Complex microbial inoculant for relieving successive cropping obstacles of traditional Chinese medicinal material crops and application of complex microbial inoculant

Abstract

The invention discloses a complex microbial inoculant for relieving successive cropping obstacles of traditional Chinese medicinal material crops and application of the complex microbial inoculant. The composite microbial agent disclosed by the invention contains bacillus amyloliquefaciens Y34, serratia marcescens Y35, bacillus amyloliquefaciens Y40 and streptomyces SD; the composition can be used for improving soil, eliminating diseases of polygonatum odoratum, pogostemon cablin and cynanchum wilfordii and promoting crop growth. The complex microbial inoculant can reduce soil-borne diseases in the planting process of the traditional Chinese medicinal materials, relieve continuous cropping obstacles of the traditional Chinese medicinal materials and improve the yield and quality of the traditional Chinese medicinal materials, and especially has important application value in cultivation and production of traditional Chinese medicinal material crops such as radix polygonati officinalis and pogostemon cablin.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and particularly relates to a composite bacterial agent for alleviating the obstacles of continuous cropping of traditional Chinese medicine crops and an application thereof. Background Art

[0002] Continuous cropping disorder refers to the situation where a single species is planted continuously on the same piece of land, but despite the same planting conditions, the successive crops suffer from poor growth and widespread diseases. This phenomenon exists in many crops, especially Chinese medicinal crops. Continuous cropping disorder causes a serious decline in the yield and quality of medicinal materials, while the soil available for planting is limited, which ultimately hinders the development of the Chinese medicinal materials industry.

[0003] Current research indicates that continuous cropping mainly leads to a decrease in soil nutrients and serious deterioration; self-toxic substances secreted by plants in the soil continue to accumulate, inhibiting plant growth; the content of soil pathogens increases, and the content of beneficial bacteria decreases.

[0004] Polygonatum odoratum Polygonatum odoratum (Mill.) Druce) is an important bulk medicinal material in my country. Its main and authentic planting area is Hunan Province. However, due to the harm of continuous cropping, the planting area is shrinking. According to the research on continuous cropping of Polygonatum odoratum, the results show that after continuous cropping, soil nutrients decrease, the content of phenolic acid substances increases, and a variety of pathogenic fungi, especially Fusarium oxysporum infection, lead to tuber rot. Therefore, eliminating the impact of continuous cropping of Polygonatum odoratum and increasing the reuse rate of Polygonatum odoratum planting land are of great significance to promoting the development of the Polygonatum odoratum industry. Patchouli ( Pogostemon cablin Patchouli (Blanco) Benth.) is a representative medicinal material of southern my country. It has a large planting area in the south, but Patchouli is not suitable for continuous cropping, and bacterial wilt disease often occurs during planting, which spreads and expands over a large area, seriously affecting yield and quality.

[0005] In response to the above adverse effects, the application of microbial flora is an effective and green environmentally friendly measure. It can form a dominant flora together with the original beneficial microorganisms in the soil, promote the benign circulation of elements such as carbon, nitrogen, and potassium in the soil ecosystem, and reduce the use of inorganic fertilizers; inhibit the accumulation of pathogens in the soil, improve soil immunity; degrade self-toxic substances in the soil, promote plant growth, and ultimately increase crop yields. Compared with traditional chemical pesticides, microbial fertilizers have no pesticide residues, so they are more suitable for Chinese medicinal crops with high requirements for pesticide residue detection. It can effectively avoid excessive pesticide residues and reduce planting risks. In addition, the production cost of microbial fertilizers in agricultural production is moderate, which is conducive to farmers' acceptance. Therefore, the development of efficient fertilizers is an important direction to solve the problem of soil shortage in Chinese medicinal materials, and it is also an important research field for green and efficient cultivation of Chinese medicinal materials. Summary of the invention

[0006] The purpose of the present invention is to provide a composite bacterial agent that can be suitable for the green and efficient planting of Chinese medicinal materials, and to provide the application of the composite bacterial agent in eliminating diseases of Chinese medicinal materials such as polygonatum and patchouli and promoting their growth, thereby reducing soil-borne diseases in the planting process of Chinese medicinal materials, alleviating obstacles to continuous planting of Chinese medicinal materials, and improving the yield and quality of Chinese medicinal materials.

[0007] Bacillus amyloliquefaciens Y34 ( Bacillus amyloliquefaciens Y34), its deposit number is GDMCC NO. 65312, the deposit date is December 27, 2024, and the deposit unit code is GDMCC-Guangdong Provincial Microbiological Culture Collection Center.

[0008] The Serratia marcescens Y35 of the present invention ( Serratia marcescens Y35), its deposit number is GDMCC NO.65313, the deposit date is December 11, 2024, and the deposit unit code is GDMCC-Guangdong Provincial Microbiological Culture Collection Center.

[0009] Bacillus amyloliquefaciens Y40 ( Bacillus amyloliquefaciens Y40), its deposit number is GDMCC NO. 65314, the deposit date is October 21, 2024, and the deposit unit code is GDMCC-Guangdong Provincial Microbiological Culture Collection Center.

[0010] Streptomyces SD of the present invention ( Streptomyces sp. SD ), its deposit number is GDMCC NO. 65311, the deposit date is October 21, 2024, and the deposit unit code is GDMCC-Guangdong Provincial Microbiological Culture Collection Center.

[0011] The first object of the present invention is to provide a composite bacterial flora comprising Bacillus amyloliquefaciens Y34 ( Bacillus amyloliquefaciens Y34), Serratia marcescens Y35 ( Serratia marcescens Y35), Bacillus amyloliquefaciens Y40 ( Bacillus amyloliquefaciens Y40) and Streptomyces SD ( Streptomyces sp. SD ); the Bacillus amyloliquefaciens Y34 has a deposit number of GDMCC NO. 65312; the Serratia marcescens Y35 has a deposit number of GDMCC NO. 65313; the Bacillus amyloliquefaciens Y40 has a deposit number of GDMCC NO. 65314; the Streptomyces SD has a deposit number of GDMCC NO. 65311.

[0012] The second object of the present invention is to provide a composite bacterial agent, which contains the composite bacterial flora and bacterial agent auxiliary materials.

[0013] Preferably, the bacterial cell quantity ratio of Bacillus amyloliquefaciens Y34:Serratia marcescens Y35:Bacillus amyloliquefaciens Y40:Streptomyces SD in the composite bacterial agent is 1:1:1:1.

[0014] The third object of the present invention is to provide a biological fertilizer, which contains the composite bacterial agent and fertilizer.

[0015] The fourth object of the present invention is to provide the use of the composite bacterial community, composite bacterial agent or biological fertilizer in at least one of the following (1)-(4): (1) Improve soil; (2) Improve the disease resistance of Chinese medicinal plants; (3) Alleviate obstacles to continuous cropping of Chinese medicinal plants; (4) Promote the growth of Chinese medicinal plants.

[0016] Preferably, the Chinese medicinal plants are Chinese medicinal plants of the Asparagaceae, Lamiaceae and Asclepiadaceae families.

[0017] More preferably, the Chinese medicinal plants are Polygonatum odoratum, Pogostemon cablin and Rhizoma Cibotii ( Cynanchum stauntonii (Decne.) Schltr. ex Lévl.).

[0018] Preferably, the application comprises the step of applying the composite bacterial community, composite bacterial agent or biological bacterial fertilizer to the roots or rhizosphere soil of Chinese medicinal plants.

[0019] Preferably, the application method is watering or spraying.

[0020] The composite bacterial agent of the present invention contains Bacillus amyloliquefaciens Y34, Serratia marcescens Y35, Bacillus amyloliquefaciens Y40 and Streptomyces SD. Experiments show that the composite bacterial agent can be applied to improve soil, eliminate diseases of Polygonatum odoratum, Pogostemon cablin and Willow Leaf Whitehead, and promote crop growth. Therefore, the composite bacterial agent of the present invention has important application value in the cultivation and production of Chinese medicinal crops such as Polygonatum odoratum and Pogostemon cablin.

[0021] Collection Instructions The present invention Bacillus amyloliquefaciens Y34 (Bacillus amyloliquefaciens Y34) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on December 27, 2024, with the deposit number: GDMCC NO. 65312, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0022] The present invention Serratia marcescensY35 (Serratia marcescens Y35) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on December 11, 2024, with the deposit number: GDMCC NO. 65313, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0023] The present invention Bacillus amyloliquefaciens Y40 (Bacillus amyloliquefaciens Y40) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number: GDMCC NO. 65314, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0024] The present invention Streptomyces sp. SD (Streptomyces SD) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number: GDMCC NO. 65311, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 These are the morphological and basic biological characteristics of strain Y34; Figure 1 A: The utilization of different carbon sources by strain Y34 and the detection of the acid and alkali production capacity of strain Y34; Figure 1 B in the figure: growth of strain Y34 on different antibiotic media; Figure 1 C in the figure: growth of strain Y34 under different pH conditions; Figure 1 D in the figure: Growth of strain Y34 under different NaCl concentrations; Figure 1 E in: free nitrogen fixation ability test of strain Y34; Figure 1 F, G, and H in the figure are the tests of the ability of strain Y34 to degrade organic phosphorus, inorganic phosphorus, and potassium, respectively; Figure 1 I and J in the figure: the inhibitory effect of strain Y34 on Fusarium oxysporum, which is the inhibition of spore germination and hyphal growth, respectively; Figure 1 K in: Antagonistic test results of strain Y34 against Ralstonia solanacearum.

[0026] Figure 2 These are the morphological and basic biological characteristics of strain Y35; Figure 2 A: The utilization of different carbon sources by strain Y35 and the detection of the acid and alkali production capacity of strain Y35; Figure 2 B in the figure: growth of strain Y35 on different antibiotic media; Figure 2C in the figure: growth of strain Y35 under different pH conditions; Figure 2 D in the figure: Growth of strain Y35 under different NaCl concentrations; Figure 2 E in: free nitrogen fixation ability test of strain Y35; Figure 2 F, G, and H in the figure are the tests of the ability of strain Y35 to degrade organic phosphorus, inorganic phosphorus, and potassium, respectively; Figure 2 I and J in the figure: the inhibitory effect of strain Y35 on Fusarium oxysporum, which is the inhibition of spore germination and hyphal growth, respectively; Figure 2 K in: The inhibitory effect of strain Y35 on Ralstonia solanacearum for 3 and 7 days.

[0027] Figure 3 These are the morphological and basic biological characteristics of strain Y40; Figure 3 A: The utilization of different carbon sources by strain Y40 and the detection of the acid and alkali production capacity of strain Y40; Figure 3 B in the figure: growth of strain Y40 on different antibiotic media; Figure 3 C in the figure: growth of strain Y40 under different pH conditions; Figure 3 D in the figure: Growth of strain Y40 under different NaCl concentrations; Figure 3 E in: free nitrogen fixation ability test of strain Y40; Figure 3 F, G, and H in the figure are the tests of the ability of strain Y40 to degrade organic phosphorus, inorganic phosphorus, and potassium, respectively; Figure 3 I and J in the figure: the inhibitory effect of strain Y40 on Fusarium oxysporum, which is the inhibition of spore germination and hyphal growth, respectively; Figure 3 K in: The inhibitory effect of strain Y40 on Ralstonia solanacearum for 3 and 7 days.

[0028] Figure 4 This is the phylogenetic tree of the 16S rDNA gene sequences of strains Y34 and Y40.

[0029] Figure 5 This is the phylogenetic tree of the 16S rDNA gene sequence of strain Y35.

[0030] Figure 6 is the tolerance of strains Y34, Y35 and Y40 to four phenolic acids; among them, Figure 6 The plates in AE are 0 addition and basal salt medium plates with ferulic acid, syringic acid, phlorizin, and p-coumaric acid as the sole carbon source.

[0031] Figure 7 These are the morphological and basic biological characteristics of strain SD.

[0032] Figure 8This is the phylogenetic tree of the 16S rDNA gene sequence of strain SD.

[0033] Fig. 9 is an antagonism test between strains; among them, Fig. 9 The plate in A is coated with Y34 bacterial solution. Fig. 9 The plate in B is coated with Y35 bacterial solution. Fig. 9 The one in C is a plate coated with Y40 bacterial solution.

[0034] Fig.10 The contents of available phosphorus, nitrate nitrogen and humic acid in the soil of Polygonatum odoratum under different treatments are as follows; Fig.10 A in the formula is the effective phosphorus content. Fig.10 B in the figure is the nitrate nitrogen content. Fig.10 C in the figure represents the humic acid content. Samples A, B, and C in the figure correspond to treatments A, B, and C respectively.

[0035] Fig.11 The comparison of different treatments of Polygonatum odoratum tuber wounds; Fig.11 A, B, and C correspond to the wound conditions of Polygonatum odoratum tubers of treatments A, B, and C respectively.

[0036] Fig.12 The new buds of Polygonatum odoratum under different treatments; Fig.12 A, B, and C correspond to the growth of new sprouts on the Polygonatum odoratum tubers of treatments A, B, and C, respectively.

[0037] Fig.13 The differences in soil flora structure of Polygonatum odoratum under different treatments; Fig.13 A in is the difference at the gate level, Fig.13 B in the figure represents the difference at the genus level. Samples A, B, and C in the figure correspond to treatments A, B, and C, respectively.

[0038] Fig.14 is the disease resistance of patchouli with different treatments; among them, Fig.14 A in the figure is the growth condition of Patchouli before treatment A in Example 3, Fig.14 B in the figure is the growth condition of Patchouli before treatment B in Example 3, Fig.14 C in the figure is the growth of patchouli after treatment A in Example 3 (the photographing area is the same piece of land corresponding to the photograph before treatment A). Fig.14 D in the figure is the growth condition of patchouli after treatment B in Example 3 (the photographing area is the same piece of land corresponding to the photograph before treatment B). DETAILED DESCRIPTION

[0039] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0040] Example 1 1. Isolation of strains Y34, Y35, Y40, and SD Y34, Y35, and Y40 were obtained from the roots of healthy Polygonatum odoratum grown in Hunan Province, disinfected with 75% ethanol aqueous solution for 30 s, then disinfected with 2% NaClO aqueous solution for 5 min, rinsed with sterile water 5-6 times, added with an appropriate amount of YMA liquid culture medium (according to the YMB culture medium formula in Table 1, the agar powder component was removed to obtain the YMA liquid culture medium), streaked on YMB plates for purification, and cultured at 28°C for 2-3 d.

[0041] Table 1 YMB medium formula (1 L) SD was obtained from rhizosphere soil of healthy Polygonatum odoratum grown in Hunan Province. 1 g of rhizosphere soil was added with an appropriate amount of YMA liquid medium. After being fully shaken for 10 min and allowed to stand for 30 min, the supernatant was diluted to 10 -3 The resulting mixture was then diluted 10 times and then poured onto an enrichment soil plate (a special plate prepared from rhizosphere soil that can effectively enrich and culture Streptomyces; it was prepared by the following steps: 500 g of root soil from healthy Polygonatum odoratum was taken, water was added to 2 L, the mixture was fully mixed and sterilized (121°C, 30 min), the supernatant was taken and diluted 10 times, agar powder was added to a final concentration of 1.5%, the plate was poured after re-sterilization (121°C, 30 min), and the plate was cultured at 28°C for 2-3 d.

[0042] Analysis of basic biological characteristics of strains Y34, Y35, Y40, and SD 2.1 Analysis of carbon source utilization characteristics Prepare a variety of single carbon source culture media (according to the YMB culture medium formula in Table 1, replace the mannitol component with other carbon sources of equal mass to obtain a single carbon source culture medium), carbon sources include mannitol, inositol, glycerol, sodium citrate, malonic acid, sodium oxalate, starch, glucose, fructose, D-xylose, arabinose, lactose, sucrose, and maltose. Then take 5 µL of the diluted bacterial solution and spot it on the plate, write the strain number and date on the plate, and place it in a 28°C incubator for 3 days.

[0043] 2.2 Antibiotic resistance testing Prepare a multi-antibiotic culture medium (according to the YMB culture medium formula in Table 1, add a single antibiotic as the antibiotic culture medium), antibiotics include chloramphenicol, chlortetracycline, rifampicin, kanamycin, gentamicin, fosfomycin, streptomycin, ampicillin, spectinomycin, tetracycline. Then take 5 µL of the diluted bacterial solution and spot it on the plate, write the strain number and date on the plate, and place it in a 28°C incubator for 3 days.

[0044] 2.3 Analysis of NaCl tolerance characteristics (1) Prepare the culture medium one day in advance, which can be normal YMB medium or YMB medium supplemented with a final concentration of 1%, 2%, 3%, 4%, or 5% NaCl. Weigh and mix the components according to Table 1 and the medium formulas for adding different concentrations of NaCl, add water to make up to 1 L, adjust the pH to 7.0 with 5% NaOH solution or 5% HCl solution, and sterilize at 121℃ for 30 min; then dispense into plates.

[0045] (2) Dilute the bacterial solutions from different sources by 10 2 Double the volume and set aside (use a 2 mL sterile centrifuge tube, add 1 mL YMB, then add 10 µL of the corresponding isolated bacteria, mix well, and operate next to an alcohol lamp).

[0046] (3) Pipette 5 µL of the diluted bacterial solution and spot it on a plate. Write the strain number and date on the plate and place it in a 28°C incubator for incubation. After 3 days, observe the growth of each bacteria under different NaCl concentrations and compare it with the growth on normal YMB medium. Record and take photos.

[0047] 2.4 pH experiment Prepare YMB medium plates with pH 5, pH 7, pH 9, pH 11, and pH 13, aspirate 5 µL of the diluted bacterial solution and spot on the plates with different pH values, observe the growth after 3 days, and take photos.

[0048] 2.5 Phosphate solubilization capacity Prepare Montgena organic phosphorus (lecithin), Montgena inorganic phosphorus (tricalcium phosphate), and potassium-solubilizing activity assay culture medium plates. Divide each plate into 6 areas, and pipette 5 μL of bacterial solution in the center of each area in turn (ensure accurate sampling and do not let the bacterial solution flow). Culture in a 28°C incubator for 3 days to observe whether the strain grows and whether phosphorus-solubilizing and potassium-solubilizing circles are formed.

[0049] The culture medium formula is as follows: ①Montgena organophosphorus (lecithin) bacterial culture medium (1 L): glucose 10.0 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, KCl 0.3 g, CaCO3 1.0 g, lecithin 0.3 g, agar 20 g, pH 7.0. Lecithin was dissolved by heating with 75% ethanol aqueous solution, sterilized separately, mixed with sterilized culture medium solution cooled to 60°C, and poured onto a plate.

[0050] ②Mongina inorganic phosphate (tricalcium phosphate) bacterial culture medium (1 L): glucose 10 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, CaCO3 5.0 g, KCl 0.3 g, Ca3(PO4) 25.0 g, agar 20 g, pH 7.0.

[0051] ③ Potassium-solubilizing activity assay medium (1 L): 5.0 g glucose, 0.5 g anhydrous magnesium sulfate, 0.005 g ferric chloride, 0.1 g calcium carbonate, 2.0 g calcium phosphate, 2.0 g potassium-containing mineral, 100 mg bromothymol blue, 15 g agar, pH 7.2.

[0052] 2.6 Testing the Acid or Alkali Production Capacity of the Strain on the Culture Medium Prepare acid-base (bromophenol blue) culture medium. Weigh and mix the components according to the formula in Table 2, add water to 1 L, adjust the pH to 7.0 with 5% NaOH solution or 5% HCl solution, and sterilize at 121℃ for 30 min. Then dispense into plates.

[0053] Table 2 Acid-base culture medium formula (1 L) Inoculate 5 µL of each of the aforementioned diluted bacterial solutions onto the acid-base medium plate, culture at 28°C for 3-5 days, and observe the color of the medium. If the medium turns blue, it means that the metabolites produced by the bacteria when using this carbon source are alkaline (alkaline production); if the medium turns yellow, it means that the metabolites produced by the bacteria when using this carbon source are acidic (acid production); if the medium does not change color and is green, it means that the metabolites produced by the bacteria when using this carbon source are neutral.

[0054] 2.7 IAA production test of strains The strain was inoculated into 50 mL of LB liquid medium containing L-tryptophan (100 mg / L), and cultured at 28°C and 180 rpm for 1 day. Then 50 μL of bacterial solution was added to a white ceramic plate, and an equal volume of Salkowski colorimetric solution (containing 50 mL 35% HClO4 and 1 mL 0.5 mol / L FeCl3) was added. After thorough mixing, the mixture was placed away from light for 30 min. If the color turned red, it indicated that the bacterial solution contained IAA.

[0055] 2.8 Siderophore production test 5 μL of the strain was pipetted onto a CAS medium (chrome azurol S (CAS) 60.5 mg, hexadecyltrimethylammonium bromide (ITIA) 72.9 mg, ferric chloride hexahydrate 2.645 mg, sodium dihydrogen phosphate dihydrate 295.25 mg, sodium dihydrogen phosphate dodecahydrate 1213.5 mg, ammonium chloride 125 mg, potassium dihydrogen phosphate 37.5 mg, sodium chloride 62.5 mg, agar 9.0 g, distilled water 1 L, pH 6.8) plate and cultured at 28°C for 3 days. If a yellow ring appears on the colony, it indicates that the siderophore is produced.

[0056] 2.9 Phenolic acid tolerance of strains Prepare basal salt medium (MSM): weigh 5.8 g K2HPO4, 2.0 g (NH4)2SO4, 4.5 g KH2PO4, 0.02 g CaCl2, 0.16 g MgCl2, 0.0018 g FeCl3, 0.0024 g Na2MoO4·2H2O, 0.0015 g MnCl2·2H2O and 18 g agar, add water to 1 L, pH 7.0, add one of p-Coumaric acid, Phloridzin, Syringic acid, Ferulic acid, with a final concentration of 0.5 g / L as the sole carbon source; then prepare the culture medium plate. Inoculate 5 µL of the aforementioned diluted bacterial solution onto the plate, culture at 28°C for 7 days, and observe the colony morphology.

[0057] 2.10 Experiment on the antagonism of strains to Fusarium oxysporum Preparation of PDA spore plates: Prepare a spore suspension of Fusarium fungi, inoculate Fusarium oxysporum on a PDA plate, culture at 28°C for 3 days, scrape off the spores, add sterile deionized water, filter with sterile cotton wool, observe with a hemocytometer, and dilute to about 1×10 7 Take 8 mL of the spore suspension and add it to 100 mL of PDA medium (20.0 g potato extract, 2.0 g glucose, 1.5 g Agar, add water to 0.1 L) that has been melted and cooled to about 45°C, shake well, and pour it into the plate. Use a hole puncher to punch holes on the prepared spore-bearing PDA plate, add 100 μL of bacterial solution to the holes, then culture at 28°C for 1 day to observe the spore germination. Antagonistic experiment on the growth of Fusarium oxysporum hyphae: Use a hole puncher to obtain bacterial blocks from the Fusarium oxysporum plate, place them in the center of the PDA plate, and drop 5 μL of bacterial solution at equal intervals 1.0 cm around the bacterial blocks, and culture at 28°C for 5 days for observation.

[0058] 2.11 Experiment on the antagonism of bacterial strains to Ralstonia solanacearum Cultivate Ralstonia solanacearum in LB medium until the OD600 value is 0.6, and prepare the bacterial solution in a spray bottle. Add 10 μL of the test bacterial solution to the YM plate medium and culture it at 28℃ for 12 h. Then spray the Ralstonia solanacearum solution evenly on the plate and culture it at 28℃ for 3 to 7 days for observation. The Fusarium oxysporum and Ralstonia solanacearum involved in the above two antagonistic experiments were isolated from the rhizosphere soil of Polygonatum odoratum or Pogostemon cablin.

[0059] The results showed that after strain Y34 was cultured on YMB plates at 28°C for 3 days, the colony edge was smooth, with protrusions, and the colony color was white. Strain Y34 can grow on plates with 0 carbon source or with mannitol, inositol, glycerol, sodium citrate, sodium oxalate, starch, glucose, fructose, D-xylose, arabinose, lactose, sucrose, and maltose as the sole carbon source. The suitable pH range for growth is pH5-pH13. It has resistance to chloramphenicol, chlortetracycline, tetracycline, and ampicillin, produces acid (the metabolites turn the bromophenol blue medium yellow, indicating that its metabolites are acidic), has the ability to degrade organic and inorganic phosphorus, has the ability to degrade potassium, has the ability to fix nitrogen freely, can antagonize the spore germination and hyphae growth of Fusarium oxysporum, has the ability to produce IAA, has the ability to produce iron, and can tolerate up to 5% NaCl ( Figure 1 ), bacterial growth was inhibited by phlorizin and p-coumaric acid ( Figure 6 ).

[0060] After strain Y35 was cultured on YMB plates at 28°C for 3 days, the colonies were transparent, slightly white, with smooth edges and protrusions. Strain Y35 can grow on plates with 0 carbon source or with mannitol, inositol, glycerol, sodium citrate, malonic acid, sodium oxalate, starch, glucose, fructose, D-xylose, arabinose, lactose, sucrose, and maltose as the sole carbon source. The pH range for growth is pH5-pH13. It is resistant to chloramphenicol, chlortetracycline, tetracycline, and ampicillin, produces acid (the metabolites turn the bromophenol blue medium yellow, indicating that its metabolites are acidic), has the ability to degrade organic and inorganic phosphorus, has the ability to degrade potassium, has the ability to fix nitrogen freely, can antagonize the spore germination and hyphae growth of Fusarium oxysporum, can antagonize the growth of Ralstonia solanacearum, has the ability to produce IAA and iron, and can tolerate up to 5% NaCl ( Figure 2 ), bacterial growth is not inhibited by phenolic acids ( Figure 6 ). After strain Y40 was cultured on a YMB plate at 28°C for 3 days, the colonies were white with smooth edges and protrusions.

[0061] Strain Y40 can grow on plates with mannitol, inositol, starch, glucose, D-xylose, arabinose, lactose, sucrose, maltose, glycerol, sodium citrate, malonic acid, sodium oxalate, and fructose as the sole carbon source. The suitable pH range for growth is pH5-pH13. It is resistant to chloramphenicol, chlortetracycline, tetracycline, and ampicillin. It produces acid (the metabolites turn the bromophenol blue medium yellow, indicating that its metabolites are acidic). It has the ability to degrade organic and inorganic phosphorus, but not potassium. It can inhibit the spore germination and hyphae growth of Fusarium oxysporum, antagonize the growth of Ralstonia solanacearum, and has no ability to produce IAA. It has the ability to produce iron and can tolerate up to 5% NaCl ( Figure 3 ), bacterial growth is not inhibited by phenolic acids ( Figure 6 ).

[0062] After the strain SD was cultured on Gao's medium No. 1 at 28°C for 3 days, the colonies were grayish white with smooth edges, protrusions, and a rough texture ( Figure 7 Gao's medium No. 1 formula: soluble starch 20 g, KNO3 1.0 g, K2HPO4 0.5 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.01 g, agar 20 g, add distilled water to 1000 mL, pH 7.4.

[0063] 3. Molecular biological identification of strains Y34, Y35, Y40 and SD The Y34, Y35, Y40 and SD strains were identified by molecular biology using 16S rDNA. The genomic DNA of each strain was amplified by PCR using primers (F: AGAGTTTGATCCTGGCTCAG; R: TACGGCTACCTTGTTACGACTT), and a fragment of about 1.4 kb was amplified, of which the nucleotide sequence of the amplified 16S rDNA of strain Y34 is shown in SEQ ID NO.1, 1451 bp; the nucleotide sequence of the amplified 16S rDNA of strain Y35 is shown in SEQ ID NO.2, 1402 bp; the nucleotide sequence of the amplified 16S rDNA of strain Y40 is shown in SEQ ID NO.3, 1449 bp; the nucleotide sequence of the amplified 16S rDNA of strain SD is shown in SEQ ID NO.4, 1386 bp. The amplified sequences were aligned using DNAMAN software, spliced ​​using SNAPGENE software, and compared for homology in the NCBI (https: / / blast.ncbi.nlm.nih.gov / ) gene library. A phylogenetic tree was constructed using the neighbor-joining method using MEGA11.0 software for phylogenetic analysis.

[0064] The Y34 strain was found to belong to the genus Bacillus ( Bacillus ),and Bacillus amyloliquefaciens Closest relative ( Figure 4 ). The strain Y34 was identified as belonging to the Bacillus Therefore, the strain Y34 was named Bacillus amyloliquefaciens Y34 (Bacillus amyloliquefaciens Y34).

[0065] Y35 strain belongs to the genus Serratia ( Serratia ),and Serratia marcescens Closest relative ( Figure 5 ). The strain Y35 was identified as belonging to the Serratia Therefore, the strain Y35 was named Serratia marcescens Y35 (Serratia marcescens Y35).

[0066] Y40 strain belongs to the genus Bacillus ( Bacillus ),and Bacillus amyloliquefaciens Closest relative ( Figure 4 ). The strain Y40 was identified as belonging to the Bacillus Therefore, the strain Y40 was named Bacillus amyloliquefaciens Y40 (Bacillus amyloliquefaciens Y40).

[0067] SD strain belongs to the genus Streptomyces ( Streptomyces ),and Streptomyces sp. Closest relative ( Figure 8 ). The morphological characteristics, physiological and biochemical characteristics of the strain SD and the phylogenetic tree analysis constructed by 16S rDNA gene sequence identified the strain SD as belonging to Streptomyces Therefore, the SD strain was named Streptomyces sp. SD (Streptomyces SD).

[0068] Antagonism experiment between strains Y34, Y35, Y40 and SD strains Prepare YMB medium plates, and take 50 μL of Y34, Y35, and Y40 bacterial solution to different plates and spread evenly. Then, 9 holes were punched on the plate, and 50 μL of bacterial solution of the other three strains except the one that had been spread were added to the holes. Three holes of each other strain were used as replicates, and cultured at 28°C for 1 day, and the plate morphology was observed.

[0069] The results showed that there was no mutual antagonism or growth inhibition between the four strains ( Fig. 9 ).

[0070] Example 2 1. Polygonatum odoratum planting The experimental site was a laboratory greenhouse, and the soil was a mixed soil of sand: soil with a ratio of 1:1. Polygonatum odoratum was planted in 50*50 cm square pots with an interval of 10 cm, with a total of 30 plants.

[0071] 2. Microbial community combination design and inoculation treatment method Polygonatum was inoculated with disease bacteria: a sharp needle was used to scratch the surface of the tuber of Polygonatum (0.5 cm wound), and then each pot was watered with Fusarium solani ( Fusarium solani ) spore liquid (1×10 7 The blank control group only used a sharp needle to scratch the surface of the Polygonatum odoratum tuber (0.5 cm wound) without watering with Fusarium solani.

[0072] Three days after the disease treatment, Polygonatum odoratum was inoculated with fungi. The combinations of fungi for each treatment are shown in Table 4. A total of three different treatment groups were designed, with 30 seedlings in each treatment group and single plant biological replication.

[0073] Table 4 Combinations of fungi in different treatments of Polygonatum odoratum experiment Strains Y34, Y35, Y40, and SD in Table 4 were isolated and obtained in Example 1.

[0074] The preparation method and treatment method of the bacterial agent combination treatment solution are as follows: The tap water used below was left overnight to eliminate chlorine before use.

[0075] Strain Y34, Y35, and Y40 were inoculated into organic nutrient liquid medium (soluble starch 5.0 g, urea 2.0 g, potassium dihydrogen phosphate 6.0 g, yeast extract 10.0 g, magnesium sulfate 1.0 g, soybean extract 10.0 g, beef extract 5.0 g, distilled water 1 L, pH 7.5) and cultured at 28°C for 3-7 days until the OD600 value was about 0.6, and the OD600 value was measured. The required volume of bacterial solution was taken according to the OD600 value and incubated at 4000 °C. g Centrifuge for 20 min, discard the supernatant, and resuspend in tap water to ensure that the concentration of strains Y34, Y35, and Y40 in the obtained bacterial solution is 1.2×10 7 bacteria / mL (i.e., when OD600=1, the bacterial solution concentration is 2×10 9 The OD600 of each bacterium in the solution was calculated as 0.006), thus a bacterial solution containing strains Y34, Y35 and Y40 was prepared.

[0076] The strain SD was inoculated into 3 L of Gao's medium No. 1 and cultured at 28°C for 7 days, then the cells were collected by centrifugation. Then an appropriate amount of SD cells (the final concentration of the control strain SD was 1.2×10 7 The concentration of Y34, Y35, Y40 and SD in the bacterial solution was 1.2×10 7 bacteria / mL.

[0077] Treatment A was the disease control group, without adding growth-promoting bacteria, and the treatment liquid of Treatment A was tap water.

[0078] Treatment B is a bacterial flora addition treatment, and the treatment solution of Treatment B is the bacterial solution containing strains Y34, Y35, Y40 and SD prepared above.

[0079] Treatment C was the blank control group, and the treatment solution of Treatment C was tap water.

[0080] During the treatment, the prepared treatment solution of A, B or C was gently poured around the root zone of the Polygonatum odoratum plants, with 500 mL per pot. Subsequently, the treatment was repeated every 2 weeks. The relevant indicators were measured 90 days after the start of the treatment.

[0081] 3. Results result( Fig.10 ) showed that the content of available phosphorus, nitrate nitrogen and humic acid in the soil of Polygonatum odoratum in treatment B and treatment C was significantly higher than that in treatment A. In addition, the results ( Fig.11 ) showed that the wounds of tubers in treatments B and C healed well, and the wounds in treatment A did not turn black and rot. In addition, treatments B and C had fewer diseased plants, a lower rot rate, and new shoots grew ( Fig.12 More importantly, the results ( Fig.13 ) showed that in treatment B, except for Streptomyces ( Streptomyces ) increased significantly, and the content of Firmicutes ( Firmicutes ), Actinobacteria ( Actinobacteriota ) and its various bacterial genera also increased significantly, effectively improving the soil microbial structure. The above results show that the composite bacterial agent in treatment B has a significant effect on improving soil nutrients and the disease resistance of Polygonatum odoratum plants.

[0082] Example 3 1. Patchouli cultivation The experimental site is a patchouli planting area in Qiaoyuan Town, Huilai County, Guangdong Province. The soil is sandy soil, and the treatment material is a patchouli area where the disease has begun. The patchouli seedlings are planted at an interval of 50 cm, with a total of 48 plants.

[0083] 2. Microbial community combination design and inoculation treatment method Patchouli fields were inoculated with fungi, and the combinations of fungi for each treatment are shown in Table 5. Two different treatment groups were designed, with 30 seedlings in each treatment group and single plant biological replication.

[0084] Table 5 Combinations of fungi in different treatments of Polygonatum odoratum experiment Strains Y34, Y35, Y40, and SD in Table 5 were isolated and obtained in Example 1.

[0085] The commercial Bacillus subtilis in Table 5 is produced by Beihai Yiqiang Biotechnology Co., Ltd. Product name: Bacillus subtilis, viable bacteria count 100 billion / g, dosage form: water-soluble powder, purchase website: https: / / item.jd.com / 10034826879550.html .

[0086] The preparation method and treatment method of the bacterial agent combination treatment solution are as follows: The tap water used below was left overnight to eliminate chlorine before use.

[0087] Strain Y34, Y35, and Y40 were inoculated into organic nutrient liquid medium (soluble starch 5.0 g, urea 2.0 g, potassium dihydrogen phosphate 6.0 g, yeast extract 10.0 g, magnesium sulfate 1.0 g, soybean extract 10.0 g, beef extract 5.0 g, distilled water 1 L, pH 7.5) and cultured at 28°C for 3-7 days until the OD600 value was about 0.6, and the OD600 value was measured. The required volume of bacterial solution was taken according to the OD600 value and incubated at 4000 °C. g Centrifuge for 20 min, discard the supernatant, and resuspend in tap water to ensure that the concentration of strains Y34, Y35, and Y40 in the obtained bacterial solution is 1.2×10 7 bacteria / mL (i.e., when OD600=1, the bacterial solution concentration is 2×10 9 The OD600 of each bacterium in the solution was calculated as 0.006), thus a bacterial solution containing strains Y34, Y35 and Y40 was prepared.

[0088] The strain SD was inoculated into 3 L of Gao's medium No. 1 and cultured at 28°C for 7 days, then the cells were collected by centrifugation. Then an appropriate amount of SD cells (the final concentration of the control strain SD was 1.2×10 7 The concentration of Y34, Y35, Y40 and SD in the bacterial solution was 1.2×10 7 bacteria / mL.

[0089] Weigh an appropriate amount of Bacillus subtilis product (live bacteria count 100 billion / g), dissolve it in tap water and mix well to prepare a concentration of 5×10 7 The bacterial solution containing commercial Bacillus subtilis was prepared by mixing 100 bacteria / mL of the bacterial solution.

[0090] Treatment A is a bacterial flora addition treatment, and the treatment solution of Treatment A is the bacterial solution containing strains Y34, Y35, Y40 and SD prepared above.

[0091] Treatment B is a treatment with commercial bacteria, and the treatment liquid of Treatment B is the bacterial liquid containing commercial Bacillus subtilis prepared above.

[0092] During the treatment, the prepared treatment solution of treatment A or B was used to irrigate the roots of the patchouli seedlings, with 500 mL of the treatment solution irrigated to each plant, and the treatment was repeated once every 20 days.

[0093] 3. Determination of plant physiological indicators One month after the root irrigation treatment, the disease status of the patchouli plants was statistically analyzed. Fig.14 ) showed that treatment A could significantly improve the disease resistance of patchouli compared with the commercial bacteria in treatment B.

Claims

1. A composite bacterial flora, characterized in that: Contains Bacillus amyloliquefaciens Y34 ( Bacillus amyloliquefaciens Y34), Serratia marcescens Y35 ( Serratia marcescens Y35), Bacillus amyloliquefaciens Y40 ( Bacillus amyloliquefaciens Y40) and Streptomyces SD ( Streptomyces sp. SD ); the Bacillus amyloliquefaciens Y34 has a deposit number of GDMCC NO. 65312; the Serratia marcescens Y35 has a deposit number of GDMCC NO. 65313; the Bacillus amyloliquefaciens Y40 has a deposit number of GDMCC NO. 65314; the Streptomyces SD has a deposit number of GDMCC NO. 65311.

2. A composite bacterial agent, characterized in that: Contains the composite bacterial flora and bacterial agent auxiliary materials as claimed in claim 1.

3. The composite bacterial agent according to claim 2, characterized in that: The bacterial cell quantity ratio of Bacillus amyloliquefaciens Y34:Serratia marcescens Y35:Bacillus amyloliquefaciens Y40:Streptomyces SD in the composite bacterial agent is 1:1:1:

1.

4. A biological fertilizer, characterized in that: Contains the composite bacterial agent according to claim 2 or 3 and a fertilizer.

5. Use of the composite bacterial community according to claim 1, the composite bacterial agent according to claim 2 or 3, or the biological fertilizer according to claim 4 in at least one of the following (1) to (4): (1) Improve soil; (2) Improve the disease resistance of Chinese medicinal plants; (3) Alleviate obstacles to continuous cropping of Chinese medicinal plants; (4) Promote the growth of Chinese medicinal plants.

6. The use according to claim 5, characterized in that: The Chinese medicinal plants are Chinese medicinal plants of the Asparagaceae, Lamiaceae and Asclepiadaceae families.

7. The use according to claim 6, characterized in that: The Chinese medicinal plants are polygonatum odoratum, patchouli and willow leaf scutellaria.

8. The use according to claim 5, characterized in that: The method comprises the steps of applying the composite bacterial flora, composite bacterial agent or biological bacterial fertilizer to the roots of Chinese medicinal plants or rhizosphere soil.

9. The use according to claim 8, characterized in that: The application method is watering or spraying.

Images