAAU-3' (SEQ ID NO: 29). The cDNA sequence encoding SLC25A13-PE5 is 5'-AATACTTTTCACTGATGAGAATGCCTGTCATTTATTGAGCACCTACTATACATCTAA AGCATTCTGCTGAGCTGCATGTATAAAT-3' (SEQ ID NO: 45). It is generally understood that given SEQ ID NO: 45, one skilled in the art will know how to derive the RNA sequence of SLC25A13-PE5 (i.e., SEQ ID NO: 29). The terms "SLC25A13-PE5", "SLC25A13-PE", "PE" and "exon 5*" can be used interchangeably.

[0054] In one embodiment, a method as described herein comprises providing a SSO having a binding site located within SLC25A13-PE5.

[0055] In one embodiment, a method as described herein comprises providing a SSO having a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5.

[0056] In one embodiment, a method as described herein comprises providing a SSO having a binding site that overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlaps with the donor splice site of SLC25A13-PE5.

[0057] In various embodiments, the methods as described herein comprise providing a SSO having a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 12.

[0058] In various embodiments, the methods as described herein comprise providing a SSO having a sequence selected from the group consisting of SEQ ID NO 13 to SEQ ID NO 27.

[0059] In one aspect of the present invention, a splice switching oligonucleotide (SSO) is provided, which binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity with SEQ ID NO:28, and wherein binding of the SSO induces exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0060] In various embodiments, the SSO has a binding site located within SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0061] In various embodiments, the SSO has a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0062] In various embodiments, the SSO has a binding site that overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlaps with the donor splice site of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:29.

[0063] In various embodiments, the SSO of the present invention comprises a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 12. In various embodiments, the SSO comprises a sequence selected from the group consisting of SEQ ID NO 13 to SEQ ID NO 27. The length of the SSO may be between 15 nucleotides and 40 nucleotides.

[0064] In addition to c.469-2922G>T, other mutations may be able to cause the generation of SLC25A13-PE5. Examples of other mutations that can cause the generation of SLC25A13-PE5 include c.469-2922G>C, c.469-2922G>A, c.469-2923A>T, c.469-2923A>G, c.469-2923A>C, c.469-2923_469-2920del, c.469-2922_469-2921del, c.469-2923_469-2921del, c.469-2924_469-2921del, c.469-2922del, c.469-2923_469-2922del, c.469-2924_469-2922del, c.469-2924_469-2921del, c.469-2923_469-2922insT, c.469-2923_469-2922insC, c.469-2923del, c.469-2924_469-2923del, and c.469-2925_469-2923del. It is generally understood by those skilled in the art that the binding or hybridization of one sequence to another sequence does not require complete complementarity of the sequences. Therefore, SSOs having sequences that are not completely complementary to the target region having SEQ ID NO: 28 are also able to bind to the target region. For example, a protein selected from the group consisting of c.469-2922G>C, c.469-2922G>A, c.469-2923A>T, c.469-2923A>G, c.469-2923A>C, c.469-2923_469-2920del, c.469-2922_469-2921del, c.469-2923_469-2921del, c.469-2924_469-2921del, c.469-2922del, c.469-2923_469-2920del, c.469-2922_469-2921del, c.469-2923_469-2921del, c.469-2924_469-2921del, c.469-2924_469-2924del, c.469-2924_469-2924del, c.469-2924_469-2924 The SSO complementary to the pre-mRNA produced by the mutations in the group consisting of 469-2922del, c.469-2924_469-2922del, c.469-2924_469-2921del, c.469-2923_469-2922insT, c.469-2923_469-2922insC, c.469-2923del, c.469-2924_469-2923del and c.469-2925_469-2923del can also bind to SEQ ID NO: 28.

[0065] Advantageously, due to the favorable binding thermodynamics and extent of the co-transcriptional local single-stranded binding sites on the identified target region, the SSOs of embodiments of the present invention are able to competitively bind to the corresponding binding sites on the target region. The selection of the target region involves considering the presence of RNA binding protein motifs on the target region. The SSOs of embodiments of the present invention are able to induce the desired splicing regulation by competitively binding to the target site, which encompasses or overlaps the sequence motifs used by the appropriate RNA binding protein, snRNP (small nuclear ribonucleoprotein), or both. Advantageously, the shortened SSO has reduced propensity for immune response and can have excellent uptake kinetics by cells, such as Figure 6 as shown in .

[0066] In various embodiments, at least one of the nucleotides of the SSO is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, a locked nucleic acid substitution, or a phosphorothioate linkage. The term "locked nucleic acid" (LNA) generally refers to a modified RNA nucleotide in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom.

[0067] It is contemplated that modified polynucleotides are used, wherein one or more sugars and / or one or more internucleotide bonds of the nucleotide units in the polynucleotides are replaced by "non-naturally occurring" sugars (i.e., sugars other than ribose or deoxyribose) or internucleotide bonds, respectively. In one embodiment, this embodiment encompasses peptide nucleic acids (PNAs). In PNA compounds, the sugar-backbone of the polynucleotide is replaced by an amide-containing (e.g., peptide bonds between N-(2-aminoethyl)-glycine units) backbone. See, for example, U.S. Patent No. 5,539,082; No. 5,714,331; and No. 5,719,262; and Nielsen et al., Science, 1991, 254, 1497-1500, the disclosures of which are incorporated herein by reference. The modified polynucleotides may also contain one or more substituted sugar groups. In one embodiment, the modification of sugars includes locked nucleic acids (LNAs), wherein a 2'-hydroxyl group is connected to a 3' or 4' carbon atom of a sugar ring, thereby forming a bicyclic sugar group. In certain embodiments, the bond is a methylene group (—CH [2] -) [n]Group, wherein n is 1 or 2. LNA and its preparation are described in WO 98 / 39352 and WO 99 / 14226, the disclosures of which are incorporated herein by reference. In the present invention, preferably, the antisense oligonucleotide comprises a modified polynucleotide backbone. The modified polynucleotide backbone may comprise a modified portion of a sugar that replaces at least one polynucleotide in the polynucleotide. The modified portion may be selected from the group consisting of a phosphorodiamidate morpholino oligomer (PMO), a peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO) and a non-peptide dendritic octaguanidine moiety labeled morpholino oligomer.

[0068] In various embodiments, the modified polynucleotide backbone comprises at least one modified internucleotide bond.The modified internucleotide bond comprises a modified phosphate.More preferably, the modified phosphate is any one of the groups consisting of a non-bridging oxygen atom, a phosphonate, a thiophosphate, a phosphodiester, a morpholine phosphate, a piperazine phosphate and an aminophosphorothioate ester selected from the group consisting of a sulphur atom.

[0069] In various embodiments of the invention, the SSO comprises a backbone selected from the group consisting of ribonucleic acids, deoxyribonucleic acids, DNA phosphorothioates, RNA phosphorothioates, 2'-O-methyl-oligoribonucleotides and 2'-O-methyl-oligodeoxyribonucleotides, 2'-O-alkyl ribonucleic acids, 2'-O-alkyl DNA, 2'-O-alkyl RNA phosphorothioates, 2'-O-alkyl DNA phosphorothioates, 2'-F-phosphothioates, 2'-F-phosphodiesters, 2'-methoxyethyl phosphorothioates, 2-methoxyethyl phosphorothioates, Ethyl phosphodiester, deoxymethylene (or amino) (deoxy MMI), 2'-O-alkyl MMI, deoxy-methylphosphonate, 2'-O-alkyl methylphosphonate, morpholino, 4'-thio DNA, 4'-thio RNA, peptide nucleic acid, 3'-amidate, deoxy 3'-amidate, 2'-O-alkyl 3'-amidate, locked nucleic acid, cyclohexane nucleic acid, tricyclic DNA, 2'-fluoro-arabino nucleic acid, N3'-P5' phosphoramidate, carbamate-linked, phosphotriester-linked, nylon backbone modifications, and mixtures of the foregoing backbones.

[0070] In various embodiments, the oligonucleotides are chemically linked to one or more conjugates that enhance the activity, cellular distribution, or cellular uptake of the SSO.

[0071] In various embodiments, the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.

[0072] In various embodiments, each nucleotide of the SSO comprises a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a locked nucleic acid substitution.

[0073] In another aspect of the invention, an SSO of the invention is provided for use in medicine or for treating Citrin deficiency. As used herein, in the context of treating a disease such as Citrin deficiency, the terms "treat" or "treating" are intended to include improving clinical outcomes in patients suffering from the disease. This includes increasing the survival rate of patients suffering from the disease. The terms "treat" or "treatment" may refer to prophylactic and / or therapeutic treatment.

[0074] In one aspect, there is provided a use of an SSO as described herein for the manufacture of a medicament for treating a Hitchling deficiency disease. In another aspect, there is provided a method of treating a Hitchling deficiency disease, the method comprising administering to a subject a composition comprising an SSO as described herein. These SSOs can be used in a composition useful for treatment, for example in the form of a pharmaceutical composition comprising an SSO of the invention and a pharmaceutically acceptable carrier. The composition is suitable for parenteral administration to a patient, either naked or in complex with a delivery agent. The carrier is selected from the group consisting of: nanoparticles, such as polymer nanoparticles; liposomes, such as pH-sensitive liposomes, antibody-conjugated liposomes; viral vectors, cationic lipids, polymers, UsnRNA (such as U7 snRNA) and cell penetrating peptides. The SSO is administered orally, or rectally, or transmucosally, or intestinal, or intramuscularly, or subcutaneously, or intramedullary, or intrathecally, or directly intraventricularly, or intravenously, or intravitreally, or intraperitoneally, or intranasally, or intraocularly.

[0075] A pharmaceutically acceptable carrier generally refers to a material suitable for administration to a subject, wherein the carrier is biologically harmless or otherwise does not cause undesirable effects. Such carriers are generally inert ingredients of a medicament. In general, the carrier is administered to a subject together with the active ingredient without causing any undesirable biological effects or interacting in a harmful manner with any of the other components of the pharmaceutical composition in which the carrier is contained. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Co., Easton, Pa., (1990), which is incorporated herein by reference in its entirety.

[0076] In a more specific form of the present disclosure, a pharmaceutical composition is provided, the pharmaceutical composition comprising a therapeutically effective amount of SSO and a pharmaceutically acceptable diluent, preservative, solubilizing agent, emulsifying agent, adjuvant and / or carrier. Such compositions include diluents of different buffer contents (e.g., phosphate, Tris-HCl, acetate), pH and ionic strength and additives (such as detergents and solubilizing agents (e.g., Tween 80, polysorbate 80), antioxidants (e.g., ascorbic acid, sodium pyrosulfite), preservatives (e.g., thimerosal, benzyl alcohol) and swelling substances (e.g., lactose, mannitol)). The material can be incorporated into a polymer compound such as, but not limited to, a microparticle formulation of polylactic acid or polyglycolic acid, or incorporated into a liposome. Hyaluronic acid can also be used. Such compositions may affect the physical state, stability, in vivo release rate and in vivo clearance rate of the disclosed composition. The composition can be prepared in liquid form, or can be prepared in dry powder form, such as lyophilized form.

[0077] It should be understood that the pharmaceutical composition provided according to the present disclosure can be administered by any means known in the art. Preferably, the pharmaceutical composition for administration is administered by injection, oral administration or by pulmonary or nasal route. In various embodiments, the antisense polynucleotide is delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous administration route.

[0078] The oligonucleotides of the present invention encompass any pharmaceutically acceptable salt, ester or salt of such ester, or any other compound that is capable of (directly or indirectly) providing its biologically active metabolite or residue when administered to animals, including humans. Thus, for example, the present disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the present invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[0079] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of compounds of the present invention: ie, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0080] For polynucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to: (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (b) acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid; (c) salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid; and (d) salts formed with elemental anions such as chlorine, bromine and iodine. The pharmaceutical compositions of the present disclosure can be administered in a variety of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (including ocular and mucosal, including rectal delivery), pulmonary (e.g., by inhalation of powders or aerosols (including by nebulizer, intratracheal, intranasal, epidermal and transdermal)), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intracerebroventricular administration.

[0081] The pharmaceutical preparations of the present disclosure, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutical carrier or excipient. Generally speaking, the preparation is prepared by uniformly combining the active ingredient with a liquid carrier or a finely divided solid carrier or both, and then (if necessary) shaping the product.

[0082] The disclosure can also be expected to be combined with additional therapeutic agents. The term "combination" or "combination therapy" used throughout the specification is intended to be contained in the same or separate pharmaceutical preparation and to apply the therapeutic agent mentioned to the subject suffering from disease, illness or pathological condition at the same time or at different times. If the therapeutic agent is applied at different times, their application time should be close enough to enhance or synergistic reaction. In such cases, it is expected that people will generally apply two therapeutic agents within about 12-24 hours and more preferably within about 6-12 hours from each other. However, in some cases, it may be expected to significantly extend the time period for treatment, wherein between the corresponding application, a few days (2, 3, 4, 5, 6 or 7 days) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8 weeks) are separated. In other cases, it may be expected to reduce the time between application, in seconds or minutes to several hours, preferably within about 6 hours from each other, more preferably within about 1 hour or 3 hours, two therapeutic agents are applied.

[0083] The term "therapeutically effective amount" refers to the amount of SSO required to confer the desired therapeutic effect in a subject, which amount will vary depending on the route of administration, disease state, age, sex, body weight and the possibility of including other therapeutic agents or excipients. The methods and uses of the present invention are for patients in need. The compositions and methods of the present invention are for subjects or patients in need. The term "patient in need" refers to a person who has or is suspected of having or suffering from Citrin deficiency disease and a person who is susceptible to but has not yet suffered from Citrin deficiency disease.

[0084] To practice the methods of the present invention, the SSO can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. Sterile injectable compositions, such as sterile injectable aqueous or oily suspensions, can be formulated using suitable dispersants or wetting agents (such as Tween 80) and suspending agents according to techniques known in the art. Sterile injectable preparations can also be sterile injectable solutions or suspensions in non-toxic, parenterally acceptable diluents or solvents, for example as solutions in 1,3-butanediol. One of the acceptable vehicles and solvents that can be used is mannitol, water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterilized, non-volatile oils are generally used as solvents or suspension media (e.g., synthetic monoglycerides or diglycerides). Fatty acids such as oleic acid and its glyceride derivatives can be used to prepare injectables, just like natural pharmaceutically acceptable oils such as olive oil or castor oil, especially in their polyoxyethylated forms. These oil solutions or suspensions can also contain long-chain alcohol diluents or dispersants or carboxymethyl cellulose or similar dispersants. Other conventional surfactants such as Tween or Span or other similar emulsifiers or bioavailability enhancers that are commonly used to make pharmaceutically acceptable solids, liquids or other dosage forms can also be used for formulation purposes.

[0085] The composition for oral administration can be any oral acceptable dosage form, including but not limited to capsules, tablets, emulsions and aqueous suspensions, dispersions and solutions. In the case of tablets for oral use, commonly used carriers include lactose and corn starch. Lubricants such as magnesium stearate are generally added. For oral administration in capsule form, useful diluents include lactose and dried corn starch. When an aqueous suspension or emulsion is administered orally, the active ingredient can be suspended or dissolved in an oil phase combined with an emulsifier or suspending agent. As desired, certain sweeteners, flavorings or coloring agents can be added. Nasal aerosols or inhalation compositions can be prepared according to techniques well known in the field of pharmaceutical preparations. Compositions containing SSO can also be administered in the form of suppositories for rectal administration. The carrier in the pharmaceutical composition must be "acceptable" in the sense of being compatible with the active ingredient of the preparation (and preferably, being able to stabilize it) and harmless to the subject to be treated. For example, one or more solubilizers or more solubilizers that form a more soluble complex with SSO can be used as a drug carrier for delivering active compounds. Examples of other carriers include colloidal silicon dioxide, magnesium stearate, sodium lauryl sulfate, and D&C Yellow No. 10.

[0086] In various embodiments, the methods as described herein comprise providing a SSO of between 15 and 40 nucleotides in length.

[0087] In various embodiments, the methods as described herein comprise providing an SSO as follows: wherein at least one of the nucleotides of the SSO is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, a locked nucleic acid substitution, or a phosphorothioate linkage.

[0088] In various embodiments, methods as described herein comprise providing a SSO having phosphorothioate linkages between all nucleotides of the SSO.

[0089] In various embodiments, a method as described herein comprises providing a SSO wherein each nucleotide has a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a locked nucleic acid substitution.

[0090] In one aspect of the present invention, a pharmaceutical composition is provided, comprising (a) a therapeutically effective amount of a SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0091] The listing or discussion of an apparently prior-published document in this specification is not necessarily taken as an admission that the document is part of the state of the art or is common general knowledge.

[0092] Any document cited herein is hereby incorporated by reference in its entirety.

[0093] The present invention is described in more detail below.

[0094] Materials and methods

[0095] Cell culture

[0096] HEK293T, Huh7 and HepG2 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with high glucose supplemented with 10% fetal bovine serum and kept in a cell culture incubator set at 37°C and 5% CO2. Embryonic stem cells (ES cells) were maintained on ES cell-specific Matrigel (Corning) in mTeSR Plus medium (STEMCELL Technologies). To differentiate hepatocytes into induced hepatocytes (iHep), ES cells plated at 50% confluence were induced for two days in Definitive Endoderm Medium 1 (RPMI 1640 medium supplemented with B-27 supplement, 100 ng / mL Activin A, and 3 μM CHIR99021), three days in Definitive Endoderm Medium 2 (RPMI 1640 medium supplemented with B-27 supplement), five days in Hepatic Endoderm Medium (Definitive Endoderm Medium 2 with 20 ng / mL BMP4 and 10 ng / mL FGF2), and fourteen days in Lonza Hepatocyte Medium. CRISPR knock-in of the c.469-2922G>T variant into ES cells was outsourced to the Duke-NUS Stem Cell and Gene Editing (SCAGE) Core Facility.

[0097] 500 ng of minigene plasmid and different amounts of SSO were co-transfected into cells using Lipofectamine 3000 reagent (Invitrogen) using Opti-MEM (Thermo Fisher) according to the manufacturer's instructions. Cells were collected 24 hours after transfection for RNA analysis and treated with 50 μg / mL cycloheximide approximately 17 hours before cell harvest to block NMD.

[0098] To establish Huh7 and HepG2 cells stably expressing minigenes, minigenes were subcloned into a piggybac-based transfer vector and co-transfected with a plasmid expressing the piggybac transposon at a 5:1 ratio using Lipofectamine 3000 as above for a total of 500 ng, after which cells were selected with 1 μg / mL of puromycin for 2 weeks.

[0099] The free uptake of SSO by Huh7 and HepG2 under CEM was performed by treating cells with SSO in a calcium-rich medium (such as the cell culture medium supplemented with 9mM calcium chloride above). Cells were collected for RNA analysis 72 hours after treatment and treated with 50μg / mL cycloheximide approximately 17 hours before cell harvest. For SSO treatment of iHep, cells were treated with GalNAc-conjugated SSO in Lonza hepatocyte culture medium for 72 hours. Cycloheximide treatment was not performed on iHep treated with SSO.

[0100] Splicing assay

[0101] RNA was extracted from cells using TRIzol reagent (Invitrogen) and messenger RNA (mRNA) was converted to complementary DNA (cDNA) using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher). PCR was performed on the cDNA and PCR products were separated using standard gel electrophoresis on agarose gels for qualitative analysis or capillary electrophoresis on a Qsep100 Bio-Fragment Analyzer (BiOptic Inc) for quantitative analysis. To analyze the sequence of the PCR products, specific PCR bands were excised and extracted from agarose gels using the QIAquick Gel Extraction Kit (QIAgen), and Sanger sequencing was outsourced to Macrogen Inc.

[0102] Quantitative real-time PCR

[0103] To quantify SLC25A13 and acute toxicity markers CDKN1A, BAX, and PUMA mRNA, and hepatocyte differentiation markers ALB and ASGR1, quantitative real-time PCR was performed on cDNA using PowerUp SYBR Green Master Mix (Applied Biosystems) and detected using the CFX Touch Real-Time PCR Detection System (Bio-Rad). The primers used were: CDKN1A forward 5'-AGCAGAGGAAGACCATGTGGA-3' (SEQ ID NO: 30), reverse 5'-AATCTGTCATGCTGGTCTGCC-3' (SEQ ID NO: 31); BAX forward 5'-CCCGAGAGGTCTTTTTCCGAG-3' (SEQ ID NO: 32), reverse 5'-CCAGCCCATGATGGTTCTGAT-3' (SEQ ID NO: 33); PUMA forward 5'-GACCTCAACGCACAGTACGAG-3' (SEQ ID NO: 34), reverse 5'-AGGAGTCCCATGATGAGATTGT-3' (SEQ ID NO: 35); ALB forward 5'-GTTGCATGAGAAAACGCCAGT-3' (SEQ ID NO: 36), reverse 5'-GTCGCCTGTTCACCAAGGAT-3' (SEQ ID NO: 37). NO:37); ASGR1 forward 5'-GAGACAGAGCTGGACAAG-3' (SEQ ID NO:38), reverse 5'-CCCCTTCCCTTAAAATCCT-3' (SEQ ID NO:39); SLC25A13 forward 5'-TGGACTGTATAGAGGTCTGTTGC-3' (SEQ ID NO:40), reverse 5'-CCCTCACAAAATCGTTCACTGT-3' (SEQ ID NO:41); CAPN10 forward 5'-CTTCTGCGACTTGTCTACGCC-3' (SEQ ID NO:42), reverse 5'-GTGTGGCACAAATCTCCTGG-3' (SEQ ID NO:43). -ΔΔCt Method, CAPN10 was used as loading control to calculate relative quantification.

[0104] Immunoblotting

[0105] Proteins were extracted in radioimmunoprecipitation buffer (50 mM sodium chloride, 50 mM Tris buffer pH 6.8, 1 mM ethylenediaminetetraacetic acid, 1% Triton X-100, 0.1% sodium deoxycholate) supplemented with protease and phosphatase inhibitors and quantified using Bradford reagent (Bio-Rad). 30 μg of lysate was denatured in SDS loading dye (1% β-mercaptoethanol, 0.004% bromophenol blue, 6% glycerol, 2% sodium dodecyl sulfate, 50 mM Tris buffer pH 6.8), then separated by polyacrylamide gel and transferred to PVDF membrane using the Bio-Rad Mini-Protean system, after which the membrane was probed with anti-SLC25A13 antibody (ab96303, Abcam) and detected using iBright FL1500 (Invitrogen).

[0106] Urea and ammonia determination

[0107] After treating iHep 72 hours with GalNAc-conjugated SSO, the culture medium was updated with HCM supplemented with 2mM ammonium chloride, and urea was collected for 48 hours. The urea in the culture medium was quantitatively measured using QuantiChrom urea assay kit (BioAssay Systems), and the signal was detected using Tecan Spark 10M plate reader. The amount of ammonia remaining in the culture medium was quantitatively measured using EnzyChrom ammonia / ammonium assay kit (BioAssay Systems), and the signal was detected as above. The ammonia clearance rate was calculated by subtracting the amount of ammonium remaining in the culture medium from the amount of ammonium measured in the control wells without cells.

[0108] MTT assay

[0109] Huh7 cells stably expressing mutant minigenes were treated with 10 nM, 50 nM or 100 nM SSO for 72 hours by free uptake in calcium-rich medium. Subsequently, MTT assays were performed using an MTT assay kit (Abcam) according to the manufacturer's instructions. Briefly, cells were treated with MTT solution for 3 hours at 37 ° C, after which MTT solvent was added to the cells to release and dissolve reduced formazan crystals. Subsequently, the signal was measured using a Tecan Spark 10M plate reader.

[0110] Example 1

[0111] The sequences of the SSOs are shown in Table 1 below. Each sugar moiety in the SSOs is linked via a phosphorothioate backbone. Except for the locked nucleic acid substituted nucleotides as indicated in bold, each sugar moiety in the SSOs is modified with either 2'-O-methyl or 2'-O-methoxyethyl.

[0112]

[0113]

[0114] Table 1

[0115] The SSO comprising the sequence of SEQ ID NO 12 has the same target sequence as the SSO comprising the sequence of any one of SEQ ID NO 13 to SEQ ID NO 27.

[0116] In some embodiments, the SSO comprises multiple chemical modifications. The sequences of the SSOs with chemical modifications are shown in Table 2 below.

[0117] Nucleotides with 2'-O-methyl RNA (2'OMe) are indicated by "m". Nucleotides with 2'-O-methoxyethyl (2'MOE) RNA are indicated by " / MOEr / ". Thymidine modified with 2'MOE is used instead of uridine modified with 2'MOE. Nucleotides with locked nucleic acids (LNA) are indicated by "+". Thymidine modified with LNA is used instead of uridine modified with LNA. Nucleotides connected to the following nucleotides by a phosphorothioate (PS) bond are indicated by "*". It is generally known to those skilled in the art that the number of phosphorothioate bonds is one less than the number of bases. "2OM" indicates that the SSO is modified by 2'-O-methyl RNA. "2MOE" indicates that the SSO is modified by 2'-O-methoxyethyl RNA. "2OML" indicates that the SSO includes 2'-O-methyl RNA and locked nucleic acid modifications. "2MOL" indicates that the SSO includes 2'-O-methoxyethyl RNA and locked nucleic acid modifications.

[0118]

[0119]

[0120]

[0121]

[0122]

[0123] Table 2

[0124] Example 2

[0125] In order to facilitate the verification of rationally designed SSOs, a minigene system with a specific genomic mutation, namely c.469-2922G>T in the SLC25A13 gene, was constructed. Figure 1As shown in , the minigene includes the entire sequence of exon 5, the first 2,000 bases and the last 4,923 bases of intron 5, and the entire sequence of exon 6; the relative loci with the G>T substitution are delineated in the figure. In the wild-type minigene, proper splicing of exon 5 to exon 6 occurs, whereas after the introduction of the c.469-2922G>T mutation, inclusion of the pseudoexon (exon 5* or SLC25A13-PE5) was confirmed when the mutant minigene was expressed in several human cell lines ( Figure 2 ). This would implicate the c.469-2922G>T mutation as the cause of SLC25A13-PE5 retention in mature SLC25A13 transcripts. The loss of sitrin expression and subsequent loss of ureagenetic potential and ammonia scavenging capacity in iHep carrying the c.469-2922G>T mutation confirms a pathogenic role ( Figure 2 B. Figure 2 C and Figure 2 D).

[0126] Example 3

[0127] Since the pseudoexon is 85 bases in length, its inclusion shifted the codon reading frame of the SLC25A13 transcript, resulting in loss of expression and protein function ( Figure 2 As a therapeutic strategy for restoring expression of the wild-type protein, nine SSOs were designed to induce the exclusion of pseudoexons, thereby correcting the reading frame. Figure 3 As shown in , each of the SSOs was highly efficient in inducing SLC25A13-PE5 exon skipping. The seven most efficient SSOs were selected and titration experiments were performed to obtain their corresponding concentration responses ( Figure 4 ) for the purpose of further differentiating the best performing SSOs. It was observed that each of the SSOs had a positive effect at concentrations below 10 nM (i.e., IC 100 <10nM) to achieve complete exclusion of pseudo exons. SSO No. 2005, 2007 and 2008 are IC 50 <0.1nM and IC 75 Top 3 performers at ~0.1 nM.

[0128] Example 4

[0129] In order to reduce the molecular size of the lead SSO to facilitate cellular uptake and reduce cGMP manufacturing costs, a shorter version of SSO No. 2008 with locked nucleic acid (LNA) substitutions at specific ribose sugars was rationally designed. Figure 5It was shown that the shortened SSO No. 2032, No. 2033 and No. 2034, which were 40% shorter than the parent No. 2008, had substantially lost their efficiency in inducing pseudo exon exclusion. No. 2034 was selected for further optimization, along with 15 arrangements with mixed chemical modifications, labeled No. 2034.1 to No. 2034.15. Each sugar moiety in the hybrid was modified with 2'-O-methyl substituted by a locked nucleic acid, which was connected via a thiophosphate backbone. The recovery of the efficiency of inducing pseudo exon exclusion was observed in several hybrids of No. 2034. In two sets of experiments, 1nM SSO was co-transfected into Huh7 with 500ng pCIT2mut. PCR was performed on the complementary DNA generated from the RNA extracted from the transfected cells. The amount of products with pseudo exons and products without pseudo exons was quantified using capillary electrophoresis for PCR products. Efficacy is reflected as the percentage of PCR products without spurious exons to the total PCR products (splicing corrected %).

[0130] Example 5

[0131] The efficiency of each of the 2034 cocktails labeled 2034.1 to 2034.15 in inducing SLC25A13-PE5 exclusion was determined by free uptake in calcium-rich medium (CEM) on Huh7 or HepG2 cells stably expressing the mutant minigene when treated with 20 nM or 200 nM SSO, respectively. The use of CEM stimulated cellular uptake in vitro and better reflected in vivo efficacy when compared to transfection. The parental 2008, which was 40% longer than 2034, almost eliminated all of its efficiency ( Figure 6 A). In contrast, the efficiency of most of the 2034 hybrids was retained, suggesting that SSO molecular size may be an important factor affecting the kinetics of free cellular uptake ( Figure 6 A). Subsequently, the dose responses of the two most potent hybrids, 2034.5 and 2034.15, were obtained and compared to their parent 2008 and a single 2'-O-methyl modified version (2034). Both 2034.5 and 2034.15 hybrids showed similar dose responses and were 10 times more potent than either 2008 or 2034 ( Figure 6 B); EC Nos. 2034.5 and 2034.15 50 (<10 1.5 nM) is about 10 times lower than that of No. 2008 and No. 2034. Figure 6 C shows that no obvious toxic effects were observed on cells treated with any of the SSOs.

[0132] Example 6

[0133] To demonstrate therapeutic applications, the lead cocktail was conjugated with three GalNAc molecules (GN*3) to mimic the asialoglycoprotein receptor-mediated functional uptake of iHep homozygous for SLC25A13-PE5 (in the absence of CEM and transfection agent). The GN*3 moiety was chemically bonded to the 5' of each SSO in a trivalent configuration, which allowed receptor-mediated uptake of the SSOs through the asialoglycoprotein receptor specifically expressed on hepatocytes. 4 μM GalNAc*3 (GN*3) conjugated non-targeting control (NC2 g1.1), 2034.5 (2034.5g1.1), or 2034.15 (2034.15g1.1) in 2'-O-methyl+LNA (2OML) or 2'-O-methoxyethyl+LNA (2MOL) chemical combinations were incubated on cultured iHep. Figure 7 A reveals that GalNAc-conjugated SSO 2034.5 and 2034.15, but not NC2, can regulate the out-splicing of SLC25A13-PE5 from the endogenous SLC25A13 transcript, which subsequently rescues the SLC25A13 transcript level that would otherwise be reduced due to nonsense-mediated decay in mutant iHep ( Figure 7 B). Restoration of expression of full-length wild-type SLC25A13 in mutant iHep by 2034.5g1.1 or 2034.15g1.1 rescued urea production ( Figure 7 C), thus causing ammonia clearance to recover ( Figure 7 D). Rescue of functional protein activity was confirmed by immunoblotting using rescue of full-length sidrin protein expression levels in mutant iHep treated with 2034.15g1.1 modified with 20ML chemical combinations ( Figure 7 F). No acute toxicity was observed in iHep treated with 2034.5g1.1 and 2034.15g1.1 in either 20ML or 2MOL chemical combinations, as inferred from the lack of significant increase in the expression of acute toxicity markers CDKN1A, BAX, and PUMA ( Figure 7 E) The sequences of primers used in quantitative real-time PCR for quantification of acute toxicity markers CDKN1A, BAX and PUMA, hepatocyte differentiation markers ALB and ASGR1, SLC25A13, and loading control CAPN10 mRNA are shown in Table 3.

[0134] SEQ ID NO manual Sequence from 5' to 3' 30 CDKN1A forward primer AGCAGAGGAAGACCATGTGGA 31 CDKN1A reverse primer AATCTGTCATGCTGGTCTGCC 32 BAX forward primer CCCGAGAGGTCTTTTTCCGAG 33 BAX reverse primer CCAGCCCATGATGGTTCTGAT 34 PUMA forward primer GACCTCAACGCACAGTACGAG 35 PUMA reverse primer AGGAGTCCCATGATGAGATTGT 36 ALB forward primer GTTGCATGAGAAAACGCCAGT 37 ALB reverse primer GTCGCCTGTTCACCAAGGAT 38 ASGR1 forward primer GAGACAGAGCTGGACAAG 39 ASGR1 reverse primer CCCCTTCCCTTAAAATCCT 40 SLC25A13 forward primer TGGACTGTATAGAGGTCTGTTGC 41 SLC25A13 reverse primer CCCTCACAAAATCGTTCACTGT 42 CAPN10 forward primer CTTCTGCGACTTGTCTACGCC 43 CAPN10 reverse primer GTGTGGCACAAATCTCCTGG

[0135] Table 3.

[0136] Although preferred embodiments of the present invention have been described in the foregoing description, those skilled in the relevant art will appreciate that many changes or modifications may be made to the details of design or construction without departing from the present invention.

Claims

1. An exon skipping method, the method comprising providing a splice switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a SLC25A13 gene, wherein the binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene. 2 . The method of claim 1 , wherein the target region has at least 95% sequence identity to SEQ ID NO:

28.

3. The method according to claim 1 or 2, wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:

29.

4. The method according to any one of claims 1 to 3, comprising providing a SSO having a binding site located within SLC25A13-PE5.

5. The method according to any one of claims 1 to 3, comprising providing a SSO having a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5.

6. The method according to any one of claims 1 to 3, comprising providing an SSO having a binding site that overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlaps with the donor splice site of SLC25A13-PE5.

7. The method according to any one of claims 1 to 3, comprising providing a SSO having a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 12.

8. The method according to any one of claims 1 to 3, comprising providing a SSO having a sequence selected from the group consisting of SEQ ID NO 13 to SEQ ID NO 27.

9. A splice switching oligonucleotide (SSO) that binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity to SEQ ID NO:28, and wherein binding of the SSO induces exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

10. The SSO of claim 9, wherein the SSO has a binding site located within SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:

29.

11. The SSO of claim 9, wherein the SSO has a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:

29.

12. The SSO of claim 9, wherein the SSO has a binding site that overlaps with SLC25A13-PE5 or a portion of SLC25A13-PE5 and overlaps with the donor splice site of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO:

29.

13. The SSO of claim 9, comprising a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 12.

14. The SSO of claim 9, comprising a sequence selected from the group consisting of SEQ ID NO 13 to SEQ ID NO 27.

15. The SSO according to any one of claims 9 to 14, for use in the treatment of Citrin deficiency.

16. Use of the SSO according to any one of claims 9 to 14 for the manufacture of a medicament for treating Citrin deficiency.

17. A method of treating Citrin deficiency, the method comprising administering to a subject a composition comprising the SSO according to any one of claims 9 to 14.

18. The method according to any one of claims 1 to 8 or the SSO according to any one of claims 9 to 15 or the use according to claim 16 or the method according to claim 17, wherein the SSO has a length between 15 and 40 nucleotides.

19. The method according to any one of claims 1 to 8 and 18 or the SSO according to any one of claims 9 to 15 and 18 or the use according to claim 16 or 18 or the method according to claim 17 or 18, wherein at least one of the nucleotides of the SSO is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, a locked nucleic acid substitution or a phosphorothioate linkage.

20. The method according to any one of claims 1 to 8 and 18 to 19 or the SSO according to any one of claims 9 to 15 and 18 to 19 or the use according to any one of claims 16 or 18 to 19 or the method according to any one of claims 17 to 19, wherein the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.

21. The method of any one of claims 1 to 8 and 18 to 20 or the SSO of any one of claims 9 to 15 and 18 to 20 or the use of any one of claims 16 or 18 to 20 or the method of any one of claims 17 to 20, wherein each nucleotide of the SSO comprises a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification or a locked nucleic acid substitution.

22. A pharmaceutical composition comprising (a) a therapeutically effective amount of a SSO according to any one of claims 9 to 14 and 18 to 21 and (b) one or more pharmaceutically acceptable carriers and / or diluents.

Images