Pseudomonas pinnatifida G-7 and application thereof

Abstract

The invention provides Pseudomonas pinnatifida G-7 and application thereof, and belongs to the technical field of agricultural microorganisms. The invention provides a pseudomonas pinnatifida G-7, and the preservation number of the pseudomonas pinnatifida G-7 is CGMCC (China General Microbiological Culture Collection Center) No.33127. The pseudomonas pinnatifida G-7 has the advantages that the preservation The Pseudomonas pinnatifida G-7 provided by the invention has salt-resistant, alkali-resistant and nitrogen-fixing and potassium-dissolving capabilities, can secrete auxin IAA and promote the formation of soil aggregates, and can promote the growth and development of plants and improve the stress resistance of the plants to saline-alkali environments. The strain preparation provided by the invention has a remarkable promoting effect on plant growth, can be used as a candidate strain of a plant nitrogen-fixing microbial inoculum and a barren saline-alkali land improvement functional microbial inoculum, and is beneficial to industrial production; the biological fertilizer prepared by using the strain can promote the growth of plants in saline-alkali soil, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and specifically relates to Pseudomonas pinnatifida G-7 and application thereof. Background Art

[0002] Saline-alkali land is a special type of soil widely distributed around the world. According to statistics, the global saline-alkali land area accounts for about 6.2% to 10% of the total land area, and its area is still increasing year by year due to factors such as climate change, unreasonable irrigation and seawater intrusion. These saline-alkali lands have high salt content, and high concentrations of salt cause many harms to plant growth. On the one hand, salt ions will interfere with the osmotic pressure balance of plant cells, causing plant cells to lose water, leading to yellowing, withering and even death of leaves; on the other hand, excessive sodium ions and other harmful ions accumulate in the plant body, which will destroy the enzyme activity in the cell, hinder photosynthesis, respiration and other physiological metabolic processes, and seriously inhibit the normal growth and development of plants, making it difficult for most common crops to survive directly on saline-alkali land.

[0003] As an indispensable component of the soil ecosystem, microorganisms play a vital role in material circulation, energy conversion, and soil structure improvement. Various microorganisms such as bacteria and fungi participate in the decomposition and synthesis of organic matter in the soil through their own unique metabolic activities. For example, some saprophytic bacteria can decompose plant and animal residues, convert complex organic macromolecules into simple inorganic small molecules, and release nitrogen, phosphorus, potassium and other nutrients necessary for plant growth for plant absorption and utilization; at the same time, some microorganisms can also secrete organic substances such as polysaccharides and proteins during the metabolic process. These substances can bond soil particles, improve the soil aggregation structure, increase soil aeration and water retention, and create a good soil physical environment for plant root growth.

[0004] In the special ecological environment of saline-alkali land, certain microorganisms show extraordinary growth-promoting potential. Some salt-alkali-tolerant microorganisms, such as halophilic bacteria and alkali-tolerant fungi, can not only adapt to high-salt and high-alkali conditions, but also promote plant growth through various mechanisms. They can secrete plant hormones, such as auxin and cytokinin, to stimulate the growth and development of plant roots, making the root system more developed and enhancing the plant's ability to absorb water and nutrients.

[0005] However, there are no reports on the application of Pseudomonas matsunensis in improving the salt-alkali tolerance of plants. Summary of the invention

[0006] The purpose of the present invention is to provide a Pseudomonas pinnatifida, which can be used to improve the salt-alkali tolerance of plants and promote the growth of plants in saline-alkali land.

[0007] The objective of the present invention is achieved through the following technical solutions:

[0008] The invention provides a Pseudomonas songnensis G-7, and the preservation number of the Pseudomonas songnensis G-7 is CGMCC No.33127.

[0009] The present invention provides a microbial preparation, comprising the Pseudomonas matsutani G-7 described in the above technical solution.

[0010] Preferably, the bacterial activity of Pseudomonas aeruginosa G-7 in the microbial preparation is ≥10 8 CFU / mL.

[0011] The present invention provides a method for preparing the microbial preparation described in the above technical solution, comprising:

[0012] The Pseudomonas matsutani G-7 is cultured in a culture medium to obtain a microbial preparation.

[0013] Preferably, the culture temperature is 28-32° C.; the culture is accompanied by rotation; the rotation speed is 180-200 r / min; and the culture time is 24-48 h.

[0014] The present invention provides the use of Pseudomonas pinnatifida G-7 described in the above technical solution in degrading straw.

[0015] The invention provides a bacterial fertilizer, the raw materials of which include: the Pseudomonas pinnatifida G-7 described in the above technical solution and straw.

[0016] The present invention provides a method for preparing the bacterial fertilizer described in the above technical solution, comprising the following steps:

[0017] The bacterial suspension of Pseudomonas songnensis G-7 was inoculated into a fermentation matrix containing straw for fermentation culture to obtain bacterial fertilizer.

[0018] The present invention provides the use of Pseudomonas songnensis G-7 described in the above technical solution in improving the salt-alkali tolerance of plants and / or promoting the growth of plants in saline-alkali soil.

[0019] Preferably, the method for promoting plant growth in saline-alkali soil includes any one or more of the following (1) to (7):

[0020] (1) Increase plant height;

[0021] (2) Increase plant biomass;

[0022] (3) Increase plant stem thickness;

[0023] (4) Improve plant SPAD value;

[0024] (5) Promote the growth of plant roots;

[0025] (6) increasing the accumulation of potassium and / or nitrogen in plant stems;

[0026] (7) Increase the accumulation of potassium and / or nitrogen in plant leaves.

[0027] The present invention provides a method for promoting plant growth in saline-alkali land, comprising:

[0028] During the plant growth stage, the microbial preparation described in the above technical solution and / or the bacterial fertilizer described in the above technical solution are applied near the roots.

[0029] Beneficial Effects of the Invention

[0030] The present invention provides a kind of Pseudomonas songnensis G-7, and the deposit number of the Pseudomonas songnensis G-7 is CGMCC No.33127. The Pseudomonas songnensis G-7 provided by the present invention has the ability of salt and alkali resistance, and can grow on a plate with 5wt.% NaCl and / or pH 11; it has the ability of nitrogen fixation, potassium solution and IAA production, and the potassium solution and IAA production abilities of 48h reach 14.47mg / L and 15.19mg / L respectively; and it can promote the formation of soil aggregates. The Pseudomonas songnensis G-7 provided by the present invention is applied to the planting of plants in saline-alkali land as a microbial fertilizer, which can improve the salt-alkali resistance of plants and promote the growth of plants. The present invention proves through potted plant experiments that adding rhizosphere Pseudomonas songnensis G-7 in saline-alkali soil can significantly improve the height of corn seedlings, aboveground biomass, root biomass, root length, root surface area, root volume and root tip number. The present invention proves through field experiments that when corn is planted in saline-alkali soil fields, adding rhizosphere Pseudomonas pinenensis G-7 can significantly increase the plant height, stem diameter, biomass, SPAD, and the accumulation of nitrogen and potassium in corn stalks and leaves. In summary, the Pseudomonas pinenensis G-7 provided by the present invention can improve the soil environment, promote plant growth, and has broad application prospects, and can be used as a candidate strain for salt-alkali tolerant bacterial agents.

[0031] Biological Deposit Description

[0032] Pseudomonas songnenensis G-7, classified and named: Pseudomonas songnenensis, was deposited on December 19, 2024 at the General Microbiology Center of the China Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCCNo.33127. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0034] Figure 1 This is the 16S rDNA phylogenetic tree of rhizospheric Pseudomonas pinunensis G-7;

[0035] Figure 2 This is the result of three consecutive cultivations of rhizospheric Pseudomonas pine G-7 on TSB solid medium;

[0036] Figure 3 The figure shows the result of three consecutive cultivations of rhizospheric Pseudomonas pinnatifida G-7 on TSB solid medium containing 5% NaCl;

[0037] Figure 4 This is the result of three consecutive cultures of rhizosphere Pseudomonas pine G-7 on TSB solid medium with a pH of 11;

[0038] Figure 5 This is the result diagram of nitrogen fixation ability of rhizosphere Pseudomonas pinnatifida G-7;

[0039] Figure 6 This is the result diagram of potassium solubilization ability of rhizosphere Pseudomonas pinnatifida G-7;

[0040] Figure 7 This is a standard curve for the determination of IAA production by Pseudomonas matsutani G-7;

[0041] Figure 8 This is the effect of rhizospheric Pseudomonas pinnatifida G-7 on soil aggregates (different colors represent different particle sizes);

[0042] Fig. 9 This is the result of the effect of Pseudomonas songnensis G-7 on Deka 159 seedlings in saline-alkali soil;

[0043] Fig.10 This is the result of the effect of Pseudomonas songnensis G-7 on the seedlings of Tiannong 9 in saline-alkali soil;

[0044] Fig.11 This is the result of the effect of Pseudomonas songnensis G-7 on the height of corn seedlings in saline-alkali soil;

[0045] Fig.12 This is the result diagram of the effect of Pseudomonas songnensis G-7 on the aboveground fresh weight of corn seedlings in saline-alkali soil;

[0046] Fig.13This is the result of the effect of Pseudomonas songnensis G-7 on the fresh weight of the roots of corn seedlings in saline-alkali soil;

[0047] Fig.14 This is the result diagram of the effect of Pseudomonas songnensis G-7 on the root morphology of corn seedlings Dika 159;

[0048] Fig.15 This is the result diagram of the effect of Pseudomonas songnensis G-7 on the root morphology of maize seedling Tiannong 9;

[0049] Fig.16 This is the result diagram of the effect of Pseudomonas songnensis G-7 on the root parameters of corn seedlings Deka 159;

[0050] Fig.17 This is the result diagram of the effect of Pseudomonas songnensis G-7 on the root system parameters of corn seedling Tiannong 9;

[0051] Fig.18 This is the result diagram of the effect of Pseudomonas songnensis G-7 on the height of corn seedlings in the field;

[0052] Fig.19 This is the result of the effect of Pseudomonas pine G-7 on the stem diameter of corn seedlings in the field;

[0053] Fig. 20 This is the result diagram of the effect of Pseudomonas matsumoto G-7 on corn biomass in the field;

[0054] Fig.21 This is the result diagram of the effect of Pseudomonas matsunensis G-7 on SPAD in the field;

[0055] Fig. 22 This is the effect of Pseudomonas pine G-7 on nitrogen accumulation in corn stalks in the field;

[0056] Fig.23 This is the effect of Pseudomonas matsumoto G-7 on nitrogen accumulation in corn leaves in the field;

[0057] Fig.24 This is the effect of Pseudomonas songnensis G-7 on potassium accumulation in corn stalks in the field;

[0058] Fig.25 This is a graph showing the effect of Pseudomonas matsumoto G-7 on potassium accumulation in field corn leaves. DETAILED DESCRIPTION

[0059] The invention provides a Pseudomonas songnensis G-7, and the preservation number of the Pseudomonas songnensis G-7 is CGMCC No.33127.

[0060] The invention plants different varieties of corn in saline-alkali land in Tongyu County, Baicheng City, Jilin Province, collects rhizosphere soil of corn with different growth potentials, extracts DNA in the root for high-throughput sequencing, analyzes microbial communities of corn with different growth potentials through sequencing results, and finds that Pseudomonas is one of the key bacteria in the microbial community of corn with strong growth potential. Bacteria are separated from the rhizosphere soil of corn by a coating separation method, and after molecular biological identification, several strains of Pseudomonas and other bacteria are obtained. It is verified by experiments that one rhizosphere Pseudomonas pinenensis has the ability of salt and alkali resistance, can effectively promote the growth of corn in saline-alkali soil, and is numbered as G-7, i.e., Pseudomonas pinenensis G-7.

[0061] The Pseudomonas matsutani G-7 provided by the invention is motile, spore-free, has a moist surface, has a rod-shaped bacterial body, and is a Gram-negative bacterium.

[0062] The Pseudomonas songnensis G-7 provided by the present invention has the ability of salt and alkali resistance, can grow on a plate with 5wt.% NaCl and / or pH 11; has the ability of nitrogen fixation, potassium solubilization and IAA production, and the potassium solubilization and IAA production capabilities of 48h reach 14.47mg / L and 15.19mg / L respectively; and can promote the formation of soil aggregates. The Pseudomonas songnensis G-7 provided by the present invention promotes the growth of plants. The Pseudomonas songnensis G-7 can still maintain stable excellent genetic traits after purification for 3 generations.

[0063] The present invention provides a microbial preparation, comprising the Pseudomonas songnensis G-7 described in the above technical solution. In the present invention, the bacterial activity of Pseudomonas songnensis G-7 in the microbial preparation is ≥10 8 CFU / mL.

[0064] The present invention provides a method for preparing the microbial preparation described in the above technical solution, comprising:

[0065] The Pseudomonas matsutani G-7 is cultured in a culture medium to obtain a microbial preparation.

[0066] The present invention does not specifically limit the method for culturing the Pseudomonas songnensis G-7. Any conventional culturing method in the art can be used to enable the normal growth of Pseudomonas songnensis G-7. As an optional embodiment of the present invention, the culture medium can be a TSB culture medium or a TSB liquid culture medium. In the present invention, the culture temperature can be 28 to 32°C, or 28°C, 29°C, 30°C, 31°C or 32°C. In the present invention, the culture process is preferably accompanied by rotation; the rotation speed can be 180 to 200r / min, or 180, 190 or 200r / min. In the present invention, the culture time can be 24 to 48h, or 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46 or 48h. The present invention obtains a microbial bacterial liquid through the culture.

[0067] After obtaining the microbial liquid, the present invention preferably further comprises obtaining bacterial cells by centrifuging the microbial liquid. The present invention does not specifically limit the centrifugation method, and any conventional centrifugation method in the art can be used. After obtaining the bacterial cells, the present invention preferably resuspends them in sterile water to obtain a bacterial suspension. The present invention preferably adjusts the number of viable cells in the bacterial suspension to ≥10 8 CFU / mL, can be 10 8 CFU / mL, or 10 9 CFU / mL. The bacterial suspension obtained in the present invention can be directly used as a microbial preparation.

[0068] The microbial preparation provided by the above technical solution of the present invention can be used as a microbial fertilizer to promote plant growth, and can also improve the ability of plants to tolerate salt and alkali, and promote the growth of plants in saline-alkali soil. The microbial preparation of the present invention is preferably sprayed close to the roots of the plants when applied. As an optional embodiment of the present invention, the plant includes corn. The present invention shows through the results of the examples that the microbial preparation can promote the growth of corn in saline-alkali soil, and significantly improve the height of corn seedlings, aboveground biomass, root biomass, root length, root surface area, root volume, number of root tips, and the accumulation of nitrogen and potassium in corn stalks and leaves.

[0069] The present invention provides the use of the Pseudomonas aeruginosa G-7 described in the above technical solution in degrading straw. In the present invention, the straw includes wheat straw. The Pseudomonas aeruginosa G-7 provided by the present invention can use straw as a fermentation substrate to degrade the straw, thereby increasing the degradation rate of the straw, and thus facilitating the preparation of a straw fertilizer that can better promote plant growth.

[0070] The present invention provides a bacterial fertilizer, wherein the raw materials of the bacterial fertilizer include the Pseudomonas songnensis G-7 described in the above technical solution and straw. As an optional embodiment of the present invention, the straw includes wheat straw. In the embodiment of the present invention, in order to better verify that Pseudomonas songnensis G-7 can be used to degrade straw and improve fertilizer efficiency, sterile straw is used for corresponding effect verification.

[0071] Straw is a widely existing agricultural waste. A large amount of straw is produced after the crops are harvested. It is an abundant source. Using straw as a microbial agent matrix can reduce the cost of raw materials for microbial agent production. At the same time, straw has a loose and porous physical structure, which provides a good growth space and gas exchange channel for microorganisms. Straw can absorb and retain a certain amount of water, which helps to maintain the water balance required for microbial growth. This good physical structure can promote the growth and reproduction of microorganisms. At the same time, straw contains rich nutrients that help microbial growth, promote microbial metabolic activities, and increase the activity and number of microorganisms in microbial agents. In addition, when straw is used as a matrix to adsorb microorganisms, its porous structure and certain water retention capacity can protect the microorganisms from external environmental shocks, provide a relatively stable microenvironment for microorganisms, and facilitate the storage, transportation and use of microbial agents.

[0072] The present invention provides a method for preparing the bacterial fertilizer described in the above technical solution, comprising the following steps:

[0073] The bacterial suspension of Pseudomonas songnensis G-7 was inoculated into a fermentation matrix containing straw for fermentation culture to obtain bacterial fertilizer.

[0074] In the present invention, the preparation method of the Pseudomonas songnensis G-7 bacterial suspension is the same as the preparation method of the above-mentioned microbial preparation. As an optional embodiment of the present invention, the bacterial activity of the Pseudomonas songnensis G-7 bacterial suspension is preferably ≥ 1×10 9 CFU / mL, or 1×10 9 CFU / mL.

[0075] As an optional embodiment of the present invention, the fermentation matrix includes straw, and the mass fraction of straw in the fermentation matrix can be 250 parts by mass. In the present invention, the fermentation matrix also includes water; the water is preferably sterile water. In the present invention, based on the mass fraction of straw, the mass fraction of water in the fermentation matrix can be 100 parts.

[0076] As an optional embodiment of the present invention, when the Pseudomonas songnensis G-7 bacterial suspension is inoculated, the mass volume ratio of the Pseudomonas songnensis G-7 bacterial suspension to the straw can be 10mL:250g. After the inoculation is completed, the present invention performs fermentation culture. In the present invention, the temperature of the fermentation culture can be 28-32°C, or 28°C, 29°C, 30°C, 31°C or 32°C. In the present invention, the fermentation culture time can be 14d. After the fermentation culture is completed, the present invention obtains the bacterial fertilizer.

[0077] The bacterial fertilizer provided by the above technical solution of the present invention can promote plant growth, improve the salt-alkali tolerance of plants, and promote the growth of plants in saline-alkali soil. The bacterial fertilizer of the present invention is preferably applied close to the roots of plants. As an optional embodiment of the present invention, the bacterial fertilizer can be applied when the plant has three leaves and one heart; the application amount of the bacterial fertilizer can be 100g / m 2 As an optional embodiment of the present invention, the plant may include corn. The present invention shows through the example results that the bacterial fertilizer can significantly increase the plant height, stem diameter, biomass, SPAD, and the accumulation of nitrogen and potassium in corn stalks and leaves when corn grows in saline-alkali soil.

[0078] The present invention provides the use of Pseudomonas pine G-7 described in the above technical solution in promoting the growth of plants in saline-alkali land. The present invention promotes the growth of plants in saline-alkali land including any one or more of the following (1) to (7): (1) increasing plant height; (2) increasing plant biomass; (3) increasing plant stem thickness; (4) increasing plant SPAD value; (5) promoting the growth of plant roots; (6) increasing the accumulation of potassium and / or nitrogen in plant stems; (7) increasing the accumulation of potassium and / or nitrogen in plant leaves. The present invention increases plant biomass including increasing plant aboveground biomass and increasing plant underground biomass. The present invention promotes the growth of plant roots including increasing any one or more of plant root length, root surface area, root volume and root tip number. In the present invention, the plant includes crops; the crops include corn; the corn varieties include any one or more of Dika 159, Tiannong 9, B73 and Mo17.

[0079] The present invention provides a method for promoting plant growth in saline-alkali land, comprising:

[0080] During the plant growth stage, the microbial preparation described in the above technical solution and / or the bacterial fertilizer described in the above technical solution are applied near the roots.

[0081] The present invention has no special limitation on the application method and timing of the microbial agent and the bacterial fertilizer, and any conventional bacterial fertilizer application method and timing in the art may be adopted.

[0082] As an optional embodiment of the present invention, the microbial agent can be applied when the corn seedlings have one leaf and one heart; when applying the microbial agent, preferably 10 mL of the microbial agent is applied for every three seedlings; the microbial agent is preferably applied twice, and the interval between the two applications is preferably 7 days. As an optional embodiment of the present invention, the bacterial fertilizer can be applied when the corn has three leaves and one heart; the application amount of the bacterial fertilizer can be 100g / m 2 In the present invention, the plants include crops; the crops include corn; the varieties of corn include any one or more of Dika 159, Tiannong 9, B73 and Mo17.

[0083] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0084] The potting soil comes from the 0-20cm surface soil of the saline-alkali land in Tongyu County, Baicheng City, Jilin Province. The basic physical and chemical properties of the soil are: total nitrogen 0.45g / kg, available phosphorus 13.45g / kg, available potassium 129g / kg, organic matter 9.84g / kg, pH 9.16, and soil salt content 0.91g / kg.

[0085] The raw material components in each liter of TSB liquid culture medium are: 17.0 g of trypticase, 3.0 g of soybean papain hydrolysate, 5.0 g of sodium chloride, 2.5 g of dipotassium hydrogen phosphate, and 2.5 g of glucose.

[0086] TSB liquid culture medium: dilute 30 g of raw material components to 1 L with deionized water and sterilize at 121°C for 15 min.

[0087] TSB solid culture medium: add 20g agar powder to TSB liquid culture medium and sterilize at 121℃ for 15min.

[0088] 1 / 2TSB culture medium is prepared by diluting TSB solid culture medium 2 times with clean water.

[0089] In the following examples, the TSB medium containing different concentrations of NaCl refers to the TSB medium supplemented with a corresponding mass of NaCl to reach a set concentration. For example, the TSB medium containing 5 wt.% NaCl means that 45 g NaCl is additionally added to 1 L of TSB complete medium.

[0090] Ashby nitrogen-free medium: The formula contains 5g mannitol, 5g glucose, 0.2g potassium dihydrogen phosphate, 0.2g magnesium sulfate, 0.2g sodium chloride, 0.3g potassium sulfate, and 5g calcium carbonate, and the volume is adjusted to 1L with deionized water. After adjusting the pH value to 7.0, sterilize at 121℃ for 15min. If solid medium is required, add 20g / L agar.

[0091] Modified Aleksandrov medium: The formula contains 5g glucose, 0.5g magnesium sulfate heptahydrate, 0.005g ferric chloride, 0.1g calcium carbonate, 2g calcium phosphate, 3g potassium-containing mineral, 20g agar, and 0.1g bromothymol blue. Add deionized water to 1L and adjust the pH to 7.0. Sterilize at 121℃ for 15min.

[0092] Example 1 Differential analysis of rhizosphere microbial communities of corn with different growth potentials

[0093] 32 corn varieties were planted in saline-alkali soil in Tongyu County, Baicheng City, Jilin Province, and rhizosphere soil of all corn varieties was collected during the silking period. The collected soil was divided into two parts, one for differential analysis of rhizosphere microbial communities, and the other for isolation and identification of functional bacterial colonies in Example 2.

[0094] DNA was extracted from the rhizosphere soil of corn with different growth conditions for high-throughput sequencing. By analyzing the taxonomic composition of all identified ASVs, it was found that in the rhizosphere community of corn, there was a significant enrichment of Pseudomonas in corn with better growth conditions, indicating that Pseudomonas bacteria play an important role in improving the salt-alkali resistance of corn.

[0095] Example 2 Isolation and identification of functional strains

[0096] Take an appropriate amount of rhizosphere soil and grind it with a mortar. Weigh 1 g of the ground rhizosphere soil sample and put it into 9 mL of sterile PBS buffer. Shake it at 30°C and 180 r / min for 30 min, then take it out and perform gradient dilutions, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , take 100 μL of the gradient suspension of different concentrations and spread it on 1 / 2 TSB medium containing 3% NaCl, invert the plate after spreading and place it in a 30℃ incubator for 2 days, select the single colony on the plate for separation and purification. The separated and purified strains were stored in glycerol tubes at -80℃.

[0097] A total of more than 33 bacterial strains were obtained in the rhizosphere soil of corn, one of which was a Pseudomonas bacterium with salt and alkali resistance, and was numbered as strain G-7.

[0098] The DNA extraction and identification process is as follows:

[0099] 1) Inoculation and cultivation of G-7 strain

[0100] The strain to be tested was streaked continuously on the TSB plate and cultured at 30°C for 2 days. Single colonies with good growth were picked and transferred to TSB liquid medium and further cultured for 12 hours to enrich the target strain.

[0101] The results of observation on G-7 strain showed that G-7 strain was motile, had no spores, had a moist surface, and had a rod-shaped body, and was a Gram-negative bacterium.

[0102] 2) Extraction of DNA from G-7 strain

[0103] Pipette 1 mL of bacterial solution on the clean bench and transfer it to a 1.5 mL centrifuge tube.

[0104] Centrifuge at 12000r / min for 1min at room temperature to precipitate the bacterial cells. Carefully pour off the supernatant, then add 200μL of ddH2O and mix gently to resuspend the bacterial cells. Heat the resuspended bacterial solution in a 100℃ boiling water bath or metal bath for 10min. Centrifuge again at 12000r / min for 1min at room temperature to collect the DNA in the supernatant. Transfer the supernatant to a new sterile centrifuge tube and store at -20℃ for subsequent experiments.

[0105] 3) PCR amplification of G-7 strain DNA

[0106] The extracted DNA was amplified by PCR using bacterial universal primers 27F (AGAGTTTGATCCTGGCTCAG, SEQ ID NO.1) and 1492R (TACGGCTACCTTGTTACGACTT, SEQ ID NO.2). The expected amplified fragment size was about 1500 bp. The PCR amplification program was set as follows: 94°C pre-denaturation for 5 min, followed by 30 cycles of 94°C denaturation for 1 min, 56°C annealing for 30 s, and 72°C extension for 90 s, and finally 72°C final extension for 10 min, and the amplified product was stored at 4°C.

[0107] 4) Detection and identification of amplification products

[0108] The quality and size of the PCR amplification product were detected by agarose gel electrophoresis. The specific operation was as follows: 5 μL of PCR product was mixed with 1% agarose gel and electrophoresed at 120 V for 25 min. After the electrophoresis was completed, the gel imaging system was used to observe the electrophoresis results.

[0109] The target band was observed to be single and clear, indicating that the PCR amplification was successful and met the sequencing requirements. The PCR product was sent to Wuhan Aoke Dingsheng Biotechnology Co., Ltd. for sequencing analysis, and the 16SrDNA of the G-7 strain was obtained as shown in SEQ ID NO.3, specifically:

[0110]

[0111] The sequencing results were compared in databases such as NCBI, and a phylogenetic tree was drawn using MAGA11 to analyze the taxonomic status and genetic relationship of the G-7 strain to be tested. Figure 1 As shown. The G-7 strain and Pseudomonas songnenensis are clustered in the same branch, and the similarity between G-7 and Pseudomonas songnenensis is 99.30%, indicating that the G-7 strain is Pseudomonas songnenensis. The Pseudomonas songnenensis G-7 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on December 19, 2024, with a deposit number of CGMCC No. 33127.

[0112] Example 3 Identification of salt tolerance, alkali tolerance and growth-promoting function of strain G-7

[0113] (1) Salt tolerance test

[0114] A single colony of the G-7 strain was streaked onto TSB solid culture medium containing 0.5wt.%, 1wt.%, 3wt.%, 5wt.% and 7wt.% NaCl, and cultured at 30°C for 48h for three consecutive times. If the bacteria can grow normally for three times, they are considered to have the ability to tolerate salt at that concentration.

[0115] The results of three consecutive cultivations of strain G-7 on TSB solid medium (containing 0.5wt.% NaCl) are shown in the figure. Figure 2 The results of G-7 strain being cultured three times on TSB solid medium containing 5% NaCl are shown in FIG. Figure 3 shown.

[0116] Pseudomonas songnensis G-7 can grow well in a medium containing ≤5wt.% NaCl, and can also grow in a medium containing 7% sodium chloride, but the growth effect is poor.

[0117] (2) Determination of alkali resistance

[0118] A single colony of the G-7 strain was streaked onto TSB solid culture medium with pH values ​​of 7, 8, 9, 10, 11 and 12, respectively, and cultured at 30°C for 48 h for three consecutive times. If the bacteria could grow normally for three times, they were considered to have the alkali resistance at that concentration.

[0119] The G-7 strain can grow normally under the conditions of pH 7, 8, 9, 10 and 11. The results of three consecutive cultures on TSB solid medium with a pH of 11 are shown in the figure. Figure 4 shown.

[0120] Depend on Figure 4 It can be seen that Pseudomonas matsutani G-7 can tolerate an alkaline environment with a maximum pH of 11.

[0121] (3) Qualitative determination of nitrogen fixation capacity

[0122] Streak the G-7 strain on Ashby nitrogen-free solid medium and culture it at 30°C for 48 hours. If the bacteria can grow normally, it is considered to have nitrogen fixation. Figure 5 As shown. Figure 5 It can be seen that the rhizospheric Pseudomonas pinnatifida G-7 can grow in Ashby nitrogen-free medium solid culture medium and has the ability to fix nitrogen.

[0123] (4) Qualitative determination of potassium-dissolving ability

[0124] The G-7 strain was cloned into the modified Aleksandrov medium and cultured at 30°C for 2 days. The strain grew normally and had a yellow halo, indicating the ability to dissolve potassium. Figure 6 As shown. Figure 6 It can be seen that the rhizospheric Pseudomonas pinnatifida G-7 can grow in Aleksandrov medium and has the ability to solubilize potassium.

[0125] (5) Quantitative determination of potassium-dissolving ability

[0126] Atomic absorption flame spectrophotometry was used to quantitatively determine the potassium solubilization ability of the strain. First, the G-7 strain was inoculated into a modified Aleksandrov liquid medium at a 1% inoculation rate, and cultured for 48 hours at a constant temperature of 30°C and 180r / min. Three replicates were set up to observe the growth. At the same time, a control group without inoculation was set up as a blank reference. After the culture was completed, the supernatant was separated by centrifugation at a speed of 10000r / min for 10 minutes, and the K in the supernatant was measured by flame photometry. + The concentration was accurately determined.

[0127] In order to ensure the accuracy of the determination, a potassium standard curve was prepared. The specific steps are: accurately weigh 0.1907g of dry KCl and dissolve it in 1L of deionized water to obtain a potassium standard stock solution with a concentration of 100mg / L. This standard curve will serve as an important reference in the subsequent determination process.

[0128] Pipette 0, 5, 10, 15, 20, 25, 30 mL of potassium standard stock solution and make up to 100 mL. The potassium concentrations are 0, 5, 10, 15, 20, 25, 30 mg / L respectively. Use a flame photometer to measure the mark and start measuring from the low concentration.

[0129] The potassium ion concentrations in the supernatant of inoculated G-7 were 18.04 mg / L, 16.27 mg / L and 15.11 mg / L, respectively, and the potassium ion concentrations in the blank reference were 2.1 mg / L, 1.66 mg / L and 2.24 mg / L, respectively. The potassium-solubilizing capacity of rhizospheric Pseudomonas pinnatifida G-7 in 48 hours was 14.47 mg / L.

[0130] (6) Determination of IAA production capacity of strains

[0131] The indoleacetic acid (IAA) secreted by the strain was quantitatively analyzed by spectrophotometry. First, the G-7 strain was inoculated with 1% inoculum into a liquid culture medium containing 0.1% tryptophan (0.1 g / 100 ml) and cultured for 48 hours at a constant temperature of 30°C and 180 r / min. Three repeated experiments were set up, and a control group without inoculation was set up as a blank reference. The specific steps are as follows: First, measure the absorbance (OD 600 ), then centrifuged at 10000r / min for 10min to obtain the supernatant. Afterwards, for subsequent analysis, the supernatant was evenly mixed with the Salkowski colorimetric reagent in a precise volume ratio of 1:1. This mixing ratio ensures the accuracy and reliability of the experiment and provides a solid foundation for subsequent colorimetric determination. The mixture was allowed to stand for 30 minutes in a dark environment, and the OD of the mixture was finally measured. 530 value to evaluate the production of IAA.

[0132] Standard curve: Indole-3-acetic acid with a content of 0, 5, 10, 15, 20, 30, 40, and 50 mg / L was mixed with an equal volume of Salkowski colorimetric solution, mixed evenly, reacted in the dark for 30 minutes, and the absorbance at 530 nm was measured.

[0133] Calculate the content of indoleacetic acid in a unit volume of fermentation broth after 48 hours of bacterial culture. At the same time, draw a standard curve. In this process, first prepare a gradient dilution solution composed of analytically pure indoleacetic acid, and then use these solutions to draw a standard curve, such as Figure 7 As shown, to ensure the accuracy and reliability of the measurement results. Figure 7 The horizontal axis is the concentration of IAA, and the vertical axis is OD 530 .

[0134] The absorbance of the strain that turned pink at 530 nm was measured, and the OD value in the supernatant of the culture medium inoculated with G-7 was 530 The blank control OD values ​​were 0.4588, 0.506, and 0.479, respectively. 530They were 0.1321, 0.1345 and 0.1246 respectively. When put into the standard curve, the IAA production of rhizospheric Pseudomonas pinelliae G-7 at 48h was 15.19mg / L.

[0135] (7) Determination of the ability of strains to promote soil aggregation

[0136] The cultured Pseudomonas G-7 was made into a bacterial suspension to prepare for subsequent experiments. The concentration was 10 8 CFU / g, the soil was sterilized after passing through a 100-mesh sieve, and a 9-cm diameter petri dish was used as the culture container. 15 g of soil was accurately added to each petri dish and 5 mL of bacterial solution was inoculated. 5 mL of sterile water was added to 15 g of soil as a control. Five replicates were processed for each batch to ensure that the moisture content of each petri dish was equal and placed in a constant temperature incubator. The wet sieving method was used for measurement after 30 days of growth.

[0137] In this experiment, soil samples were placed on a set of sieves with different apertures (2mm, 0.25mm, and 0.053mm), and oscillated and sieved on a specific shaking sieve machine at a certain speed and time to classify soil aggregates into different levels according to particle size.

[0138] The effects of rhizospheric Pseudomonas pinnatifida G-7 on soil aggregates are shown in Tables 1 and Figure 8 shown.

[0139] Table 1 Effects of rhizospheric Pseudomonas pinelliae G-7 on soil aggregates

[0140] project CK G-7 0.25-2mm(g) 0.04±0.006 0.10±0.015 0.053-0.25mm(g) 12.81±0.37 12.02±0.40 <0.053(g) 1.67±0.32 2.37±0.41

[0141] From Table 1 and Figure 8 It can be seen that in the microscopic culture experiment, Pseudomonas pinnatifida G-7 can promote the formation of soil aggregates and has a significant effect on the formation of soil particle size of 0.25-2 mm.

[0142] Example 4 Effect of Pseudomonas pine G-7 on the Growth of Corn Seedlings in Saline-Alkali Soil

[0143] 1. Preparation of Pseudomonas songnensis G-7 bacterial suspension - microbial preparation:

[0144] The Pseudomonas songnensis G-7 bacteria were inoculated into TSB liquid culture medium for liquid fermentation at a temperature of 32° C., a rotation speed of 180 r / min, and a time of 24 h. After the liquid fermentation was completed, a Pseudomonas songnensis G-7 bacterial liquid was obtained.

[0145] The bacterial suspension of Pseudomonas songnensis G-7 was centrifuged to obtain the bacterial cells, which were resuspended in sterile water to obtain a bacterial suspension with a bacterial content of 1×10 8 CFU / mL, can be used as a microbial preparation.

[0146] 2. The potted saline-alkali soil comes from the 0-20cm surface soil of the saline-alkali land in Tongyu County, Baicheng City, Jilin Province. After the surface soil is mixed and sieved evenly, the basic physical and chemical properties of the soil are measured. The basic physical and chemical properties of the measured soil are: total nitrogen 0.45g / kg, available phosphorus 13.45g / kg, available potassium 129g / kg, organic matter 9.84g / kg, pH 9.16, and soil salt content 0.91g / kg.

[0147] The saline-alkali soil bacteria were inactivated by high-pressure steam treatment at 121°C for 30 min and were used in the following potted plant experiments.

[0148] Corn seeds Dika 159 and Tiannong 9 were washed with deionized water, soaked in 10% hydrogen peroxide for 30 minutes for disinfection, and the disinfected corn seeds were soaked in sterile water for 12 hours, and the seeds were spread on a culture dish with filter paper for germination. After the seeds turned white, they were transplanted into pots with 500g of saline-alkali soil, 3 seeds were placed in each pot, and cultured in a greenhouse. The greenhouse was set to 60% to 70% humidity, 16h light and 8h dark per day.

[0149] Two treatments were set up for corn seedlings of Deka 159 and Tiannong 9, namely a blank control group (CK group) and a group treated with the addition of Pseudomonas songnensis G-7 (+G-7 group), and four replicates were set up for each treatment.

[0150] When the corn seedlings grew to one leaf and one heart, 10 mL of Pseudomonas pinenensis G-7 was added to each pot in the +G-7 group, with a bacterial content of 1×10 8 CFU / mL bacterial suspension (near the roots of corn seedlings), the CK group replaced the bacterial suspension with an equal amount of distilled water, and the bacterial suspension was added twice with an interval of 7 days.

[0151] After adding the bacterial suspension twice, the corn seedlings were allowed to continue growing for 14 days. After 14 days, the plant height of the four corn seedlings in each treatment was measured with a ruler; the aboveground part of the corn seedlings was cut off with scissors and its fresh weight was measured; the roots of the corn seedlings were completely removed from the soil, rinsed with water, the surface soil was removed, the surface moisture was wiped off with filter paper, and its fresh weight was measured. The root morphological parameters were then measured using the WinRHIZO root analysis system, including root length (cm), root surface area (cm 2 ), average root diameter (mm), root volume (cm 3 ) and root apex number.

[0152] The effects of Pseudomonas spp. G-7 on the growth of corn seedlings in saline-alkali soil are shown in Tables 2-4 and Figures 9 to 17In the figure, **, * and ns are significant differences defined by independent sample t test (**: P < 0.01; *: P < 0.05; ns: P ≥ 0.05), the same below.

[0153] Table 2 Effects of rhizosphere inoculation with Pseudomonas pinnatifida G-7 on the growth of corn seedlings

[0154]

[0155] Table 3 Effects of rhizosphere inoculation with Pseudomonas pinenei G-7 on the root system of maize seedling Dika 159

[0156] deal with Root length (cm) <![CDATA[Root surface area (cm 2 )]]> Root diameter (cm) <![CDATA[Root volume (cm 3 )]]> Number of root tips CK 109.90±18.01 20.31±4.07 0.59±0.09 0.30±0.10 345.75±151.14 +G-7 308.21±24.25 58.36±16.22 0.58±0.09 0.82±0.15 821.75±204.27

[0157] Table 4 Effects of inoculation with rhizosphere Pseudomonas pinenensis G-7 on the root system of maize seedlings Tiannong 9

[0158] deal with Root length (cm) <![CDATA[Root surface area (cm 2 )]]> Root diameter (cm) <![CDATA[Root volume (cm 3 )]]> Number of root tips CK 131.74±22.90 20.46±4.70 0.58±0.12 0.27±0.074 567.25±84.85 +G-7 215.18±15.45 34.05±4.29 0.50±0.03 0.44±0.07 766.00±106.71

[0159] From Table 2 and Figures 9 to 13 As shown in the figure, the growth indexes of the treatment with the addition of rhizosphere Pseudomonas pinenei G-7 were higher than those of CK. Compared with CK, the +G-7 treatment could significantly increase the plant height, aboveground fresh weight and root weight of maize seedlings Dika 159 and Tiannong 9. The plant height increased by 27.45% and 33.06%, the aboveground fresh weight increased by 74.43% and 80.60%, and the root fresh weight increased by 160.00% and 74.51%. As shown in Tables 3-4 and Figures 14 to 17 As shown in the figure, compared with CK, +G-7 treatment can significantly increase the root length, root surface area, root volume and root tip number of maize seedlings Dika 159 and Tiannong 9, with root length increased by 180.45% and 63.33%, root surface area increased by 187.34% and 66.41%, root volume increased by 170.06% and 64.44%, and root tip number increased by 137.67% and 35.03%. In summary, the rhizosphere Pseudomonas pinnatifida G-7 can promote plant growth, especially in promoting root growth.

[0160] Example 5 Effect of Pseudomonas matsumotoni G-7 on corn growth in the field

[0161] 1. Preparation method of Pseudomonas serrata G-7 bacterial fertilizer

[0162] The Pseudomonas songnensis G-7 bacteria were inoculated into TSB liquid culture medium for liquid fermentation at a temperature of 32° C., a rotation speed of 180 r / min, and a time of 24 h. After the liquid fermentation was completed, a Pseudomonas songnensis G-7 bacterial liquid was obtained.

[0163] The bacterial suspension of Pseudomonas songnensis G-7 was centrifuged to obtain the bacterial cells, which were resuspended in sterile water to obtain a bacterial suspension with a bacterial content of 1×109 CFU / mL.

[0164] 10 mL of the bacterial suspension was inoculated into a sterile bag containing 250 g of sterile wheat straw and 100 g of sterile water for fermentation. The fermentation conditions were: temperature 30°C, and fermentation time 14 days. After fermentation, Pseudomonas songnensis G-7 bacterial fertilizer was obtained, which can also be referred to as fermented straw containing Pseudomonas songnensis G-7 in subsequent experiments.

[0165] 2. Field trials

[0166] The pH of the test field soil was 8.42 and the salt content was 0.52 g / kg.

[0167] The field was divided into 4 plots, each 5m long and 3m wide. Two plots were planted with B73 and two plots were planted with Mo17. Treatment was added when the corn seedlings grew to three leaves and one heart. One of the two plots planted with B73 and Mo17 was added with a matrix mixed with 250g sterile straw and 100g sterile water, as the CK group; the other plot was added with fermented straw containing Pseudomonas pinenensis G-7, as the +G-7 group. The CK group and the +G-7 group applied the matrix or the fermented straw containing Pseudomonas pinenensis G-7 close to the corn root system, and the addition amount was 100g / m 2 . Plant height, stem diameter, biomass and SPAD value were measured during the silking stage of corn. Nitrogen and potassium accumulation in corn stalks and leaves was detected.

[0168] The effects of Pseudomonas pine G-7 on corn growth in the field are shown in Table 5 and Figures 18 to 21 The effects of Pseudomonas alpina G-7 on nitrogen and potassium accumulation in corn stalks and leaves in the field are shown in Tables 6 and Figures 22 to 25 shown.

[0169] Table 5 Effects of Pseudomonas pine G-7 on the growth of corn seedlings in the field

[0170]

[0171] Table 6 Effect of Pseudomonas pine G-7 on the growth of corn seedlings in the field

[0172]

[0173] As shown in Table 5 and Figures 18 to 21As shown in the figure, compared with CK, inoculation of rhizosphere Pseudomonas pinelliae G-7 can significantly promote the plant height, stem diameter, biomass and SPAD value of corn. The +G-7 treatment had no significant effect on the plant height of B73, while the plant height of Mo17 increased by 5.84%. The +G-7 treatment increased the stem diameter of B73 by 20.56%, while there was no significant change in Mo17. +G-7 promoted the increase of biomass of B73 and Mo17 by 41.22% and 16.71%, respectively. +G-7 promoted the increase of SPAD of B73 and Mo17 by 11.49% and 6.56%, respectively. As shown in Table 6 and Figure 22-25 As shown, compared with CK, inoculation of rhizospheric Pseudomonas pinenulata G-7 significantly increased the accumulation of nitrogen and potassium in corn stems and leaves. The experimental results showed that rhizospheric Pseudomonas pinenulata G-7 can promote corn growth, help improve corn growth, and improve salt-alkali resistance.

[0174] In summary, the rhizosphere Pseudomonas pinenensis G-7 provided by the present invention has the ability to tolerate salt and alkali, can grow on a plate with 5% NaCl and pH 11; has the ability to fix nitrogen, dissolve potassium and produce IAA, and the 48h potassium dissolving and IAA producing abilities reach 14.47 mg / L and 15.19 mg / L, respectively, and can promote the formation of soil aggregates, which promotes the growth of plants. Potted plant experiments show that rhizosphere Pseudomonas pinenensis G-7 can promote the growth of corn seedlings in saline-alkali soils, and field experiments can also promote corn growth, which helps to increase its yield.

[0175] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A Pseudomonas songnenensis G-7, characterized in that: The deposit number of the Pseudomonas matsunensis G-7 is CGMCC No.33127.

2. A microbial preparation, characterized in that: It includes the Pseudomonas matsumotoni G-7 described in claim 1.

3. The method for preparing the microbial preparation according to claim 2, characterized in that: include: The Pseudomonas matsutani G-7 is cultured in a culture medium to obtain a microbial preparation.

4. The preparation method according to claim 3, characterized in that: The culture temperature is 28-32° C. The culture is accompanied by rotation during the culture process. The rotation speed is 180-200 r / min. The culture time is 24-48 h.

5. Use of the Pseudomonas pinnatifida G-7 described in claim 1 in degrading straw.

6. A bacterial fertilizer, characterized in that: Ingredients include: The Pseudomonas pinnatifida G-7 and straw as described in claim 1.

7. The method for preparing the bacterial fertilizer according to claim 6, characterized in that: The following steps are involved: The bacterial suspension of Pseudomonas songnensis G-7 was inoculated into a fermentation matrix containing straw for fermentation culture to obtain bacterial fertilizer.

8. Use of the Pseudomonas songnensis G-7 according to claim 1 in improving the salt-alkali tolerance of plants and / or promoting the growth of plants in saline-alkali soil.

9. The use according to claim 8, characterized in that: The method for promoting plant growth in saline-alkali soil includes any one or more of the following (1) to (7): (1) Increase plant height; (2) Increase plant biomass; (3) Increase plant stem thickness; (4) Improve plant SPAD value; (5) Promote the growth of plant roots; (6) increasing the accumulation of potassium and / or nitrogen in plant stems; (7) Increase the accumulation of potassium and / or nitrogen in plant leaves.

10. A method for promoting plant growth in saline-alkali land, characterized in that: include: During the plant growth stage, the microbial preparation according to claim 2 and / or the bacterial fertilizer according to claim 6 are applied near the roots.

Images