Fluorinated guanidyl block copolymer carrier as well as preparation method and application thereof

Abstract

The invention provides a fluorinated guanidyl segmented copolymer carrier as well as a preparation method and application thereof. The fluorinated guanidyl segmented copolymer carrier is obtained by grafting a positively charged group and a fluorinated modification group on a polyethylene glycol carrier. The carrier is endowed with excellent hydrophobicity and chemical stability through a fluorinated chain segment, so that the stability and degradation resistance of the carrier in a living body are enhanced, and efficient gene delivery is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedical materials, and in particular relates to a fluorinated guanidine-based block copolymer carrier and a preparation method and application thereof. Background Art

[0002] Cardiovascular disease is the leading cause of death worldwide, and hyperlipidemia (especially hypercholesterolemia) is one of the main risk factors for cardiovascular disease. The development of lipid-lowering drugs is of great significance for preventing the occurrence and development of cardiovascular disease. Up to now, lipid-lowering therapeutic drugs targeting low-density lipoprotein cholesterol (LDL-C), an important target, have become an important means of preventing and treating cardiovascular disease (ASCVD). At present, the lipid-lowering drugs widely used in clinical practice include statins, cholesterol absorption inhibitors, and PCSK9 inhibitors. However, these drugs have many shortcomings during use, such as side effects such as liver damage and muscle pain, and the need for frequent administration.

[0003] Gene therapy has become an effective treatment strategy for infectious diseases, cancer, genetic diseases, etc. Through gene editing technology, the expression of genes related to blood lipid metabolism can be targeted and regulated, thereby achieving more accurate and efficient lipid-lowering treatment. However, the naturally existing high molecular weight, strong negative charge and easy degradation of nucleic acid molecules make their loading and in vivo transportation a key problem that needs to be solved in the field of drug delivery. Fluorinated guanidine-based block copolymers, as gene editing delivery vectors, can efficiently deliver gene editing tools (such as CRISPR / Cas9 system, small interfering RNA, etc.) to target cells, achieving precise regulation of genes related to blood lipid metabolism. Summary of the invention

[0004] In order to solve the problems in the prior art, the present invention provides a fluorinated guanidine block copolymer carrier and its preparation method and application. The fluorinated guanidine block copolymer is prepared by a specific synthesis path. The fluorinated segment gives the carrier excellent hydrophobicity and chemical stability, which helps to enhance the stability and anti-degradation ability of the carrier in the organism and achieve efficient gene delivery. By controlling the polymerization reaction conditions and block ratio, the physical and chemical properties of the fluorinated guanidine block copolymer are optimized, thereby improving its performance as a gene editing delivery carrier.

[0005] The present invention solves the technical problem by adopting the following technical solutions:

[0006] The first object of the present invention is to provide a fluorinated guanidine-based block copolymer carrier, which is obtained by grafting positively charged groups and fluorinated modified groups on a polyethylene glycol carrier.

[0007] Furthermore, the structural formula of the fluorinated guanidine-based block copolymer carrier is

[0008]

[0009] Wherein, x, y, and z are number average polymerization degrees, x is a natural number of 5 to 200, y is a natural number of 1 to 500, z is a natural number of 1 to 500, R1 is a positively charged group, and R2 is a fluorinated modified group.

[0010] Furthermore, the positively charged group is selected from one or more of a guanidine group, an amine group, a nitrogen-containing heterocyclic group, a quaternary ammonium salt group, an amine ester group, and an amine oxygen group, and the fluorinated modification group is selected from one or more of a fluorinated alkyl group, a fluorinated aryl group, a fluorinated ether group, a fluorinated ester group, and a fluorinated amine group.

[0011] The second object of the present invention is to provide a method for preparing a fluorinated guanidine block copolymer carrier, comprising the following steps: mixing PEG-CPADN, a positively charged group, and a fluorinated modified group, adding an initiator, reacting at high temperature overnight under the protection of an inert gas, dialyzing the reaction solution in pure water, and freeze-drying to obtain the fluorinated guanidine block copolymer carrier.

[0012] Furthermore, the positively charged group is a guanidine side chain, the fluorinated modification group is heptafluorobutyl methacrylate, and the initiator is AIBN.

[0013] Furthermore, the fluorinated guanidine block copolymer carrier is PEG-bP (FBM), and the structural formula of the PEG-bP (FBM) is:

[0014]

[0015] Wherein, x, y, and z are number average polymerization degrees, x is a natural number of 5 to 200, y is a natural number of 1 to 500, and z is a natural number of 1 to 500.

[0016] The third object of the present invention is to provide a gene editing tool delivery system, which includes the above-mentioned fluorinated guanidine block copolymer carrier and a nucleic acid drug, and the nucleic acid drug is encapsulated in the fluorinated guanidine block copolymer carrier.

[0017] Furthermore, the preparation method of the delivery system is: placing the nucleic acid drug in an ice bath, then quickly mixing the nucleic acid drug with the fluorinated guanidine block copolymer carrier, and incubating at room temperature to encapsulate the nucleic acid drug in the fluorinated guanidine block copolymer carrier to obtain the nano delivery system.

[0018] Furthermore, the nucleic acid drug is selected from one or more of clustered regularly interspaced short palindromic repeats-associated nucleases, zinc finger nucleases, transcription activator-like effector nucleases, siRNA, and ShRNA.

[0019] Furthermore, the mass ratio of the nucleic acid drug to the fluorinated guanidine-based block copolymer carrier is 1:1 to 1:10.

[0020] Furthermore, the nucleic acid drug is CRISPR / Cas9, and the CRISPR / Cas9 is obtained by complexing Cas9-mRNA and gRNA.

[0021] Furthermore, the molar ratio of Cas9-mRNA to gRNA in the CRISPR / Cas9 is 1:1 to 1:5.

[0022] Furthermore, the reaction time of Cas9-mRNA and gRNA is 15 to 30 minutes.

[0023] Furthermore, the gRNA is a sgRNA targeting the LPA gene, and the sequence of the sgRNA targeting the LPA gene is shown in SEQ ID NO: 1.

[0024] Furthermore, the diameter of the delivery system is 50 to 200 nm.

[0025] The fourth object of the present invention is to provide the use of the above-mentioned first object fluorinated guanidine block copolymer vector and the third object gene editing tool delivery system in constructing an animal model.

[0026] Furthermore, the animal model is a transgenic mouse model of humanized LPA and APOB (B6-hLPA*hAPOB-tg).

[0027] The fifth object of the present invention is to provide the application of the animal model constructed as above in screening cardiovascular disease drugs.

[0028] Furthermore, the cardiovascular diseases include but are not limited to atherosclerosis, hypertension, coronary heart disease, myocardial infarction and stroke.

[0029] Compared with the prior art, the beneficial technical effects of the present invention are:

[0030] 1) Lp(a) is an independent risk factor for cardiovascular disease, and its plasma level is almost entirely regulated by the LPA gene, but there is currently no effective treatment to reduce Lp(a) levels. The present invention can accurately edit the Lp(a) synthetic gene through CRISPR / Cas9 technology, specifically regulate the level of Lp(a), and thus block or slow down the progression of cardiovascular disease at the genetic level. This efficient gene editing technology makes individualized treatment possible, because different individuals may have different metabolism and responses to Lp(a). CRISPR / Cas9 technology can be precisely adjusted according to individual genetic characteristics to improve the pertinence and effectiveness of treatment. In addition, CRISPR / Cas9 has a persistent effect. Through a single gene editing, long-term regulation of Lp(a) levels can be achieved, reducing the need for frequent medication and improving patient convenience and treatment compliance. CRISPR / Cas9 to reduce plasma Lp(a) levels has the characteristics of strong pertinence and lasting effect, and is expected to become an emerging means in the field of atherosclerosis treatment.

[0031] 2) The present invention designs a fluorinated guanidine block copolymer that produces multiple molecular interactions for RNA loading, achieving effective loading and efficient delivery of CRISPR / Cas9, and providing a more feasible solution for applications in gene therapy and other fields. The fluorinated guanidine block copolymer vector of the present invention has high gene delivery efficiency and good biocompatibility. In lipid-lowering therapy, the vector can significantly reduce lipoprotein levels in target cells without obvious cytotoxicity and immunogenicity.

[0032] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented according to the contents of the specification. In order to make the above and other purposes, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is the hydrogen nuclear magnetic resonance spectrum of PEG-bP (FBM) of the present invention.

[0034] Figure 2 This is a transmission electron micrograph of nanoparticles assembled from PEG-bP (FBM) and mRNA in Example 3 of the present invention.

[0035] Figure 3 It is the hydrated particle size before and after assembly of Example 3 of the present invention.

[0036] Figure 4 3 is the potential diagram before and after assembly of Example 3 of the present invention.

[0037] Figure 5 This is a comparison chart of the encapsulation efficiency after assembly of Example 3 of the present invention.

[0038] Figure 6 This is a diagram showing the co-localization of Cy5.5-gRNA with the cell nucleus and lysosome under a confocal microscope in Example 4 of the present invention.

[0039] Figure 7 This is a diagram showing the effect of the assembled nanodelivery system on LPA gene editing in Example 4 of the present invention.

[0040] Figure 8 This is a graph showing the difference in Lp(a) levels in the liver of mice after a period of treatment in the animal experiment of Example 5 of the present invention. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the following embodiments are only exemplary illustrations and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope of protection that the present invention is intended to protect.

[0042] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0043] It should be noted that "CPADN" in the present invention refers to 4-cyano-4-(phenylthioformylthio) pentanoic acid, and the structural formula is:

[0044]

[0045] Example 1: Synthesis and verification of fluorinated guanidine-based block copolymers

[0046] Synthesis method of PEG-bP(FBM):

[0047] Take 50.0 mg PEG-CPADN, 79.8 mg N-(2-(3-aminoimidoguanidine)ethyl)methacrylamide, 100.6 mg heptafluorobutyl methacrylate, add 0.1-1 mg initiator azobisisobutyronitrile, under the protection of inert gas, react overnight at 70-90°C. The reaction solution is dialyzed in pure water and freeze-dried to obtain fluorinated guanidine block copolymer PEG-bP (FBM).

[0048] The reaction formula is as follows:

[0049]

[0050] Structural verification of PEG-bP(FBM):

[0051] The lyophilized powder of the fluorinated guanidine polymer PEG-bP (FBM) obtained in this example was vacuum dried, and then the powder was dissolved in deuterated dimethyl sulfoxide and placed in a nuclear magnetic resonance tube. The chemical structure of the fluorinated guanidine block copolymer was detected by nuclear magnetic resonance hydrogen spectrum. The results are as follows Figure 1 As shown, PEG-bP(FBM) was successfully synthesized.

[0052] Example 2: Construction method of fluorinated guanidine block copolymer CRISPR / Cas9 nano-delivery system

[0053] Construction of PEG-bP(FBM) / Cas9-mRNA / gRNA nano-delivery system:

[0054] First, Cas9-mRNA and gRNA were mixed at a molar ratio of 1:1 to 1:5, and then placed in an ice bath. The mixture of Cas9-mRNA and gRNA was then quickly mixed with PEG-bP (FBM) obtained in Example 1 at a mass ratio of 1:5 for 20 minutes, and the nano delivery system was obtained after incubation at room temperature.

[0055] The gRNA is a sgRNA targeting the LPA gene, and the sequence of the sgRNA targeting the LPA gene is AAGTGTCCTTGCGACGTCCA (as shown in SEQ ID NO: 1).

[0056] The nano delivery system used in Examples 3 to 5 is the delivery system prepared in Example 2.

[0057] Example 3: Assembly performance of fluorinated guanidine-based block copolymers with CRISPR / Cas9 system

[0058] Methods: The assembly performance of polymer and CRISPR / Cas9 system was investigated by transmission electron microscopy, Malvern particle size analyzer, Ribogreen and other methods.

[0059] (1) Characterization by transmission electron microscopy:

[0060] The freeze-dried powder of the assembled fluorinated guanidine polymer PEG-bP (FBM) obtained in Example 2 was resuspended with an appropriate amount of pure water, and after being evenly dispersed, the suspension was dripped onto a copper mesh, air-dried at room temperature, and the morphology and dispersibility of the particles were observed by transmission electron microscopy. Figure 2 As shown, the average particle size of the assembled nanodelivery system is about 100 nm, with uniform size and good dispersibility.

[0061] (2) Malvern particle sizer characterization. Take a small amount of polymer and assemble it with the Cas9-mRNA and gRNA system at a mass ratio of 5:1. After it is evenly dispersed, the hydrated particle size and potential changes before and after assembly are detected in a Malvern particle sizer. The hydrated particle size results are shown in Figure 2. Figure 3 The potential results are shown as Figure 4 As shown. It can be seen that the single PEG-bP (FBM) polymer has a positive charge, the RNA before assembly has a positive charge, and the assembled PEG-bP (FBM) / Cas9-mRNA / gRNA has a weak positive charge, with a potential of about +10mV. After being encapsulated by PEG-bP (FBM), the particle size decreases slightly, and the uniformity is good, which is conducive to promoting the cell's uptake of nanomedicines and providing the possibility for the fluorinated guanidine block copolymer CRISPR / Cas9 nano delivery system to enter the human body.

[0062] (3) Ribogreen was used to detect the encapsulation efficiency.

[0063] ①Establishment of standard curve for determining nucleic acid encapsulation efficiency using the Ribogreen method.

[0064] ② Determination of sample encapsulation efficiency. After the delivery system after assembling CRISPR / Cas9 was evenly dispersed, the encapsulation efficiency was determined by an ELISA instrument. A positive control group was set up, and the results were as follows: Figure 5 As shown, compared with the positive control group (PEI), the encapsulation rate of the delivery system after assembling CRISPR / Cas9 reached 87%, far exceeding the positive control group.

[0065] Example 4: Transfection efficiency of nanodelivery system

[0066] After the nano-delivery system was used to treat HepG2 cells for 48 hours, confocal microscopy was used to observe whether the fluorinated guanidine polymer PEG-bP (FBM) could mediate gRNA to escape from the endosomal structure and enter the cell nucleus; qPCR was used to detect the LPA gene in the cells. The specific method is as follows:

[0067] (1) The polymer PEG-bP (FBM) mediates gRNA to escape from endosomal structures and enter the cell nucleus.

[0068] ①Cy5.5 fluorescently labeled gRNA. Add 35μL DNase-free water, 5μL 10×loading bμfferA, 5μL 100ng / mL gRNA, and 5μL LableL7Regent to the EP tube in sequence and incubate at 37°C for 1h. Vortex the G50 microglobulin column briefly, place the column in a 1.5mL enzyme-free EP tube, centrifuge at 735×g for 1min, and remove the buffer. Slowly apply the RNA sample to the surface of the G50 microglobulin column, centrifuge at 735×g for 2min, and collect the liquid in the centrifuge tube, which is the Cy5.5 fluorescently labeled gRNA (Cy5.5-gRNA).

[0069] ② Transfection. According to the method of Example 2, a certain mass ratio of Cas9-mRNA and Cy5.5-gRNA was added to PEG-bP (FBM), and incubated at room temperature for a period of time to obtain a transfection complex solution. The transfection complex solution was added to HepG2 cells and incubated for a period of time.

[0070] ③ Lysosome staining: Change the cell medium, wash with PBS three times, add 1 mL of lysoTracker, and incubate at 37°C for 20 min.

[0071] ④ Nuclear staining: Change the medium, wash with PBS three times, add 1 mL of Hochest staining solution, and incubate at 37°C for 20 min.

[0072] ⑤ Observe the co-localization of Cy5.5-gRNA with the cell nucleus and lysosome under laser confocal microscope. Figure 6 Confocal observations before and after assembly showed that the red fluorescence of Cy5.5-gRNA had no obvious overlap with the green fluorescence of lysosomes, indicating that PEG-bP (FBM) could mediate RNA escape from endosomal structures; the red fluorescence of Cy5.5-gRNA overlapped with the blue fluorescence of the cell nucleus, indicating that after assembly, gRNA could enter cells well and successfully enter the cell nucleus, providing the possibility for gene editing.

[0073] (2) qPCR detection of LPA gene levels.

[0074] ① Extract RNA. Discard the old culture medium in the 6-well plate cell culture dish, wash the dish with PBS 3 times, add 500μL RNA lysis solution, blow with a pipette tip until the liquid is not sticky, transfer the sample to an enzyme-free EP tube after blowing, add 100μL chloroform and cover the EP tube tightly, shake until there is no stratification, let it stand for 5 minutes, centrifuge at 12000rcf for 15 minutes in a 4℃ centrifuge, aspirate the supernatant to a new enzyme-free EP tube, add isopropanol of the same volume as the supernatant aspirated in the previous step, mix it upside down and let it stand on ice for 10 minutes, centrifuge the sample after standing at 4℃ centrifuge at 12000rcf for 10 minutes. Discard the supernatant, add 75% ethanol along the tube wall, gently turn it upside down to wash the tube wall. Centrifuge at 12000rcf for 5 minutes, discard the ethanol, open the EP tube and dry it at room temperature for 2-5 minutes, add 20μl DEPC water to dissolve the precipitate, and measure the RNA concentration.

[0075] ②Reverse transcription: (O37A) reagent (total reaction system is 20 μL)

[0076]

[0077] The reverse transcription program was: 37°C for 15 min, 85°C for 5 s, and maintained at 4°C.

[0078] After reverse transcription, RNA was stored at -80°C and cDNA was stored at -20°C.

[0079] ③qPCR: (total reaction system is 25μl)

[0080]

[0081]

[0082] Forward primer sequence: TCCGAACAAGCACCGACTG (as shown in SEQ ID NO: 2)

[0083] Reverse primer sequence: GGTCCGACTATGCGAGTGT (as shown in SEQ ID NO: 3)

[0084] See also Figure 7 Compared with the positive control (PEI / Cas9-mRNA / sgLPA) delivery system, the PEG-bP(FBM) / Cas9-mRNA / sgLPA delivery system after assembling CRISPR / Cas9 can effectively deliver Cas9-mRNA and gRNA to edit the LPA gene, and the expression level of the LPA gene is significantly reduced.

[0085] Example 5: Anti-atherosclerotic properties of the nanodelivery system in mice.

[0086] Methods: ① Construction of mouse atherosclerosis model and treatment plan. Transgenic mice expressing humanized LPA and APOB (B6-hLPA*hAPOB-tg) were constructed by CRISPR Cas9, and AAV-PCSK 9 virus was injected into the tail vein and high cholesterol diet was given. After a period of modeling, nucleic acid drug treatment was given to the groups including blank group, positive control group, PEG-bP(FBM) / Cas9-mRNA / sgLPA.

[0087] The drug administration method is intravenous injection.

[0088] Administration time: 1-12 weeks after modeling, administration frequency is once every 2 days, and the nucleic acid dose is 35 mg / kg.

[0089] ② Evaluation of anti-atherosclerosis effect. After a period of treatment, the Lp(a) level in mice was detected by Western Blot. The detection method is as follows:

[0090] (1) Glue preparation: Take 8 mL of lower glue solution, 8 mL of lower glue buffer, and 160 μL of coagulation solution, add them to the mold, seal with ethanol, and wait for coagulation. Pour away the ethanol solution, wait for it to evaporate, add 4 mL of upper glue solution and coagulation solution, insert a comb, and wait for coagulation.

[0091] (2) Sample preparation: Take mouse liver tissue, add cell lysis buffer, transfer to EP tube, lyse for 30 min, centrifuge at 12000 rpm for 5 min at 4°C, take the supernatant and divide it into 0.5 mL centrifuge tubes and measure the content in an ELISA instrument. Sample loading: Take the blank group, positive control group, PEG-bP(FBM) / Cas9-mRNA / sgLPA group and add them to the sample loading wells.

[0092] (3) Electrophoresis: 80 V for 2 h.

[0093] (4) Membrane transfer: After cutting the gel according to the protein molecular weight, cover it with a layer of activated PVDF membrane and transfer at 200 mA for 90 min.

[0094] (5) Blocking: After transfer, place the PVDF membrane in BSA blocking solution and block for 10 min.

[0095] (6) Antibody incubation: Incubate the membrane with LPA primary antibody (Abcam Lp(a), Proteintech β-actin) at 4°C overnight, wash the membrane three times with TBST, incubate the membrane with secondary antibody (Proteintech Goat anti Rabbit) at room temperature for 30 min, and then wash away the excess secondary antibody with TBST.

[0096] (7) Development: Add developer onto the PVDF membrane, place it in a gel imager, and observe the bands.

[0097] See also Figure 8 After a period of treatment with the PEG-bP(FBM) / Cas9-mRNA / sgLPA delivery system, the Lp(a) level in the mouse liver was significantly reduced, and the expression of LPA protein in the mouse liver was significantly decreased, which shows that it has a positive effect on the improvement of cardiovascular diseases.

[0098] The serial numbers of the above embodiments of the present invention are only for description and do not represent the advantages or disadvantages of the embodiments.

[0099] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. A fluorinated guanidine-based block copolymer carrier, characterized in that: It is obtained by grafting positively charged groups and fluorinated modified groups on a polyethylene glycol carrier.

2. A fluorinated guanidine-based block copolymer carrier as claimed in claim 1, characterized in that: The structural formula of the fluorinated guanidine-based block copolymer carrier is Among them, x, y, and z are number average polymerization degrees, x is a natural number of 5 to 200, y is a natural number of 1 to 500, z is a natural number of 1 to 500, R1 is a positively charged group, and R2 is a fluorinated modified group.

3. A fluorinated guanidine-based block copolymer carrier as claimed in claim 1 or 2, characterized in that: The positively charged group is selected from one or more of a guanidine group, an amine group, a nitrogen-containing heterocyclic group, a quaternary ammonium salt group, an amine ester group, and an amineoxy group; and the fluorinated modification group is selected from one or more of a fluorinated alkyl group, a fluorinated aryl group, a fluorinated ether group, a fluorinated ester group, and a fluorinated amine group.

4. The method for preparing the fluorinated guanidine-based block copolymer carrier according to claim 1, characterized in that: The following steps are involved: After mixing PEG-CPADN, a positively charged group and a fluorinated modified group, an initiator is added, and the mixture is reacted at high temperature overnight under the protection of an inert gas. The solution after the reaction is dialyzed in pure water and then freeze-dried to obtain the fluorinated guanidine-based block copolymer carrier.

5. A method for preparing a fluorinated guanidine-based block copolymer carrier as claimed in claim 4, characterized in that: The positively charged group is a guanidine side chain, the fluorinated modification group is heptafluorobutyl methacrylate, and the initiator is AIBN.

6. A gene editing tool delivery system, characterized in that: The delivery system comprises the fluorinated guanidine-based block copolymer carrier according to any one of claims 1 to 3 and a nucleic acid drug, wherein the nucleic acid drug is encapsulated in the fluorinated guanidine-based block copolymer carrier.

7. A gene editing tool delivery system as claimed in claim 6, characterized in that: The preparation method of the delivery system is as follows: placing the nucleic acid drug in an ice bath, then quickly mixing the nucleic acid drug with the fluorinated guanidine block copolymer carrier, and incubating at room temperature to encapsulate the nucleic acid drug in the fluorinated guanidine block copolymer carrier to obtain the nano delivery system.

8. A gene editing tool delivery system as claimed in claim 6 or 7, characterized in that: The nucleic acid drug is selected from one or more of clustered regularly interspaced short palindromic repeats-associated nucleases, zinc finger nucleases, transcription activator-like effector nucleases, siRNA, and ShRNA.

9. Use of the fluorinated guanidine-based block copolymer vector according to any one of claims 1 to 3 and the gene editing tool delivery system according to any one of claims 6 to 8 in constructing an animal model.

10. Use of the animal model constructed by the application of claim 9 in screening drugs for cardiovascular diseases.

Images