A brazin mutant and application thereof

By performing site-directed mutagenesis on the amino acid sequence of brassinolide and expressing it in Pichia pastoris, the problems of low yield and unstable sweetness properties of brassinolide were solved, resulting in a significant improvement in sweetness and promoting its application in the food and pharmaceutical fields.

CN119954922BActive Publication Date: 2026-06-26NANJING TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510181686.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-19
Publication Date
2026-06-26
Estimated Expiration
2045-02-19

AI Technical Summary

Technical Problem

Existing technologies yield low amounts of Brazilian sweet protein and produce inconsistent sweetness properties, making industrialization difficult.

Method used

By performing specific amino acid mutations on the amino acid sequence of brassinoprotein, a brassinoprotein mutant was constructed and expressed in Pichia pastoris. Fermentation conditions were then optimized to improve the yield and sweetness of the brassinoprotein.

Benefits of technology

The Brazilian sweet protein mutant, when expressed in Pichia pastoris, increases sweetness by 240% and can be widely used in the food and pharmaceutical fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119954922B_ABST
    Figure CN119954922B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of protein engineering, and discloses a brazzein mutant and application thereof. In the application, aspartic acid at the 29th position of brazzein is replaced by lysine, glutamic acid at the 36th position is replaced by arginine, and aspartic acid at the 50th position is replaced by alanine. The brazzein mutant is constructed by mutating the amino acids at the above-mentioned positions, the brazzein mutant is expressed in Pichia pastoris GS115 in a heterologous manner, and the sweet taste performance of the expressed brazzein mutant is evaluated. The sweet taste performance of the double mutant Asp29Lys-Asp50Ala protein is improved by 240% compared with that of the brazzein before mutation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of protein engineering technology and relates to a Brazilian sweet protein mutant and its applications. Background Technology

[0002] Brazzein, or Brazilian sweet protein, is a natural plant protein that produces a sweet taste by binding to sweet taste receptors in the human body. Brazzein has a relatively low molecular weight, high sweetness, good water solubility, low calories, a long-lasting sweet taste, and can be degraded into amino acids for human absorption and utilization, making it highly nutritious. Therefore, its application in the food industry has attracted widespread attention, further increasing the demand for economical, efficient, and safe production of brazzein.

[0003] To address the issues of low yield and difficulties in industrialization of plant-based sweet proteins, scholars both domestically and internationally have recently focused on utilizing heterologous expression of sweet proteins through microorganisms, such as E. coli, plant cells, and animal cells, to increase their production. However, these methods all share the problem of insufficient yield for production and inconsistent sweetness properties, which remains a bottleneck for the industrialization of sweet proteins. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to address the shortcomings of the prior art by providing a Brazilian sweet protein mutant and its applications.

[0005] To address the aforementioned technical problems, this invention discloses a Brazil sweet protein mutant and its applications. The specific technical solution is as follows:

[0006] A Brazilin mutant, wherein the Brazilin mutant is obtained by mutating any one of the following amino acid mutations (1) to (6) of the Brazilin with the amino acid sequence shown in SEQ ID No. 1:

[0007] (1)D50A; represents replacing the 50th position aspartic acid with alanine;

[0008] (2)E36R; This means that the glutamic acid at position 36 is replaced with arginine;

[0009] (3)D29K; represents replacing the 29th aspartic acid with lysine;

[0010] (4) D29K and D50A; represent replacing the 29th aspartic acid with lysine and the 50th aspartic acid with alanine;

[0011] (5) E36R and D50A; represent replacing glutamic acid at position 36 with arginine and replacing aspartic acid at position 50 with alanine;

[0012] (6) D29K and E36R; represent replacing the 29th position aspartic acid with lysine and the 36th position glutamic acid with arginine.

[0013] The amino acid sequence of the Brazilian sweet protein, as shown in SEQ ID No. 1, is Brazzein, which is derived from the West African plant Pentadiplandra brazzeana Baillon.

[0014] Preferably, the amino acid sequence of the Brazilian sweet protein mutant obtained by any one of (1) to (6) is as shown in SEQ ID No. 2 to 7.

[0015] The aforementioned Brazil saccharin mutant is obtained by modifying the amino acid sequence of Brazil saccharin, as shown in SEQ ID No. 1, through amino acid mutations of D29K and D50A, or through amino acid mutations of E36R and D50A.

[0016] In a second aspect, the present invention provides a gene encoding the Brazilian sweet protein mutant described in the first aspect.

[0017] Thirdly, the present invention provides an expression cassette or recombinant vector containing the gene described in the second aspect.

[0018] Fourthly, the present invention provides recombinant bacteria containing the expression cassette or recombinant vector described in the third aspect.

[0019] The recombinant strain is derived from Pichia pastoris. Preferably, it is Pichia pastoris GS115.

[0020] More preferably, the recombinant bacteria are constructed by linking the vector pPIC9K with the gene encoding the Brazil sweet protein mutant and transforming it into the Pichia pastoris starting strain.

[0021] Fifthly, the present invention provides the application of the recombinant bacteria described in the fourth aspect in the fermentation production of Brazilin mutants.

[0022] The recombinant bacteria were inoculated into the first culture medium and cultured at 28–32°C until OD200. 600 After 3-4 hours, the culture medium was transferred to a second culture medium and cultured at 28-32°C for another 96-144 hours to obtain the Brazil sweet protein mutant. Preferably, the mutant was cultured at 30°C until OD... 600 After 3-4 hours, transfer to the second culture medium and continue culturing at 30°C for 120 hours.

[0023] The first culture medium is a glycerol-containing buffered complete culture medium BMGY; the second culture medium is a methanol-containing buffered complete culture medium BMMY; during the culture process after transfer, methanol is added every 24 hours, with each addition being 0.5% to 2% of the fermentation broth volume. Preferably, the methanol addition volume is 0.5%.

[0024] Sixthly, the present invention provides the application of the brassinoprotein mutant described in the first aspect as a sweetener in the food or medical excipient fields. The brassinoprotein mutant can improve the sweetness properties of brassinoprotein, with its sweetness increasing by 240% compared to the unmutated brassinoprotein.

[0025] Beneficial effects:

[0026] This invention provides a Brazil sweet protein mutant, which, when expressed in Pichia pastoris, has a sweetness that is 240% higher than that of the unmutated Brazil sweet protein, and can be widely used in the food and pharmaceutical fields. Attached Figure Description

[0027] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0028] Figure 1 This is a PCR identification diagram of the recombinant strain GS115 / pPIC9K-Bra. M represents a 5000bp marker; 1-4 correspond to four different positive clones.

[0029] Figure 2 This is a PCR identification diagram of the mutant plasmid. In the diagram, M represents the 5000bp Marker; 0 represents the plasmid vector pPIC9K-Bra; and 1-6 correspond to the recombinant plasmids pPIC9K-Bra-Asp29Lys, pPIC9K-Bra-Glu36Arg, pPIC9K-Bra-Asp50Ala, pPIC9K-Bra-Asp29Lys-Glu36Arg, pPIC9K-Bra-Asp29Lys-Asp50Ala, and pPIC9K-Bra-Glu36Arg-Asp50Ala, respectively.

[0030] Figure 3SDS-PAGE image for identifying recombinant Saccharomyces cerevisiae with introduced mutant protein. M represents a 66.0 kDa Marker; 0 represents the unmutated strain GS115 / pPIC9K-Bra; 1-6 correspond to strains GS115 / pPIC9K-Bra-Asp29Lys, GS115 / pPIC9K-Bra-Glu36Arg, GS115 / pPIC9K-Bra-Asp50Ala, GS115 / pPIC9K-Bra-Asp29Lys-Glu36Arg, GS115 / pPIC9K-Bra-Asp29Lys-Asp50Ala, and GS115 / pPIC9K-Bra-Glu36Arg-Asp50Ala, respectively.

[0031] Figure 4 The sweetness of the mutant proteins is measured relative to standard sucrose. 1 represents the unmutated protein Bra; 2-7 correspond to the mutant proteins Bra-Asp29Lys, Bra-Glu36Arg, Bra-Asp50Ala, Bra-Asp29Lys-Glu36Arg, Bra-Asp29Lys-Asp50Ala, and Bra-Glu36Arg-Asp50Ala, respectively. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to specific embodiments. The following examples are merely descriptive and not definitive, and should not be used to limit the scope of protection of the present invention.

[0033] Unless otherwise specified, the raw materials used in this invention are all conventional commercially available products; the methods used in this invention are all conventional methods in the field unless otherwise specified.

[0034] The culture medium used in this invention can be as follows:

[0035] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;

[0036] YPD medium: tryptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L;

[0037] Solid culture medium is liquid culture medium with added agar powder at a concentration of 20 g / L;

[0038] MD solid medium: glucose 20 g / L, YNB 13.4 g / L, biotin 0.4 mg / L, agar powder 20 g / L.

[0039] Glycerol-buffered complete medium (BMGY): tryptone 20 g / L, yeast extract 10 g / L, amino acid- and ammonium sulfate-free yeast nitrogen source 3.4 g / L, ammonium sulfate 10 g / L, glycerol 20 g / L, biotin 0.4 mg / L, 100 mL / L 1 M (pH 6.0) phosphate buffer;

[0040] Methanol-buffered complete medium (BMMY): tryptone 20 g / L, yeast extract 10 g / L, yeast nitrogen source without amino acids and ammonium sulfate 3.4 g / L, ammonium sulfate 10 g / L, methanol 2% v / v, biotin 0.4 mg / L, 100 mL / L 1 M (pH 6.0) phosphate buffer.

[0041] The invention will be further illustrated below with examples.

[0042] Example 1: Construction of a recombinant Pichia pastoris engineered strain expressing brassinolide

[0043] 1. Construction of expression vector pPIC9K-Bra

[0044] Using the Brazzein (Bra) gene from the West African plant *Pentadiplandra brazzeana* Baillon as a template, the amino acid sequence of which is shown in SEQ ID No. 1, primers Bra-F (tgaagcttacgta) were designed based on the Brazzein gene sequence (KF013250) in GenBank. gaattc atggacaaatgcaaaaaagtg, underlined indicates EcoRI restriction site) and Bra-R (tgcgactactgcgaatactaa gcggccgc The gaattaattcg enzyme (underlined indicates the NotI restriction site) was used for PCR amplification. The amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 10 s, for 30 cycles; and 72℃ extension for 5 min. The PCR product was recovered from the gel and ligated into the pPIC9K vector, which had been digested with EcoRI and NotI, in a one-step cloning process. This ligation was then transformed into *E. coli* DH5α competent cells, and sequencing, colony PCR, and EcoRI and NotI double digestion verification were performed. The verified recombinant vector pPIC9K-Bra was used to transform *Pichia pastoris* competent cells to construct the recombinant strain GS115 / pPIC9K-Bra.

[0045] 2. Pichia pastoris was transformed with expression vector pPIC9K-Bra.

[0046] The expression vector pPIC9K-Bra obtained in step (1) was linearized by SalI digestion, recovered by gel extraction, and dissolved in 30-50 μL of sterile ddH2O. 5-10 μg of the linearized plasmid was mixed with 90 μL of Pichia pastoris GS115 competent cells and transformed by electroporation. After screening on MD plates, the recombinant strain GS115 / pPIC9K-Bra was obtained, and positive clones were selected for PCR identification. The results are as follows: Figure 1 As shown, there is a clear band at the 600bp position, which is consistent with the expected fragment size, indicating that the linearized recombinant plasmid was successfully integrated into the P. pastoris GS115 genome chromosome.

[0047] Simultaneously, the vector pPIC9K was linearized by SalI single enzyme digestion, recovered by gel, and dissolved in 30-50 μL of sterile ddH2O. 5-10 μg of the linearized plasmid was mixed with 90 μL of Pichia pastoris GS115 competent cells and then electroporated to obtain the control strain GS115 / pPIC9K.

[0048] 3. Protein production from Pichia pastoris transformant GS115 / pPIC9K-Bra fermentation

[0049] The recombinant strain GS115 / pPIC9K-Bra and the control strain GS115 / pPIC9K constructed in step (2) were inoculated into YPD medium and cultured at 30℃ with shaking at 200 rpm for 24 h to obtain seed culture. The seed culture was then inoculated into glycerol-buffered complete medium (BMGY) at a 10% v / v inoculation rate and cultured at 30℃ and 200 rpm until OD... 600 After centrifugation to collect the bacterial cells (3-4), they were transferred to methanol-buffered complete medium (BMMY) and cultured at 30°C and 200 rpm for 120 h, with methanol added every 24 h at 0.5% of the fermentation broth volume. The supernatant of the induced bacterial culture was collected by centrifugation and used to determine its sweetness and concentration.

[0050] Example 2: Determination of the site-directed mutation site of the Brazilian sweet protein gene

[0051] The Brazilian sweet protein gene (KF013250) was simulated using a computer, and three key sites were selected for site-directed mutagenesis. Amino acid sites 29, 36, and 50, which may be related to sweetness performance, were selected.

[0052] The original position 29 was aspartic acid (Asp), the original position 36 was glutamic acid (Glu), and the original position 50 was aspartic acid (Asp). In this invention, the position 29 will be mutated to lysine (Lys), the position 36 to arginine (Arg), and the position 50 to alanine (Ala) by site-directed mutagenesis via reverse PCR.

[0053] Primers were designed for the selected mutation sites using SnapGene, as shown in Table 1.

[0054] Table 1 Primer sequences used for site-directed mutagenesis.

[0055]

[0056] The recombinant plasmid pPIC9K-Bra prepared in Example 1 was extracted using a kit from Nanjing Novizan Biotechnology Co., Ltd.

[0057] Using Asp29Lys-F and Asp29Lys-R as primers, the aspartic acid at position 29 of the amino acid sequence of brassinoprotein was mutated to construct the recombinant plasmid pPIC9K-Bra-Asp29Lys.

[0058] Using Glu36Arg-F and Glu36Arg-R as primers, the glutamic acid at position 36 was mutated to construct the recombinant plasmid pPIC9K-Bra-Glu36Arg.

[0059] The 50th aspartic acid was mutated using Asp50Ala-F and Asp50Ala-R primers to construct the recombinant plasmid pPIC9K-Bra-Asp50Ala.

[0060] The PCR reaction system was as follows: 25 μL 2×Phanta Master Mix, 19 μL ddH2O, 2 μL each of 20 μM forward and reverse primers, and 2 μL template DNA, for a total volume of 50 μL. Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 10 min; 30 cycles; 72℃ extension for 5 min. The PCR products were then subjected to agarose gel electrophoresis.

[0061] After a single mutation is successful, using the single-point mutation plasmid as a template, another pair of mutation primers are used to introduce a second mutation site according to the same PCR system, that is, to construct the double mutation sites Asp29Lys-Glu36Arg, Asp29Lys-Asp50Ala, and Glu36Arg-Asp50Ala.

[0062] After the PCR reaction was completed, 1 μL DpnⅠ was added directly to the PCR reaction system, mixed well, and incubated in a metal bath at 37°C for 1 h.

[0063] The PCR products were purified using a kit from Nanjing Novizan Biotechnology Co., Ltd. The single-mutant and double-mutant recombinant plasmids were transformed into *E. coli* DH5α competent cells to obtain recombinant bacteria. Single clones of the recombinant bacteria were picked, and plasmids were extracted from them: pPIC9K-Bra-Asp29Lys, pPIC9K-Bra-Glu36Arg, pPIC9K-Bra-Asp50Ala, pPIC9K-Bra-Asp29Lys-Glu36Arg, pPIC9K-Bra-Asp29Lys-Asp50Ala, and pPIC9K-Bra-Glu36Arg-Asp50Ala.

[0064] The recombinant vectors pPIC9K-Bra-Asp29Lys, pPIC9K-Bra-Glu36Arg, pPIC9K-Bra-Asp50Ala, pPIC9K-Bra-Asp29Lys-Glu36Arg, pPIC9K-Bra-Asp29Lys-Asp50Ala, and pPIC9K-Bra-Glu36Arg-Asp50Ala were digested with EcoRI and NotI, and then subjected to agarose gel electrophoresis, as follows: Figure 2 All target fragments were of equal length, indicating they were the correct target fragment length. Recombinant vectors that passed enzyme digestion were selected and sent to General Biotechnology (Anhui) Co., Ltd. for sequencing. The nucleotide sequence alignment of the amplified Brazil sweet protein gene showed a 99.23% consistency, with all nucleotide sequences except for the mutation site being completely identical. This verification demonstrates the successful construction of the recombinant plasmid.

[0065] The recombinant plasmid constructed in this embodiment was transformed into Pichia pastoris GS115 according to the method described in Example 1 to obtain a recombinant strain. The recombinant strain was then fermented to produce protein according to the method described in Example 1. SDS-PAGE analysis was performed as follows. Figure 3 As shown, there is a distinct band at a molecular weight of 6.5 kDa, which is basically consistent with the size of the sweet protein Brazzein.

[0066] Example 3 Sweetness Detection

[0067] The method for determining the expression level of the sweet protein Brazzein in this invention can be as follows:

[0068] Accurately weigh 0.05 g of crystalline bovine serum albumin into a beaker using an analytical balance, dissolve it in a small amount of distilled water, and then transfer it to a 50 mL volumetric flask. Rinse the remaining liquid in the beaker several times with a small amount of distilled water, pour the rinsing solution into the volumetric flask, and finally dilute to the mark with distilled water to complete the preparation of the standard protein, in which the concentration of bovine serum albumin is 1 g / L.

[0069] The standard curve is plotted by taking 6 test tubes, numbering them, and adding reagents according to Table 2 and mixing them well.

[0070] Table 2. Method for plotting standard curve concentrations

[0071] Pipe number 1 2 3 4 5 6 Sample (mL) 0 0.4 0.8 1.2 1.6 2 Distilled water (mL) 2 1.6 1.2 0.8 0.4 0 Protein concentration (g / L) 0 0.2 0.4 0.6 0.8 1.0

[0072] The samples were subjected to SDS-PAGE protein electrophoresis, and the images were obtained using an optical density scanner. The SDS-PAGE images were analyzed using ImageJ software to obtain the absolute gray values ​​of the protein samples to be tested. A standard curve was plotted with protein concentration on the x-axis and absolute gray values ​​on the y-axis.

[0073] The sample detection method is to perform SDS-PAGE protein electrophoresis, image the sample using an optical density scanner, analyze the SDS-PAGE image using ImageJ software, obtain the absolute gray value of the protein in the sample, and calculate the protein concentration based on the standard curve.

[0074] The results showed that the protein content of unmutated Brazzein in the recombinant bacteria at the shake-flask level was 0.64 g / L; the protein content of Bra-Asp29Lys mutant was 0.65 g / L; the protein content of Bra-Glu36Arg mutant was 0.51 g / L; the protein content of Bra-Asp50Ala mutant was 0.61 g / L; the protein content of Bra-Asp29Lys-Glu36Arg mutant was 0.63 g / L; the protein content of Bra-Asp29Lys-Asp50Ala mutant was 0.61 g / L; and the protein content of Bra-Glu36Arg-Asp50Ala mutant was 0.59 g / L.

[0075] The method for detecting the sweetness of the sweet protein Brazzein in this invention can be as follows:

[0076] The protein sample obtained from fermentation in the above embodiments was rinsed with distilled water. Replace the target protein solution in the Ultra-15 ultrafiltration centrifuge tube to obtain a protein sample for sweetness threshold determination.

[0077] The sweetness threshold refers to the lowest concentration at which the sweetness of protein can be tasted. This study used a double-blind, manual tasting method for determination. Ten volunteers with average gender and age were selected. The protein sample concentration was initially set to 0.5 g / L using distilled water. Subsequent solutions were prepared at different dilutions: 0.5, 0.4, 0.3, 0.2, 0.1, 0.05, and 0.01 g / L. A 10 g / L sucrose solution served as the control group. Volunteers tasted 2 mL of sucrose solution first, followed by 2 mL of protein sample, tasting in ascending order of sweetness. After each tasting, volunteers rinsed their mouths with deionized water until no taste remained. All samples were held on the tip of the tongue for at least 15 seconds before spitting out. The sweetness intensity rating for different concentrations was as follows: 0, no sweetness or uncertain sweetness; 1, slightly sweet; 2, sweet; 3, very sweet; 4, very sweet. The average value was used as the result. Samples with a score of 2 were selected as the sweetness threshold and compared with the 10 g / L sucrose solution. The sweetness of the sample is obtained using the following formula: Sweetness multiple relative to sucrose = 10 / Dilution multiple of the sample that tastes sweet.

[0078] The results are as follows Figure 4 As shown, the sweetness of unmutated Brazzein in recombinant bacteria at the shake-flask level was 2000 times that of standard sucrose; the sweetness of the Bra-Asp29Lys mutant was 2800 times that of standard sucrose; the sweetness of the Bra-Glu36Arg mutant was 3200 times that of standard sucrose; the sweetness of the Bra-Asp50Ala mutant was 3200 times that of standard sucrose; the sweetness of the Bra-Asp29Lys-Glu36Arg mutant was 4000 times that of standard sucrose; the sweetness of the Bra-Asp29Lys-Asp50Ala mutant was 6800 times that of standard sucrose; and the sweetness of the Bra-Glu36Arg-Asp50Ala mutant was 4800 times that of standard sucrose.

[0079] The Brazilian sweetener mutant provided by this invention can be widely used as a sweetener in the food, biological, and pharmaceutical fields, and has broad application prospects.

[0080] This invention provides a Brazilian sweet protein mutant and its application, along with a method and approach. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A mutant of Brazilin, characterized in that, The aforementioned Brazilin mutant is obtained by modifying the amino acid sequence of Brazilin, as shown in SEQ ID No. 1, through amino acid mutations of D29K and D50A, or through amino acid mutations of E36R and D50A.

2. The gene encoding the Brazilian sweet protein mutant of claim 1.

3. An expression cassette or recombinant vector containing the gene of claim 2.

4. Recombinant bacteria containing the expression cassette or recombinant vector as described in claim 3.

5. The recombinant bacteria according to claim 4, characterized in that, The recombinant strain originated from Pichia pastoris. Pichia pastoris .

6. The use of the recombinant bacteria according to claim 4 or 5 in the fermentation production of Brazilin mutants.

7. The application according to claim 6, characterized in that, The recombinant bacteria were inoculated into the first culture medium and cultured at 28-32°C until OD200 was reached. 600 After 3-4 hours, the culture medium was transferred to the second culture medium and cultured at 28-32 °C for 96-144 hours to obtain the Brazil sweet protein mutant.

8. The application according to claim 7, characterized in that, The first culture medium is a buffered complete culture medium BMGY containing glycerol; the second culture medium is a buffered complete culture medium BMMY containing methanol. After being transferred to the second culture medium, methanol was added every 24 hours during the culture process, with each addition being 0.5% to 2% of the fermentation broth volume.

9. The use of the Brazilian sweet protein mutant as a sweetener in the food or medical excipient fields according to claim 1.

Citation Information

Patent Citations

  • Preparation method of sweet protein

    CN117568380A

  • Beverages comprising protein sweeteners with improved taste and mouthfeel

    CN118647282A