Small nucleic acid preparation and compound preparation for treating leucoderma disease

Abstract

The invention finds that the small nucleic acid for interfering the UBE2S gene has the effect of treating leucoderma, and also discloses and prepares a compound preparation which comprises the following components: polygonum multiflorum, radix salviae miltiorrhizae, quercetin, psoralein fat, apigenin, herba epimedii, the small nucleic acid for interfering the gene and panthenol, and has the effects of inhibiting excessive immunity, promoting blood circulation and the like in a skin smearing manner. The traditional Chinese medicine composition has the effects of promoting melanocyte proliferation and melanogenesis, and can recover white spots and treat leucoderma. The innovative gene small nucleic acid and the compound preparation are combined with a molecular biological technology and a traditional plant extract, cover cell cycle regulation, immunosuppression, melanocyte proliferation and melanogenesis mechanisms, and have the advantages of feasible formula process, convenience in use, remarkable effect, no toxic or side effect, irritation and the like; a brand new technical scheme is provided for clinical treatment of vitiligo.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and medical technology, and in particular to a small nucleic acid preparation and a compound preparation for treating vitiligo. Background Art

[0002] Vitiligo is a common skin disease caused by abnormal melanocytes due to abnormal immune system and other reasons, which leads to reduced melanin production. The disease is characterized by local or widespread melanin loss, forming white spots, with increased or normal pigmentation of the surrounding skin, and the hair in the affected area may turn white. This disease is equivalent to vitiligo and white spot wind in traditional Chinese medicine. As recorded in the Treatise on the Causes and Symptoms of Various Diseases, "Vitiligo is the skin and flesh of the face, neck and body turning white, which is different from flesh, and is not itchy or painful. It is called vitiligo." It occurs all over the world, with an incidence rate of 0.1% to 2%. About 30 million people in my country suffer from the disease, and this disease can affect all races. In recent years, the incidence of vitiligo has increased year by year. Due to local pigment loss, it affects beauty, is easy to diagnose and difficult to treat, and brings serious psychological and social pressure to patients. The size and shape of white spots are uncertain, the number is uncertain, and adjacent ones can merge with each other. They are irregularly distributed in any part, especially common on the face, neck, arms, penis, foreskin, vulva and other parts. Some develop faster, and new lesions appear one after another. Some patients can maintain 1-2 white spots for a long time, or they can become fixed after developing to a certain extent. Only a few patients' white spots gradually shrink, the pigments merge and eventually return to normal.

[0003] The cause of vitiligo is unknown, and there are many theories, such as autoimmunity, psychological and mental stress, and peroxidation. Studies have found that some patients have other autoimmune diseases, such as thyroid disease, chronic adrenocortical insufficiency, and diabetes. In addition, a variety of organ-specific antibodies can be found in the patient's serum, and T lymphocytes and their subpopulations have abnormal changes. It is speculated that skin lymphocyte-associated antigen (CLA) and specific cytotoxic T cells (CTL) may play a key role in the destruction of melanocytes. Some patients have excessive mental tension before the onset or during the development of skin lesions, and patients are often accompanied by autonomic dysfunction. In addition, oxidative stress damage is considered to be one of the initiating factors that promote the onset of vitiligo and may promote the development of the disease. Oxidative stress is the excessive production of reactive oxygen free radicals in the body under the action of various harmful stimuli or the lack of antioxidant substances in the body. The degree of oxidation exceeds the clearance of oxides, and the oxidation system and antioxidant system are unbalanced, which puts the body in a state of oxidative stress, thereby causing tissue damage. Oxidative stress can not only cause damage to melanocytes, but also damage the structure and function of membrane proteins in cell membranes or organelles, disrupting autoimmune discomfort, inducing immune response, causing immune damage, and thus forming a cascade effect.

[0004] So far, the etiology and pathogenesis of vitiligo have not been fully clarified, and its treatment is still very difficult. At present, the main treatment options are divided into drug therapy, phototherapy, and traditional Chinese medicine. First of all, hormone therapy includes topical hormones (glucocorticoids) and systemic hormones. The use of hormone regimens may cause many adverse reactions, and treatment needs to be adjusted in time, and follow-up observation should be paid attention to. Immunosuppressants include topical calcineurin inhibitors, such as pimecrolimus or tacrolimus, which are non-hormonal immunosuppressants. Currently used phototherapy methods include narrow-band medium-wave ultraviolet NB-UVB and 308 nanometer excimer lasers or excimer light waves, photosensitizers combined with long-wave ultraviolet rays, which can stimulate the growth of melanocytes in the skin and hair follicles and regulate the function of skin immune cells. Some traditional Chinese medicine ingredients containing photosensitizers or anti-inflammatory are used in the treatment of vitiligo. In addition, topical traditional Chinese medicine plus UVA phototherapy can also be used. In addition, when vitiligo is in a stable period, transplantation can be considered, from normal skin or cells in other parts of the patient's body to the white spot area. However, patients with progressive vitiligo, scar constitution, etc. are not suitable for transplantation treatment. The above treatment options all have certain efficacy and improvement, but once the medication is stopped, the recurrence rate is high and it is difficult to cure.

[0005] In general, the treatment of vitiligo is a complex and long process. There is no unified standard, and the treatment method varies from person to person. Because traditional treatment methods have large side effects, such as hormone treatment options, more innovative treatment methods are needed. Summary of the invention

[0006] In view of the current status and shortcomings of the above-mentioned existing vitiligo treatment schemes, the purpose of the present invention is to provide a UBE2S gene interference small nucleic acid with a vitiligo treatment effect; further, to invent a compound preparation combining small nucleic acid and plant extracts for use in the treatment of vitiligo diseases, to solve the problem of limited efficacy of existing vitiligo treatments. To achieve the above purpose, the present invention provides a set of technical solutions for regulating cell cycle, inhibiting immune cell killing and anti-oxidation, which are applied to the treatment of vitiligo diseases.

[0007] The present invention provides a substance for inhibiting small nucleic acid interfering with UBE2S gene and reducing the expression of UBE2S gene, and the substance is used in preparing a medicine for treating or preventing vitiligo.

[0008] The functions of the substance that reduces the expression level of the UBE2S gene include any one or more of the following: (1) regulating the cell cycle; (2) promoting the growth of melanocytes; (3) enhancing the melanin production capacity.

[0009] The substances for reducing the expression level of the UBE2S gene include RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA targeting the UBE2S gene, and substances for implementing lentiviral infection or gene knockout.

[0010] The substance for implementing gene interference is a siRNA interference sequence: Wherein, siUBE2S sense: GCACAUCAUCCGCCUGGUGUAC, the sequence is shown in SEQ ID NO: 1; siUBE2S antisense: AGUACACCAGGCGGAUGAUGUG, the sequence is shown in SEQ ID NO:2.

[0011] The interfering small nucleic acid of the UBE2S gene of the present invention has the following beneficial effects: providing the application of the UBE2S gene in the treatment of vitiligo, and effectively improving and restoring the growth of melanocytes by specifically interfering with the UBE2S gene. The value of the present invention lies in that it can be used as a target for the treatment of vitiligo and has good clinical application value.

[0012] Furthermore, the present invention finds that the combination of Polygonum multiflorum, Salvia miltiorrhiza, quercetin, osteosin lipid, apigenin, epimedium, UBE2S gene interference small nucleic acid, and panthenol, through different dosages of different component combinations, can effectively inhibit the development of vitiligo and restore melanocyte function, and has good clinical application value. The value of the present invention is to provide an application of a compound preparation in the treatment of vitiligo.

[0013] The composite preparation for treating vitiligo of the present invention comprises the following components by weight percentage: 3-16 portions of Polygonum multiflorum. The main effects and functions of Polygonum multiflorum include nourishing the liver and kidneys, improving the essence and blood, blackening the hair, and clearing turbidity.

[0014] 4-13 portions of purple salvia miltiorrhiza. The main effects and functions of purple salvia miltiorrhiza include nourishing blood and calming the mind, promoting blood circulation and removing blood stasis, clearing the heart and cooling blood.

[0015] 3-11 parts of quercetin. The main effects and functions of quercetin include anti-inflammatory, anti-thrombotic, anti-allergic, lowering blood sugar and blood lipids.

[0016] 2-13 parts of apigenin. The main effects and functions of apigenin include anti-tumor, cardiovascular protection, anti-neurodegenerative disease, anti-type 2 diabetes, and antioxidant effects.

[0017] 1-9 portions of Epimedium. The main effects and functions of Epimedium include enhancing immunity, protecting liver and kidney, resisting osteoporosis, resisting myocardial ischemia, resisting Alzheimer's disease, resisting thrombosis, promoting hematopoiesis, etc.

[0018] 3.5-11 portions of Psoralea corylifolia. The main effects and functions of Psoralea corylifolia include anti-cancer, anti-bleeding, kidney-tonifying and yang-enhancing, qi-regulating and asthma-relieving, spleen-warming and diarrhea-stopping, treatment of vitiligo and alopecia areata, etc.

[0019] UBE2S gene interfering small nucleic acid 0-24 copies, the efficacy and function of UBE2S gene interfering small nucleic acid mainly include specific interference with UBE2S gene, reducing the expression level of UBE2S gene, affecting signal transduction and intracellular transport, protein degradation, and ubiquitin regulation of cell cycle.

[0020] 0.5-5 parts of panthenol. The main effects and functions of panthenol are that it will be converted into pantothenic acid after being used by skin tissue. Pantothenic acid is the most important raw material for synthesizing coenzyme A, promoting the metabolism of human protein, lipid, and sugar, protecting the skin and mucous membrane, and improving the gloss of hair. It enhances moisturizing effect, relieves dry skin and enhances skin hydration ability. It also has certain anti-inflammatory and repair effects.

[0021] Furthermore, Polygonum multiflorum and Salvia miltiorrhiza are crushed, decocted at 20-60 degrees, and the filtrate after decoction is collected. Quercetin, apigenin, osteospermum officinale, and apigenin are soaked in warm water and then mixed with the decoction filtrate and panthenol.

[0022] The mixed solution is fermented for 10-30 days. UBE2S gene interference small nucleic acid is added to the mixed fermentation solution.

[0023] Furthermore, the compound preparation is directly applied to the affected part of the skin, and the drug enters the lesion site through the skin tissue to exert a therapeutic effect.

[0024] The functions of the composite substance for preventing and treating vitiligo are any one or more of the following: (1) inhibiting the killing effect of immune cells on melanocytes; (2) anti-oxidation effect, reducing the damage to melanocytes; (3) promoting the proliferation of melanocytes; (4) promoting the production of melanin; (5) the preparation is directly applied to the affected area for use.

[0025] The dosage form of the invention is liquid, and the method of use is to apply it externally to the affected area.

[0026] The advantages of the product of the present invention are: the compound preparation is easy to use, and the preparation can be applied to the affected area; the preparation of the present invention uses ingredients with multiple functions, combines molecular biotechnology means with plant extracts, and the mechanism of action covers multiple effects including inhibiting the killing effect of immune cells on melanocytes, promoting melanocyte growth, promoting melanin production, and anti-oxidation. Experimental verification shows that the compound preparation has a significant effect in treating vitiligo and has a significant color restoration effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the qPCR effect diagram before and after UBE2S gene interference in melanocytes. The bar graph shows the comparison before and after UBE2S gene inhibition. After adding UBE2S-siRNA, the expression of UBE2S gene was significantly inhibited (*p<0.05);

[0028] Figure 2 It is the small nucleic acid group or compound preparation group, which can enhance the proliferation ability of melanocytes. The curve of the change of the number of cells over time (days) shows that the proliferation ability of cells is significantly improved. Each time point on the horizontal axis represents 2 days;

[0029] Figure 3 In the vitiligo mouse model, small nucleic acid has a significant re-pigmentation effect. A Control group (normal saline without preparation); B Small nucleic acid smear treatment; C Compared with the control group, the small nucleic acid group has a significant re-pigmentation effect (P value <0.05);

[0030] Figure 4 In the vitiligo mouse model, the compound preparation has a significant restoring effect. A Control group (normal saline without preparation); B Compound preparation smear treatment; C Compared with the control group, the compound preparation group has a significant restoring effect (P value <0.05). DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some representative embodiments of the present invention, rather than all embodiments. All other embodiments obtained by ordinary technicians in this field without making creative work belong to the protection scope of the present invention.

[0032] Example 1 In this example, the qPCR effect before and after UBE2S gene interference in melanocytes (shRNA lentivirus infection of melanocytes) was verified.

[0033] This embodiment includes a qPCR fluorescence quantitative PCR experiment, including the following methods: 1.1. RNA extraction (1) Collect cells (6-well plate), centrifuge at 2000 rpm for 5 minutes, remove the supernatant, add 1 mL of Trizol reagent to the cell pellet and mix well, let stand at room temperature for 5 minutes, and then transfer to a new 1.5 mL tube.

[0034] (2) Add 200 μL of chloroform to each tube, shake up and down for 15 seconds, and let stand at room temperature for 10 minutes. Centrifuge at 4°C and 12,600 rpm for 15 minutes.

[0035] (3) Transfer the upper layer of liquid to a new 1.5 mL EP tube, add an equal volume of pre-cooled isopropanol, mix well, and let stand at 4°C for 10 minutes. Centrifuge at 4°C, 12,600 rpm for 12 minutes, and discard the supernatant.

[0036] (4) Add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 12,000 rpm at 4°C for 5 minutes and discard most of the supernatant.

[0037] (5) Centrifuge at 12,000 rpm at 4°C for 5 minutes, discard the supernatant, and dry at room temperature.

[0038] (6) When the RNA precipitate becomes transparent, add RNase-free water until it is completely dissolved. Use Nanodrop 2000 / 2000C spectrophotometer to measure the concentration and quality of the extracted RNA.

[0039] 1.2. RNA Reverse Transcription (1) Add 1 μL Oligo dT and 2 μg Total RNA to a PCR tube and add RNase-Free H2O to 10 μL. Mix well and centrifuge. Incubate at 70°C for 10 minutes. Then place in an ice-water mixture to allow Oligo dT and template to anneal.

[0040] (2) In the above mixture, prepare the reaction system according to the proportions, mix well, and centrifuge briefly. Ratio: 5×RT buffer 4μL, 10 mM dNTPs 2μL, Rnasin (40U / μL) 0.4μL, M-MLV-RTase (200U / μL) 1μL, RNase-FreeH2O 2.6μL.

[0041] (3) The above system was reacted in a 42°C water bath for 1 hour, then in a 70°C water bath for 10 minutes, and the obtained RT product cDNA was stored at -20°C for later use.

[0042] 1.3. Real-time PCR detection of gene expression (1) Prepare the reaction system according to the following proportions: SYBR premix ex taq 6.0 μL, primer mix (5 μM) 0.3 μL, template (reverse transcription product) 0.6 μL, RNase-Free H2O 5.1 μL.

[0043] (2) Real-Time PCR was performed using a two-step method and a melting curve was generated. The procedure was as follows: stage 1: 95°C for 30 seconds; stage 2: 95°C for 5 seconds, 60°C for 30 seconds, 40 cycles; stage 3: 95°C for 15 seconds, 60°C for 30 seconds, and 95°C for 15 seconds.

[0044] Data Analysis Relative quantitative analysis ΔCt = target gene Ct value - reference gene Ct value; -ΔΔCt = NC group ΔCt average - each sample ΔCt value; 2 -ΔΔCt Reflects the relative expression level of the target gene in each sample relative to the NC group samples.

[0045] Reference Figure 1As shown, the bar graph shows the comparison before and after UBE2S gene inhibition. After adding UBE2S gene siRNA, the expression of UBE2S gene was significantly inhibited (*p<0.05; **p<0.01).

[0046] Example 2 In this example, after adding UBE2S gene interfering small nucleic acid and compound preparation, the Celigo method was used to detect the number of cells and analyze the growth and proliferation of melanocytes.

[0047] The specific method is: (1) Resuspend the cells in each group in complete culture medium into cell suspension and count them.

[0048] (2) Determine the cell density for plating according to the cell growth rate. The culture system is 100 μL / well. Ensure that the number of cells added to each well is consistent during plating. Culture in a 37°C, 5% CO2 incubator.

[0049] (3) Starting from the second day after plating, read the plates using Celigo assay every 2 days for 5 consecutive days.

[0050] (4) Adjust the input parameters of the analysis settings to accurately calculate the number of cells with green fluorescence in each scan. Perform statistics on the data and draw a cell proliferation curve for 10 consecutive days (once every 2 days).

[0051] Reference Figure 2 As shown, the horizontal axis represents the number of days. Figure 2 It shows that the proliferation ability of melanocytes is enhanced after adding small nucleic acids and compound preparations.

[0052] Example 3 Vitiligo animal modeling and treatment verification.

[0053] (1) Prepare 12 C57 mice weighing 18-26 g.

[0054] (2) Shave the animals and apply 5% hydrogen peroxide to the experimental skin area twice a day for 30 days to create a vitiligo mouse model.

[0055] (3) After the vitiligo mouse model is completed, apply the corresponding preparation to the lesion site once a day for 25 days.

[0056] (4) After 25 days, the re-pigmentation of the vitiligo lesions was observed to evaluate the therapeutic effect of the preparation on vitiligo. The analysis software ImageJ ver1.52a was used.

[0057] (5) Statistical analysis: The data were expressed as mean ± standard deviation and analyzed by t test. P < 0.05 was considered to be significantly different.

[0058] (6) The analysis showed that compared with the control ( Figure 3 ), the small nucleic acid group had a significant color restoration effect (P value <0.05). Figure 4 ), the compound preparation group had a significant restorative effect (P value < 0.05).

[0059] Those skilled in the art may make various modifications to the above content without departing from the spirit and scope of the present invention as defined in the claims. Therefore, the scope of the present invention is not limited to the above description, but is determined by the scope of the claims.

Claims

1. The UBE2S gene interfering small nucleic acid preparation and compound preparation (Polygonum multiflorum, Salvia miltiorrhiza, quercetin, osteospermum officinale, apigenin, epimedium, UBE2S gene interfering small nucleic acid, and panthenol) of the present invention are used to treat vitiligo. The preparation can regulate the cell cycle, affect cellular immunity and cell autophagy, promote the growth of melanocytes and melanin production, and has the effect of treating vitiligo and restoring color safely.

2. The use according to claim 1, characterized in that: The preparations having the effect of restoring the color of vitiligo are any of the following: (1) UBE2S gene small nucleic acid preparations have the effect of restoring the color of vitiligo and can be used to treat vitiligo; (2) compound preparations (Polygonum multiflorum, Salvia miltiorrhiza, quercetin, osteospermum officinale, apigenin, epimedium, UBE2S gene interfering small nucleic acid, panthenol) have the effect of restoring the color of vitiligo and can be used to treat vitiligo; (2) compound preparations (Polygonum multiflorum, Salvia miltiorrhiza, quercetin, osteospermum officinale, apigenin, epimedium, panthenol) have the effect of restoring the color of vitiligo white spots and can be used to treat vitiligo.

3. The use according to claims 1 and 2, characterized in that Compound preparation (including small nucleic acid): 3-15 parts of Polygonum multiflorum, 4-11 parts of Salvia miltiorrhiza, 3-10 parts of quercetin, 2-6 parts of apigenin, 1-4 parts of Epimedium, 3.5-8 parts of osteospermum officinale, 5-15 parts of UBE2S gene interfering small nucleic acid, and 0.5-3 parts of panthenol.

4. The use according to claim 2, characterized in that: Compound preparation (does not contain small nucleic acids): 3-15 parts of Polygonum multiflorum, 4-11 parts of Salvia miltiorrhiza, 3-10 parts of quercetin, 2-6 parts of apigenin, 1-4 parts of Epimedium, 3.5-8 parts of osteospermum officinale, and 0.5-3 parts of panthenol.

5. The use according to claims 1 and 2, characterized in that The substances for reducing the expression level of the UBE2S gene include RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA targeting the UBE2S gene, and substances for implementing lentiviral infection or gene knockout.

6. The use according to claim 5, characterized in that: The substance for suppressing interference genes is a siRNA nucleic acid sequence.

7. The use according to claim 6, characterized in that The siRNA knockout sequences are siUBE2S: siUBE2S sense: GCACAUCAUCCGCCUGGUGUAC, siUBE2S antisense: AGUACACCAGGCGGAUGAUGUG.

8. The use according to claims 1 and 2, characterized in that The vitiligo includes different types known in the classification.

9. The use according to claims 1 and 2, characterized in that Application of UBE2S gene small nucleic acid preparations, compound preparations (Polygonum multiflorum, Salvia miltiorrhiza, quercetin, osteospermum officinale, apigenin, epimedium, UBE2S gene interfering small nucleic acid, panthenol), and compound preparations (Polygonum multiflorum, Salvia miltiorrhiza, quercetin, osteospermum officinale, apigenin, epimedium, panthenol), wherein the functions of the products are any one or more of the following: (1) promoting melanocyte proliferation; (2) promoting melanin production capacity; (3) regulating cell cycle; (4) inhibiting immune cell destruction; (5) antioxidant effect.

Images