Method for realizing internal circulation of carbon atoms and reducing power in engineering bacterium cells and application of method

Abstract

The invention discloses a method for realizing internal circulation of carbon atoms and reducing power in engineering bacterium cells and application thereof, and belongs to the technical field of genetic engineering. Aiming at the problem of low economical efficiency of carbon atoms caused by carbon source loss in a CO2 form and net generation of reducing power NAD (P) H in the process of producing chemicals through fermentation of engineering bacteria, acetone carboxylase with a carbon sequestration function and 3-hydroxybutyrate dehydrogenase consuming reducing power are introduced into a chemical production strain with carbon loss and excessive reducing power; the internal circulation of carbon atoms and reducing power in engineering bacteria cells is realized, so that the economical efficiency of the carbon atoms is improved. When the method provided by the invention is used for constructing the isoprene and 3-hydroxybutyric acid co-production strain, the economical efficiency of carbon atoms is improved by 2.7 times.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a method for realizing the internal circulation of carbon atoms and reducing power in engineering bacteria cells and its application. Background Art

[0002] With the rapid development of synthetic biology technology, the customized synthesis of target chemicals by constructing microbial cell factories has the advantages of green and sustainable development, and has important scientific value and application prospects. In the process of microbial fermentation, the utilization efficiency of materials and energy is an important factor affecting the economic efficiency of biosynthesis. However, the carbon loss in the fermentation process will reduce the utilization efficiency of materials and energy and thus reduce the economic efficiency of biosynthesis. There are three main mechanisms for carbon loss in the form of CO2, namely, release from decarboxylation reactions, redox imbalance, and adenosine triphosphate (ATP) generation. Among them, the loss of CO2 caused by pyruvate decarboxylation during carbon metabolism is the most common. This phenomenon will affect the carbon yield of the desired product and reduce the carbon atom economy. In addition, redox imbalance is also an important reason for the low carbon atom economy. When the reducing power NAD(P)H is insufficient, microorganisms consume additional carbon sources to generate reducing power to meet the synthesis needs. For example, there are carbon fixation reactions and dehydrogenation reactions that consume reducing power in microorganisms: in the biosynthesis pathway of 3-hydroxybutyric acid, a monomer of biodegradable plastics, acetone carboxylase catalyzes the reaction of substrate acetone and CO2 to produce acetoacetate, which is a carbon fixation reaction; then acetoacetate is catalyzed by 3-hydroxybutyrate dehydrogenase to synthesize 3-hydroxybutyrate, which is a catalytic reaction that consumes reducing power. Figure 1 As shown. When the reducing power NAD(P)H is in excess, it is consumed through respiratory chain oxidation and the generation of byproducts such as reducing organic acids, which is a waste of material and energy. Taking isoprene biosynthesis as an example, the reaction equation for synthesizing isoprene using glucose as a substrate through the mevalonic acid (MVA) pathway is: 1.5C6H 12 O6+4NAD(P) + →C5H8+4CO2+4NAD(P)H+H2O+4[H + ]. For every molecule of isoprene synthesized, 4 carbon sources in the form of CO2 are lost and 4 reducing power NAD(P)H are generated. The inefficient use of materials and energy results in a theoretical carbon atom economy of only 0.55 mol / mol for this pathway. It can be seen that the redox imbalance caused by the above two situations results in low carbon atom economy. Therefore, how to solve the bottleneck problem of low carbon atom economy caused by the loss of carbon source in the form of CO2 and the net generation of reducing power NAD(P)H in the process of fermentation of chemicals by engineered bacteria is of great significance to improving the economy of biosynthesis. Summary of the invention

[0003] In view of the problem that the carbon source loss in the form of CO2 and the net generation of reducing power NAD(P)H in the process of producing chemicals by fermentation of engineered bacteria lead to low carbon atom economy, the present invention introduces acetone carboxylase with carbon fixation function and 3-hydroxybutyrate dehydrogenase that consumes reducing power into chemical production strains with carbon loss and excess reducing power, thereby realizing the internal circulation of carbon atoms and reducing power in the cells of the engineered bacteria, thereby improving the carbon atom economy.

[0004] In order to solve the above technical problems and achieve corresponding technical effects, the present invention provides the following technical solutions:

[0005] The first object of the present invention is to provide a method for realizing the internal circulation of carbon atoms and reducing power in engineered bacteria cells, wherein the method is to introduce acetone carboxylase gene acxABC and 3-hydroxybutyrate dehydrogenase gene hbdh into chemical engineering bacteria with carbon loss and excess reducing power.

[0006] In one embodiment of the present invention, the method for realizing the internal circulation of carbon atoms and reducing power in the engineered bacterial cells specifically comprises the following steps:

[0007] (1) constructing a recombinant plasmid expressing the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh;

[0008] (2) Introducing the recombinant plasmid obtained in step (1) into chemical engineering bacteria with carbon source loss and excess reducing power.

[0009] In one embodiment of the present invention, the acetone carboxylase gene acxABC is derived from Xanthobacter autotrophicus, GenBank ID: AY055852.1; the 3-hydroxybutyrate dehydrogenase gene hbdh is derived from Rhodobacter capsulatus, GenBank ID: WP_023911413.1.

[0010] In one embodiment of the present invention, the chemical engineering bacteria with carbon loss and excess reducing power are engineering bacteria in which the carbon source is lost in the form of CO2 during the biosynthesis of the target chemical, accompanied by the net production of reducing power NAD(P)H.

[0011] In one embodiment of the present invention, chemical engineering bacteria include but are not limited to engineering bacteria that synthesize isoprene.

[0012] The second object of the present invention is to provide an application of the above method in improving the carbon atom economy in the process of producing chemicals by fermentation of engineered bacteria.

[0013] In one embodiment of the present invention, the above application includes utilizing the above method to construct a strain for co-producing 3-hydroxybutyric acid and specific chemicals, and fermenting and co-producing the chemicals.

[0014] The third object of the present invention is to provide a method for co-producing 3-hydroxybutyrate and isoprene capable of improving the total carbon atom economy, wherein the method comprises introducing the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh into isoprene engineering bacteria to obtain recombinant bacteria, and then sequentially performing seed culture, fermentation culture and induction culture on the recombinant bacteria to produce 3-hydroxybutyrate and isoprene.

[0015] In one embodiment of the present invention, the acetone carboxylase gene acxABC is derived from Xanthobacter autotrophicus, GenBank ID: AY055852.1; the 3-hydroxybutyrate dehydrogenase gene hbdh is derived from Rhodobacter capsulatus, GenBank ID: WP_023911413.1.

[0016] In one embodiment of the present invention, the specific construction method of the above-mentioned recombinant bacteria is as follows:

[0017] S1. Constructing the recombinant plasmid pCDF-acx-hbdh expressing the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh;

[0018] S2. Using recombinant plasmids pGJ02 and pYJM14 as templates, recombinant plasmids pGJ23-07 and pGJ23-04 carrying all the genes of the isoprene biosynthesis pathway were constructed by homologous recombination;

[0019] S3. The recombinant plasmid pCDF-acx-hbdh obtained in S1 and the recombinant plasmids pGJ23-07 and pGJ23-04 obtained in S2 were transformed into E. coli BL21 (DE3) to obtain recombinant bacteria that co-produce 3-hydroxybutyrate and isoprene.

[0020] The fourth object of the present invention is to provide a recombinant bacterium for co-producing 3-hydroxybutyric acid and isoprene obtained by the above method.

[0021] The "overexpression" or "overexpression" mentioned in the present invention refers to the expression of a specific gene in a cell exceeding the original level in an organism after being regulated by various signals. This can be achieved by enhancing endogenous expression or introducing exogenous genes.

[0022] Beneficial effects of the present invention:

[0023] In view of the bottleneck problem that the carbon source loss in the form of CO2 and the net generation of reducing power NAD(P)H in the process of producing chemicals by engineering bacteria lead to low carbon atom economy, the present invention introduces the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh into the above-mentioned engineering bacteria to promote the internal circulation of carbon atoms and reducing power in the cell and improve the carbon atom economy. The method is used to introduce the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh into the isoprene engineering bacteria, and an isoprene and 3-hydroxybutyrate co-production strain is constructed, and the carbon atom economy is improved by 2.7 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the reaction in which acetone carboxylase catalyzes the reaction of substrate acetone and CO2 to produce acetoacetate, which is then catalyzed by 3-hydroxybutyrate dehydrogenase to synthesize 3-hydroxybutyrate;

[0025] Figure 2 Schematic diagram of the pCDF-acx-hbdh recombinant plasmid structure. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific implementation methods and the accompanying drawings of the specification. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0027] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described in the present invention without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0028] The restriction endonucleases and T4 DNA ligase used in the present invention were purchased from MBI Fermentas; the kits used for plasmid extraction and gel recovery in the present invention were purchased from OMEGA, USA, and the operation steps were carried out according to the product instructions; all culture media in the present invention were prepared with deionized water unless otherwise specified.

[0029] Example 1: Construction of recombinant plasmid pCDF-acx-hbdh

[0030] (1) Construction of recombinant plasmid pCDFDuet-acxABC

[0031] The ACXCn-ACXAn gene fragment (nucleotide sequence see SEQ ID NO.1) and the ACXBn gene fragment (nucleotide sequence see SEQ ID NO.2) were synthesized. The two gene fragments were connected to the plasmid vector pCDFDuet-1 by seamless cloning to obtain the recombinant plasmid pCDFDuet-acxABC expressing the Flavobacterium acetone carboxylase gene acxABC. The specific steps are as follows:

[0032] The gene fragment acxCA was amplified by PCR using the fully synthesized gene fragment ACXCn-ACXAn as a template and ACXCn+ACXAn-F and ACXCn+ACXAn-R as primers. The gene fragment acxB was amplified by PCR using the fully synthesized gene fragment ACXBn as a template and ACXBn-F and ACXBn-R as primers. The linear vector was obtained by PCR amplification using the plasmid pCDFDuet-1 as a template and pCDFDuet-F and pCDFDuet-R as primers. The primer information used in the construction of the above recombinant plasmid pCDFDuet-acxABC is shown in Table 1, the system of the PCR reaction involved is shown in Table 2, and the reaction procedure is shown in Table 3.

[0033] SEQ ID NO.1(5'-3'):

[0034] TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCAGAATTCAAAAGATCTTTTAAGAAGGAGATATACATATGGCCTATACCCGCTCGAAGATCGTCGATCTCGTGGACGGCAAGATCGATCCCGATACGCTGCACCAGATGCTCTCCACCCCCAAGGACCCGGAGCGCTTCGTGACCTATGTGGAGATCCTGCAGGAGCGCATGCCGTGGGATGACAAGATCATCCTGCCGCTCGGCCCCAAGCTCTTCATCGTGCAGCAGAAAGTCTCCAAGAAATGGACCGTGCGCTGCGAATGCGGCCACGATTTCTGCGACTGGAAGGACAATTGGAAGCTCAGCGCCCGCGTCCATGTTCGCGACACGCCGCAGAAGATGGAGGAGATCTATCCCCGCCTCATGGCGCCCACCCCGTCCTGGCAGGTGATCCGGGAGTATTTCTGCCCCGAGTGCGGCACCCTTCACGATGTGGAGGCGCCCACCCCCTGGTATCCGGTGATCCACGATTTCTCGCCGGATATCGAGGGCTTCTACCAGGAGTGGCTCGGCCTGCCGGTGCCCGAGCGGGCCGACGCCTGAAGATCTTATAAGAAGGAGGTATTCATATGAACGTTCCCGTGGGACACCTGCGCAACGTCCAGGTGCTTGGCATCGATGCCGGCGGCACCATGACGGACACTTTCTTCGTGGACCAGGACGGCGACTTCGTCGTCGGCAAGGCCCAGTCCACGCCCCAGAACGAGGCTTTGGGCCTCATCGCCTCGTCTGAAGACGGGCTCGCCAACTGGGGCATGTCGCTCCACGAGGCGCTGGCCCAGCTTCAGACCGGTGTCTATTCCGGCACCGCGATGCTCAATCGCGTGGTCCAGCGCAAGGGGCTGAAATGCGGCCTCATCGTCAATCGCGGCATGGAGGATTTCCACCGCATGGGCCGCGCGGTGCAGAGCCA

[0035] CCTCGGCTACGCCTATGAGGACCGCATCCACCTCAACACCCACCGCTACGATCCCCC

[0036] GCTCGTCCCGCGCCACCTCACCCGCGGCGTGGTGGAGCGCACCGACATGATCGGCA

[0037] CGCAGGTGATCCCGCTGCGCGAGGACACGGCGCGGGACGCCGCCCGCGACCTGATC

[0038] GCGGCCGACGCGGAAGGCATCGTCATCTCGCTGCTGCATTCCTACAAGAACCCGGA

[0039] GAACGAGCGCCGCGTGCGCGACATCGTGCTGGAGGAAGTGGAGAAGAGCGGCAAG

[0040] AAGATCCCGGTCTTCGCCTCCGCCGATTATTATCCGGTGCGCAAGGAAACCCACCGC

[0041] ACCAACACCACCATCCTCGAAGGCTACGCCGCCGAGCCCTCGCGGCAGACCCTGTC

[0042] CAAGATTTCCAACGCCTTCAAGGAGCGTGGCACCAAGTTCGACTTCCGCGTGATGG

[0043] CGACCCATGGCGGCACCATCTCCTGGAAGGCGAAGGAGCTGGCGCGCACCATCGTG

[0044] TCTGGCCCCATCGGCGGGGTGATCGGCGCGAAATATCTCGGCGAGGTGCTGGGCTAC

[0045] AAGAACATCGCCTGCTCGGACATCGGCGGCACCTCGTTCGACGTGGCGCTGATCAC

[0046] CCAGGGCGAGATGACCATCAAGAACGATCCGGACATGGCGCGCCTCGTCCTGTCGC

[0047] TGCCGCTGGTGGCCATGGATTCGGTGGGCGCCGGCGCCGGCTCCTTCATTCGGCTCG

[0048] ATCCCTATACCCGGGCCATCAAGCTGGGGCCGGATTCGGCCGGCTACCGGGTGGGCG

[0049] TGTGCTGGAAGGAGAGCGGCATCGAGACGGTGACCATCTCCGACTGTCACATGGTG

[0050] CTCGGCTATCTCAACCCCGACAACTTCCTCGGCGGGGCGGTGAAGCTCGATCGCCA

[0051] GCGCTCGGTGGATGCCATCAAGGCGCAGATTGCCGATCCGCTCGGCCTGTCGGTCGA

[0052] GGATGCCGCCGCCGGCGTTATCGAACTGCTCGACAGCGACCTGCGCGACTACCTGC

[0053] GCTCCATGATCTCCGGCAAGGGCTATTCGCCGGCGAGCTTCGTGTGCTTCTCCTATG

[0054] GCGGCGCCGGCCCGGTGCACACCTATGGCTACACCGAGGGCCTTGGCTTCGAGGAT

[0055] GTGATCGTTCCGGCCTGGGCGGCGGGCTTCTCCGCCTTCGGCTGCGCGGCGGCGGA

[0056] TTTCGAGTATCGCTACGACAAGTCCCTCGACATCAACATGCCGACGGAGACCCCTGA

[0057] CACCGACAAGGAGAAGGCCGCCGCCACCCTCCAGGCGGCATGGGAGGAACTCACC

[0058] AAGAACGTGCTCGAAGAGTTCAAGCTGAACGGCTATTCGGCCGACCAGGTGACGCT

[0059] CCAGCCCGGCTACCCGCATGCAGTATCGCGGGCAGCTCAACGACCTGGAGATAGAGA

[0060] GCCCGCTGGCGCAGGCCCACACCGCGGCTGACTGGGACCAGCTGACGGACGCCTT

[0061] CAACGCCACCTATGGCCGGGTCTATGCCGCCTCCGCCCGCTCGCCGGAGCTGGGCTA

[0062] TTCGGTTACCGGCGCCATCATGCGCGGCATGGTGCCGATCCCCAAGCCCAAGATCCC

[0063] CAAGGAGCCGGAGGAGGGCGGAGACCCCGCCGGAGAGCGCCAAGATCGGCACCCGC

[0064] AAGTTCTATCGCAAGAAGCGGTGGGTGGATGCGCAGCTCTATCACATGGAGTCGCTG

[0065] CGCCCCGGCAACCGGGTGATGGGCCCTGCCGTGATCGAATCCGACGCCACCACCTT

[0066] CGTGGTGCCCGACGGCTTCGAGACCTGGCTCGACGCCACCGCCTGTTCCACCTGC

[0067] GCGAGGTGTGGA

[0068] SEQ ID NO.2(5'-3'):

[0069]

[0070] Table 1 Primer information used in the construction of recombinant plasmid pCDFDuet-acxABC

[0071]

[0072] Table 2 PCR reaction system involved in the construction of recombinant plasmid pCDFDuet-acxABC

[0073]

[0074]

[0075] Table 3 PCR reaction procedures involved in the construction of recombinant plasmid pCDFDuet-acxABC

[0076]

[0077] The gene fragments acxCA and acxB were homologously recombined with the linear vector through homology arms using the Quanshijin Bio-seamless Cloning Kit to obtain the recombinant plasmid pCDFDuet-acxABC expressing the acetone carboxylase gene acxABC of Flavobacterium. The homologous recombination reaction system is shown in Table 4. The reaction conditions are to gently pipette and mix the reaction system solution, centrifuge briefly, then collect the reaction solution to the bottom of the tube, incubate at 50°C in a water bath for 30 minutes, and then immediately cool on ice.

[0078] Table 4 Homologous recombination reaction system

[0079]

[0080] (2) Construction of recombinant plasmid pCDF-acx-hbdh

[0081] The gene fragment hbdh of 3-hydroxybutyrate dehydrogenase from Rhodobacter capsulatus was optimized and fully synthesized according to the codon preference of Escherichia coli, and the nucleotide sequence is shown in SEQ ID NO.3. The hbdh gene was used as a template, HBDH-F and HBDH-R were used as primers, and the target gene fragment was amplified by PCR. The primer sequence information of the hbdh gene is shown in Table 5, the PCR reaction system is shown in Table 6, and the reaction procedure is shown in Table 7.

[0082] SEQ ID NO.3(5'-3'):

[0083] ATGAGCCTGAAAGGTAAAACCGCAGTTATTACCGGTAGCAATAGCGGTATTGGTCTGGGTGTTGCACGTGAACTGGCACGTGCAGGTGCAGATGTTGTTCTGAATAGCTTTACCGATCGTCCGGAAGATCATGCACTGGCAGCAGCACTGGGTGCAGAATTTGGTGTTACCGCACGTTATATTAAAGCCGATATGAGCCAGGGTGCAGAATGTCGTGCACTGGTT GCACAGGCAGGTCGTTGTGATATTCTGGTTAATAATGCCGGTATCCAGCACGTTGCACCGGTTGATCAGTTTCCGGTTGAAAAATGGGATGCAATTATTGCCATTAACCTGAGCAGCGCCTTTCACACCACCGCAGCAGCATTACCTTTAATGCGTGCAGCAGGTTGGGGTCGTGTTGTTAATATTGCAAGCGCACATGGTCTGACCGCAAGCCCGTTTAAAAGCGCATATGTTGCAGCAAAACATGGCATTGTTGGTTTCACCAAAACCGTTGCACTGGAAACCGCAGAAGAACCGATTACCTGTAATGCAATTTGTCCGGGTTATGTGCTGACCCCGCTGGTTGAAGCACAGATTCCGGATCAGATGAAAGTTCATGGTATGGATCGTGAAACCGTTATTCGTGAAGTTATGCTGACCCGTCAGCCGAGCAAACAGTTTGCAACCGTTGAACAGCTGGGTGGTACCACCGTTTTTCTGTGTAGCGAAGCAGCAGCACAGATTACCGGTACCACCATTAGCGTTGATGGTGGTTGGACCGCACTGTAA

[0084] Table 5 Primer information used in the construction of recombinant plasmid pCDF-acx-hbdh

[0085]

[0086] Table 6 PCR reaction system involved in the construction of recombinant plasmid pCDF-acx-hbdh

[0087]

[0088] Table 7 PCR reaction procedures involved in the construction of recombinant plasmid pCDF-acx-hbdh

[0089]

[0090] The PCR amplification product was subjected to agarose gel electrophoresis, and after running the gel, it was excised and recovered using a gel excision recovery kit to obtain the target gene fragment.

[0091] The pCDFDuet-acxABC plasmid was digested with PacI. The enzyme digestion system is shown in Table 8.

[0092] Table 8 Enzyme digestion system of pCDFDuet-acxABC plasmid digested with PacI

[0093]

[0094] The enzyme digestion system was reacted at 37°C for 2 hours, and the enzyme digestion product was recovered using a gel recovery kit to obtain a linear vector. The target gene fragment obtained by PCR amplification was homologously recombined with the linear vector of pCDFDuet-acxABC using a recombination cloning kit to obtain the recombinant plasmid pCDF-acx-hbdh. The homologous recombination reaction system is shown in Table 9. The reaction conditions are to gently pipette and mix the reaction system solution, centrifuge briefly, then collect the reaction solution to the bottom of the tube, water bath at 50°C for 30 minutes, and then immediately cool it on ice.

[0095] Table 9 Homologous recombination reaction system involved in obtaining recombinant plasmid pCDF-acx-hbdh

[0096]

[0097] Example 2: Construction of recombinant plasmid pGJ23-07

[0098] Using the recombinant plasmid pGJ02 (see the published literature Guo J, Cao Y, Liu H, Zhang R, Xian M, Liu H. Improving the production of isoprene and 1,3-propanediol by metabolically engineered Escherichia coli through recycling redox cofactor between the dualpathways. Appl Microbiol Biotechnol. 2019, 103 (6): 2597-2608) as a template, the recombinant plasmid pGJ23-07 was constructed by homologous recombination. The recombinant plasmid pGJ23-07 carries some genes of the isoprene biosynthesis pathway. The specific method is as follows:

[0099] (1) PCR amplification

[0100] Using plasmid pGJ02 as template and ZTYJ-F and ZTYJ-R as primers, PCR amplified the vector element fragment; using plasmid pGJ02 as template and mvaES-F and mvaES-R as primers, PCR amplified the mvaE-mvaS fragment; using plasmid pGJ02 as template and IP-F and IP-R as primers, PCR amplified the ispS4-pntAB fragment.

[0101] Table 10 Primer information used in the construction of recombinant plasmid pGJ23-07

[0102]

[0103]

[0104] (2) Seamless cloning

[0105] The amplified vector element fragment, mvaE-mvaS fragment, and ispS4-pntAB fragment were homologously recombined using the Quanshijin Biotech Seamless Cloning Kit to obtain the recombinant plasmid pGJ23-07.

[0106] Example 3: Construction of recombinant plasmid pGJ23-04

[0107] The recombinant plasmid pYJM14 (see the published literature Yang J, Zhao G, Sun Y, Zheng Y, Jiang X, Liu W, Xian M. Bio-isoprene production using exogenous MVA pathway and isoprene synthase in Escherichia coli. Bioresour Technol. 2012, 104: 642-647) was used as a template, and ERG-F and IDI-R were used as primers to PCR amplify the target gene fragment; the empty plasmid pETDuet-1 was used as a template, and ZT-F2 and ZT-R were used as primers to PCR amplify the linear vector. The primer information involved is shown in Table 11, the PCR reaction system is shown in Table 12, and the reaction procedure is shown in Table 13. The PCR amplification product was subjected to agarose gel electrophoresis, and the gene fragment and the linear vector were recovered using a gel cutting recovery kit. The full-type gold biological seamless cloning kit was used to homologously recombine the target gene fragment recovered from the gel with the linear vector to obtain the recombinant plasmid pGJ23-04.

[0108] The recombinant plasmid pGJ23-04 carries some genes of the isoprene biosynthesis pathway. The biosynthesis of isoprene can be achieved by introducing the recombinant plasmid pGJ23-07 constructed in Example 2 and the recombinant plasmid pGJ23-04 constructed in this example into the host cell.

[0109] Table 11 Primer information used in the construction of recombinant plasmid pGJ23-04

[0110]

[0111] Table 12 PCR reaction system involved in the construction of recombinant plasmid pGJ23-04

[0112]

[0113] Table 13 PCR program involved in the construction of PCR recombinant plasmid pGJ23-04

[0114]

[0115]

[0116] Example 4: Construction of a strain for co-production of 3-hydroxybutyrate and isoprene

[0117] The recombinant plasmid pCDF-acx-hbdh obtained in Example 1, the recombinant plasmid pGJ23-07 obtained in Example 2, and the recombinant plasmid pGJ23-04 obtained in Example 3 were transformed into E. coli BL21 (DE3) to obtain a 3-hydroxybutyrate and isoprene co-producing strain, and the specific operation was as follows:

[0118] (1) 100 μL E.coli BL21 (DE3) competent cells, thawed on ice;

[0119] (2) Add 50-100 ng of recombinant plasmids pCDF-acx-hbdh, pGJ23-07, and pGJ23-04, respectively, and place on ice for 30 min;

[0120] (3) Heat shock at 42°C for 90 seconds and place on ice for 2 minutes;

[0121] (4) Add 600 μL of resistance-free LB and incubate at 37°C on a shaker for 1 h;

[0122] (5) The bacterial solution was centrifuged at 5000 rpm for 3 min, 600 μL of the supernatant was discarded, and the remaining 100 μL was taken and plated, and cultured at 37°C overnight to obtain a 3-hydroxybutyrate and isoprene co-producing strain, which was labeled GJ23-24.

[0123] Comparative Example 1: Construction of 3-hydroxybutyrate engineering bacteria

[0124] The recombinant plasmid pCDF-acx-hbdh obtained in Example 1 was transformed into E. coli BL21 (DE3) by the following specific steps:

[0125] (1) 100 μL E.coli BL21 (DE3) competent cells, thawed on ice;

[0126] (2) Add 50-100 ng of plasmid pCDF-acx-hbdh and place on ice for 30 min;

[0127] (3) Heat shock at 42°C for 90 seconds and place on ice for 2 minutes;

[0128] (4) Add 600 μL of resistance-free LB liquid medium and incubate at 37°C on a shaker for 1 h;

[0129] (5) The bacterial solution was centrifuged at 5000 rpm for 3 min, 600 μL of the supernatant was discarded, and the remaining 100 μL was taken and plated, and cultured at 37°C overnight to obtain 3-hydroxybutyric acid engineered bacteria, which were labeled as GJ23-10.

[0130] Comparative Example 2: Construction of isoprene engineering bacteria

[0131] The recombinant plasmid pGJ23-07 obtained in Example 2 and the recombinant plasmid pGJ23-04 obtained in Example 3 were transformed into E. coli BL21 (DE3) to obtain isoprene engineering bacteria. The specific operation is as follows:

[0132] (1) 100 μL E.coli BL21 (DE3) competent cells, thawed on ice;

[0133] (2) Add 50-100 ng of recombinant plasmid pGJ23-07 and recombinant plasmid pGJ23-04 respectively and place on ice for 30 min;

[0134] (3) Heat shock at 42°C for 90 seconds and place on ice for 2 minutes;

[0135] (4) Add 600 μL of resistance-free LB and incubate at 37°C on a shaker for 1 h;

[0136] (5) The bacterial solution was centrifuged at 5000 rpm for 3 min, 600 μL of the supernatant was discarded, and the remaining 100 μL was taken and plated, and cultured at 37°C overnight to obtain the isoprene-engineered bacteria, which was labeled GJ23-22.

[0137] Example 7: Fermentation production of isoprene and 3-hydroxybutyrate

[0138] (1) Seed liquid preparation: 3-hydroxybutyrate and isoprene co-producing strain GJ23-24 was inoculated into 5 mL of LB liquid medium and cultured overnight at 37° C. and 180 rpm;

[0139] (2) Inoculation of shake flasks: Inoculate the seed solution into 100 mL of modified M9 medium (6 g / L Na2HPO4, 3 g / L KH2PO4, 1 g / L NH4Cl, 0.5 g / L NaCl, 2 mM MgSO4, 27 μM FeSO4, 50 μM MnCl2·4H2O and 38 μM ZnSO4·7H2O, 100 ng / mL thiamine, 20 g / L glucose) at a volume ratio of 1% and culture at 37°C, 180 rpm;

[0140] (3) Induction: Shake flask culture until OD 600 When the pressure reaches about 0.6, add 0.1 mM IPTG, 2 g / L NaHCO3 and 1 g / L acetone, seal the bottle, and ferment at 30°C for 48 h.

[0141] (4) Detection: GC was used to detect the concentration of isoprene in the headspace, and HPLC was used to detect the carbon source consumption and the concentration of the product 3-hydroxybutyric acid.

[0142] As a control group, the 3-hydroxybutyrate engineering bacteria GJ23-10 obtained in Comparative Example 1 and the isoprene engineering bacteria GJ23-22 obtained in Comparative Example 2 (NaHCO3 and acetone were not added to the strain during induction) were cultured according to the above method. The test results are shown in Table 14.

[0143] Table 14 Carbon atom economy in the fermentation production of chemical products by engineering bacteria GJ23-24, GJ23-10 and GJ23-22

[0144]

[0145] in,

[0146] According to the test results in Table 14 and the carbon atom economy calculation formula, it can be seen that the total carbon atom economy of producing isoprene and 3-hydroxybutyric acid by fermenting and culturing the engineering bacteria GJ23-22 and GJ23-10 separately is 5.5%; while the total carbon atom economy of co-producing isoprene and 3-hydroxybutyric acid by fermenting and culturing the engineering bacteria GJ23-24 is increased to 20.7%, an increase of 2.7 times.

[0147] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for realizing the internal circulation of carbon atoms and reducing power in engineered bacterial cells, characterized in that: The acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh were introduced into chemical engineering bacteria with carbon loss and excess reducing power.

2. The method according to claim 1, characterized in that: The specific steps include: (1) constructing a recombinant plasmid expressing the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh; (2) Introducing the recombinant plasmid obtained in step (1) into chemical engineering bacteria with carbon source loss and excess reducing power.

3. The method according to any one of claims 1 or 2, characterized in that: The acetone carboxylase gene acxABC is derived from Xanthobacter autotrophicus, GenBank ID: AY055852.1; the 3-hydroxybutyrate dehydrogenase gene hbdh is derived from Rhodobacter capsulatus, GenBank ID: WP_023911413.

1.

4. The method according to claim 1, characterized in that: Chemical engineering bacteria with carbon loss and excess reducing power are engineering bacteria in which the carbon source is lost in the form of CO2 during the biosynthesis of target chemicals, accompanied by the net production of reducing power NAD(P)H.

5. The method according to claim 4, characterized in that: Chemical engineered bacteria include engineered bacteria that synthesize isoprene.

6. Use of the method according to any one of claims 1 to 5 in improving the carbon atom economy in the process of producing chemicals by fermentation with engineered bacteria.

7. A method for co-producing 3-hydroxybutyric acid and isoprene capable of improving the total carbon atom economy, characterized in that: The acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh are introduced into isoprene engineering bacteria to obtain recombinant bacteria, and then the recombinant bacteria are subjected to seed culture, fermentation culture and induction to produce 3-hydroxybutyrate and isoprene in sequence.

8. The method according to claim 7, characterized in that: The acetone carboxylase gene acxABC is derived from Xanthobacter autotrophicus, GenBank ID: AY055852.1; the 3-hydroxybutyrate dehydrogenase gene hbdh is derived from Rhodobacter capsulatus, GenBank ID: WP_023911413.

1.

9. The method according to claim 7, characterized in that: The specific construction method of the recombinant bacteria is as follows: S1. Constructing the recombinant plasmid pCDF-acx-hbdh expressing the acetone carboxylase gene acxABC and the 3-hydroxybutyrate dehydrogenase gene hbdh; S2. Using recombinant plasmids pGJ02 and pYJM14 as templates, recombinant plasmids pGJ23-07 and pGJ23-04 carrying all the genes of the isoprene biosynthesis pathway were constructed by homologous recombination; S3. The recombinant plasmid pCDF-acx-hbdh obtained in S1 and the recombinant plasmids pGJ23-07 and pGJ23-04 obtained in S2 were transformed into E. coli BL21 (DE3) to obtain recombinant bacteria that co-produce 3-hydroxybutyrate and isoprene.

10. A recombinant bacterium for co-producing 3-hydroxybutyric acid and isoprene obtained by the method of claim 9.

Images