Method for improving steroid drug precursor production through triacylglycerol synthesis route blocking, genetically engineered bacterium and application

Abstract

The invention belongs to the technical field of biological catalysis and biology, and discloses a method for improving steroid drug precursor production through triacylglycerol synthesis pathway blocking, a genetically engineered bacterium and application, and the genetically engineered bacterium is obtained by knocking out a key gene influencing a TAG synthesis pathway in an original strain; the starting strain is a strain with a steroid hormone drug intermediate production capacity. The method solves the problem that in the microbiological method steroid drug prerequisite production process, the conversion efficiency is low due to insufficient intracellular energy supply in the early stage of fermentation, and then the steroid drug prerequisite price is high, and a new method is provided for improving the production capacity of steroid hormone drug intermediate production strains. The method can also be used for other industrial production strains, and has wide application value. According to the invention, the problem of low yield of the steroid hormone drug intermediates caused by reduction of thallus activity due to environmental stress in the production process of the steroid hormone drug intermediates is solved.

Description

Technical Field

[0001] The invention belongs to the fields of biocatalysis and biotechnology, and in particular to a method for improving the production of steroid drug precursors by blocking a triacylglycerol synthesis pathway, a genetic engineering bacterium and an application thereof. Background Art

[0002] Steroid hormone drugs are widely used as clinical drugs because of their small molecular weight and high fat solubility. They can easily enter cells and produce a series of biochemical reactions. Currently, steroid hormone drugs have become the second class of drugs after antibiotics. Among them, 4-androstene-3,17-dione (Androsta-diene-dione, AD) is the starting material for the production of almost all steroid hormone drugs. It can be used to synthesize a variety of steroid drugs such as cortisone, progesterone, testosterone, etc. The current market demand for AD has exceeded 1 billion US dollars.

[0003] AD is currently produced mainly by microbial transformation. The biological production of AD uses the enzyme system of microorganisms to modify specific parts of the substrate. Compared with traditional chemical methods, microbial transformation has the advantages of being environmentally friendly and having high substrate specificity. In industrial production, the method of using mycobacteria to degrade the side chains of plant sterols to produce value-added synthesis of various steroid hormone intermediates such as AD has attracted much attention.

[0004] The new golden mycobacterium acid rod-shaped bacteria (Mycobacterium sp.) MNR M3 faces a lot of environmental stress problems in the process of degrading phytosterols, such as insufficient oxygen intake, toxicity of substrates and products to the strain, etc. These stresses from biological and non-biological aspects in the production process always affect the production efficiency of AD, and ultimately affect the fermentation performance of the strain. Uneven energy supply in the process of degrading phytosterols can also lead to growth inhibition of the bacteria. So the most critical thing now is to solve the problem of growth inhibition of the bacteria.

[0005] The transcriptional regulatory factor DosR and triglyceride synthase tgs1 have the ability to regulate the TAG pathway and can initiate energy metabolism mechanisms to respond to adverse environments, but existing technologies do not have any research on the correlation between DosR, Tgs1 and the TGA pathway.

[0006] To improve the conversion rate of AD, the current technology usually uses genetic engineering to intervene in the key genes of the metabolic pathway, but the modified engineered bacteria still show reduced vitality during the fermentation process, affecting the strain performance in the later stage of fermentation, which is also the reason why AD cannot be produced in large quantities. When M. tuberculosis is subjected to environmental stress, the bacterial growth metabolic activity decreases and the synthesis of triacylglycerol (TAG) is enhanced through energy metabolic transfer to store energy and enter dormancy mode. DosR activates the start of this energy metabolic transfer mechanism by regulating the key enzymes of the TAG synthesis pathway, promoting the flow of acetyl CoA to the TAG synthesis pathway in response to environmental stress. The regulatory protein of DosR in the TAG synthesis pathway is triacylglycerol synthase tgs1, and the loss of tgs1 activity will lead to a significant decrease in the intracellular TAG content of the strain. By blocking the TAG pathway, it is confirmed that it has a role in energy metabolic transfer in the conversion of phytosterols. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method, a genetically engineered bacterium and an application thereof for improving the production of steroidal drug precursors by blocking the triglyceride synthesis pathway.

[0008] The technical solution adopted by the present invention to solve its technical problem is:

[0009] One of the technical solutions provided by the present invention is two engineered bacteria capable of producing steroid hormone drug intermediates, wherein the two strains are obtained by knocking out key genes affecting the TAG synthesis pathway in the starting strain; the key genes affecting the TAG synthesis pathway include: key enzyme tgs1 and transcriptional regulatory factor dosR;

[0010] Furthermore, the effects of the two genetically engineered bacteria on bacterial growth and AD transformation;

[0011] Furthermore, the effects of blocking the TAG synthesis pathway by the two genetically engineered bacteria on the content of key energy substances in the strains;

[0012] Furthermore, the starting strain is a strain capable of producing steroid hormone drug intermediates;

[0013] The steroid hormone drug intermediates include but are not limited to androst-4-ene-3,17-dione (androst-4-ene-3,17-dione, AD), androst-1,4-diene-3,17-dione (Androst-1,4-diene-3,17-dione, ADD), 9α-hydroxyandrost-4-ene-3,17-dione (9α-hydroxyandrost-4-ene-3,17-dione, 9α-OH-AD), etc.

[0014] Furthermore, the starting strain is Escherichia coli BL21 strain, Mycobacterium tuberculosis, Mycobacterium neoaurum, etc.

[0015] Preferably, the starting strain is a fast-growing new golden mycobacterium acid rod-shaped bacteria (Mycobacterium sp.) MNR M3, selected from Chinese patent CN115216435A, application number 202210421339.3, a method for improving sterol conversion by enhancing intracellular cofactor metabolism and sugar metabolism;

[0016] More preferably, the two strains of genetically engineered bacteria capable of producing steroid hormone drug intermediates are obtained by knocking out tgs1 and dosR respectively, using the fast-growing Mycobacterium sp. MNR M3 as the starting strain;

[0017] Furthermore, the key enzyme tgs1 affecting the TAG synthesis pathway has a nucleotide sequence as shown in SEQ ID NO.1;

[0018] Furthermore, the transcriptional regulatory factor dosR that affects the TAG synthesis pathway has a nucleotide sequence as shown in SEQ ID NO.2;

[0019] Furthermore, the genetically engineered bacteria knock out the key enzyme tgs1 and the transcriptional regulatory factor dosR that affect the TAG synthesis pathway by knocking out the vectors respectively;

[0020] Furthermore, the genetic engineering knockout vector is a bacterial knockout vector;

[0021] Preferably, the bacterial knockout vector is a mycobacterium knockout vector;

[0022] Furthermore, the genetic engineering expression vector is a bacterial expression vector;

[0023] Preferably, the bacterial expression vector is a mycobacterium expression vector;

[0024] More preferably, the mycobacterium expression vector is pMV306 and pMV261 mycobacterium-Escherichia coli shuttle expression vector; the mycobacterium knockout vector contains all or part of the sequence of p2NIL and pGOAL19 plasmids.

[0025] The second technical solution provided by the present invention is to provide a method for constructing the genetically engineered bacteria as described above, comprising the following steps:

[0026] (1) Preparation of MNR M3 competent cells: Inoculate the fast-growing Mycobacterium sp. MNR M3 into LB medium and culture at 30°C until OD 600 The inoculum volume was 1.0, and the inoculum volume was transferred to the seed culture medium at 10% of the volume of the culture medium for secondary seed culture; after 24 hours, 2% glycine was added and cultured at 30°C and 200rpm for 24 hours. The bacteria were collected by centrifugation at 4°C, and the suspended bacteria were washed with 1 times, 3 / 4 times, 1 / 2 times and 1 / 4 times the volume of the seed liquid with a concentration of 10% pre-cooled glycerol and centrifuged at 4°C. Finally, 1 / 25 times the volume of 10% glycerol was added to suspend the bacteria to obtain MNR M3 competent cells, which were then packaged and stored;

[0027] The seed culture medium consists of: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO3 1~5 g / L, and the rest is water, pH 6.0~7.5;

[0028] Fermentation medium composition: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, diammonium hydrogen phosphate 1~10 g / L, glucose 5~50 g / L, phytosterol 1~50 g / L, the rest is water, pH 6.0~7.5;

[0029] (2) Construction of knockout plasmid: Design primers for the upper and lower arms of dosR and tgs1 genes, and use the genomic DNA of MNR M3 as a template to amplify the upper and lower homologous arms of dosR and tgs1; the primers for the upper and lower arms of dosR and tgs1 genes are primers DosR-UP-F, DosR-UP-R, DosR-down -F, DosR-down-R, Tgs1-UP-F, Tgs1-UP-R, Tgs1-down-F, Tgs1-down-R, and their nucleotide sequences are shown in SEQ ID NO.3 to SEQ ID NO.10, respectively;

[0030] The upstream and downstream homologous arm genes of the target genes dosR and tgs1 were amplified by PCR technology, and connected to the mycobacterial gene knockout plasmid p2NIL that was double-digested with BamHⅠ and HindⅢ. After that, the above plasmids and pGOAL19 plasmid were digested with PacI and connected with T4 ligase to construct gene knockout plasmids pKO-dosR and pKO-tgs1, and the enzyme digestion was verified.

[0031] (3) Take 10 μL of pKO-dosR and pKO-tgs1 knockout plasmids and add them to 100 μL MNR M3 competent cells. After 30 minutes, transfer them to an electroporation cup for knockout. After electroporation at 2 kV / cm, 25 μF, and 720 Ω for 3-6 ms, place them on ice for 5 min, transfer them to a freshly sterilized 1.5 mL centrifuge and add 500 μL of fresh sterilized LB medium. Resuscitate them at 30°C and 200 rpm for 3-24 hours. Spread them on LB solid medium containing hyg 50 μg / ml, Kan 20 μg / ml, and X-gal 50 μg / ml and culture them for 5-7 days. Pick the colonies with blue spots and use the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R was verified as a single exchange strain by PCR; the verified single exchange bacteria were spread on 2% sucrose plates, inverted and cultured at 30°C for 3-7 days, white colonies were picked, and the genome was extracted and verified by PCR using the upstream forward primer DosR-UP-F / Tgs1-UP-F and the downstream reverse primer DosR-down-R / Tgs1-down-R. After successful verification, the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.

[0032] The third technical solution provided by the present invention is the use of the genetically engineered bacteria described in the first technical solution in the production of steroid hormone drug intermediates, especially in the production of AD.

[0033] The method for producing 4-androsten-3,17-dione using the genetically engineered bacteria as described above comprises the following steps:

[0034] The seed culture of the genetically engineered bacteria was transferred to the fermentation medium at an inoculation rate of 2-10%, and cultured at 25-35°C and 50-200 rpm for 24-168 h.

[0035] Furthermore, the yield of 4-androstene-3,17-dione can reach 0.3-30 g / L, and the molar conversion rate can reach 50%-100%.

[0036] Further, the formula of the fermentation medium is: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, diammonium hydrogen phosphate 1~10 g / L, glucose 5~50 g / L, phytosterol 1~50 g / L, and the rest is water, pH 6.0~7.5;

[0037] The formula of seed culture medium is: K2HPO40.1~3 g / L, MgSO40.1~3 g / L, ammonium ferric citrate 0.01~0.2g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO31~5 g / L, and the rest is water, pH 6.0~7.5.

[0038] The advantages and positive effects achieved by the present invention are:

[0039] 1. The present invention obtains recombinant strains MNR-ΔdosR and MNR-Δtgs1 by knocking out the key transcriptional regulatory factor dosR and the key synthesis enzyme tgs1 in the TAG synthesis pathway in the steroid hormone drug intermediate production bacteria MNR M3, respectively. During the fermentation process, the AD molar production rates of MNR-ΔdosR and MNR-Δtgs1 are higher than that of MNR. Among them, at 72 hours of fermentation, the AD molar production rate of MNR-ΔdosR is increased by 19.89% compared with the original strain, which is 1.51 times the AD molar production rate of MNR; the intracellular acetyl CoA content of MNR-ΔdosR and MNR-Δtgs1 is significantly improved compared with the original strain MNR. At 72 hours of fermentation, the intracellular acetyl CoA content of MNR-ΔdosR and MNR-Δtgs1 is increased by 49.97% and 43.46% respectively compared with MNR. Furthermore, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 was significantly increased. Among them, at 48 h of transformation, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 increased by 41.93% and 22.46% compared with MNR, respectively.

[0040] 2. The present invention has demonstrated for the first time the role of the transcriptional regulatory factor DosR and the key synthetic enzyme tgs1 in the production of steroidal drugs using plant sterols. The present invention significantly improves the conversion rate of AD, among which MNR-ΔdosR has the most obvious effect, and the AD conversion rate of the strain MNR starting from the same period has increased by 9.49%.

[0041] 3. The present invention solves the problem that insufficient intracellular energy supply in the early stage of fermentation leads to low conversion efficiency and high price of steroid drug precursors in the production process of steroid drug precursors by microbial method, and provides a new method for improving the production capacity of strains producing steroid hormone drug intermediates. The method can also be used for other industrial production strains and has a wide range of application value. The present invention solves the problem that in the production process of steroid hormone drug intermediates, the strain faces environmental stress, resulting in a decrease in bacterial viability, which in turn leads to low production of steroid hormone drug intermediates. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1This is a verification diagram of the genotype of the dosR knockout bacteria in the present invention;

[0043] Lane M is a DNA standard marker, Lane 1 is an amplified band containing the complete dosR gene, and Lane 2 is an amplified band containing the dosR gene with a 500bp deletion after the knockout (the starting strain has an amplified band at 2729bp, and the knockout strain has a band at 2329bp because it lacks dosR, and the missing 500bp is dosR);

[0044] Figure 2 This is a verification diagram of the genotype of the tgs1 knockout bacteria in the present invention;

[0045] Lane M is a DNA standard marker, lane 2 is an amplified band containing the complete tgs1 gene, and lane 1 is an amplified band containing the tgs1 gene with a 1239 bp deletion after the knockout (the starting strain has an amplified band at 2589 bp, and the knockout strain has a band at 1350 bp because it lacks tgs1. The missing 1239 bp is tgs1).

[0046] Figure 3 This is a graph showing the changes in intracellular TAG content of strains affected by MNR-ΔdosR, MNR-Δtgs1 and MNR in the present invention;

[0047] Figure 4 It is a graph showing changes in intracellular acetyl-CoA content of MNR-ΔdosR, MNR-Δtgs1 and MNR in the present invention;

[0048] Figure 5 It is a graph showing changes in intracellular ATP content of MNR-ΔdosR, MNR-Δtgs1 and MNR in the present invention;

[0049] Figure 6 This is a graph showing the changes in the AD molar production rates of MNR-ΔdosR, MNR-Δtgs1 and MNR in the present invention. DETAILED DESCRIPTION

[0050] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0051] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0052] A genetically engineered bacterium capable of sterol conversion, wherein the strain is obtained by knocking out a key gene affecting the TAG synthesis pathway in the starting strain;

[0053] The starting strain is a strain capable of producing steroid hormone drug intermediates.

[0054] Preferably, the starting strains include Escherichia coli BL21 strain, Mycobacterium tuberculosis, and Mycobacterium neoaurum;

[0055] Alternatively, the steroid hormone drug intermediates include androst-4-ene-3,17-dione (AD), androst-1,4-diene-3,17-dione (ADD), and 9α-hydroxyandrost-4-ene-3,17-dione (9α-hydroxyandrost-4-ene-3,17-dione, 9α-OH-AD).

[0056] Preferably, the strain is a fast-growing new golden mycobacterium acid rod-shaped bacteria (Mycobacterium sp.) MNR M3 as a starting strain, which is selected from Chinese patent CN115216435A, application number 202210421339.3, a method for improving sterol conversion by enhancing intracellular cofactor metabolism and sugar metabolism.

[0057] Preferably, the key genes of the TAG synthesis pathway include: a transcriptional regulatory factor dosR and a key enzyme tgs1, the nucleotide sequence of the key enzyme tgs1 is shown in SEQ ID NO.1, and the nucleotide sequence of the transcriptional regulatory factor dosR is shown in SEQ ID NO.2.

[0058] The method for constructing the genetically engineered bacteria as described above comprises the following steps:

[0059] (1) Preparation of MNR M3 competent cells: Inoculate the fast-growing Mycobacterium sp. MNR M3 into LB medium and culture at 30°C until OD 600 The inoculum volume was 1.0, and the inoculum volume was transferred to the seed culture medium at 10% of the volume of the culture medium for secondary seed culture; after 24 hours, 2% glycine was added and cultured at 30°C and 200rpm for 24 hours. The bacteria were collected by centrifugation at 4°C, and the suspended bacteria were washed with 1 times, 3 / 4 times, 1 / 2 times and 1 / 4 times the volume of the seed liquid with a concentration of 10% pre-cooled glycerol and centrifuged at 4°C. Finally, 1 / 25 times the volume of 10% glycerol was added to suspend the bacteria to obtain MNR M3 competent cells, which were then packaged and stored;

[0060] The seed culture medium consists of: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO3 1~5 g / L, and the rest is water, pH 6.0~7.5;

[0061] Fermentation medium composition: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, diammonium hydrogen phosphate 1~10 g / L, glucose 5~50 g / L, phytosterol 1~50 g / L, the rest is water, pH 6.0~7.5;

[0062] (2) Construction of knockout plasmid: Design primers for the upper and lower arms of dosR and tgs1 genes, and use the genomic DNA of MNR M3 as a template to amplify the upper and lower homologous arms of dosR and tgs1; the primers for the upper and lower arms of dosR and tgs1 genes are primers DosR-UP-F, DosR-UP-R, DosR-down -F, DosR-down-R, Tgs1-UP-F, Tgs1-UP-R, Tgs1-down-F, Tgs1-down-R, and their nucleotide sequences are shown in SEQ ID NO.3 to SEQ ID NO.10, respectively;

[0063] The upstream and downstream homologous arm genes of the target genes dosR and tgs1 were amplified by PCR technology, and connected to the mycobacterial gene knockout plasmid p2NIL that was double-digested with BamHⅠ and HindⅢ. After that, the above plasmids and pGOAL19 plasmid were digested with PacI and connected with T4 ligase to construct gene knockout plasmids pKO-dosR and pKO-tgs1, and the enzyme digestion was verified.

[0064] (3) Take 10 μL of pKO-dosR and pKO-tgs1 knockout plasmids and add them to 100 μL MNR M3 competent cells. After 30 minutes, transfer them to an electroporation cup for knockout. After electroporation at 2 kV / cm, 25 μF, and 720 Ω for 3-6 ms, place them on ice for 5 min, transfer them to a freshly sterilized 1.5 mL centrifuge and add 500 μL of fresh sterilized LB medium. Resuscitate them at 30°C and 200 rpm for 3-24 hours. Spread them on LB solid medium containing hyg 50 μg / ml, Kan 20 μg / ml, and X-gal 50 μg / ml and culture them for 5-7 days. Pick the colonies with blue spots and use the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R was verified as a single exchange strain by PCR; the verified single exchange bacteria were spread on 2% sucrose plates, inverted and cultured at 30°C for 3-7 days, white colonies were picked, and the genome was extracted and verified by PCR using the upstream forward primer DosR-UP-F / Tgs1-UP-F and the downstream reverse primer DosR-down-R / Tgs1-down-R. After successful verification, the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.

[0065] The use of the genetically engineered bacteria as described above in steroid transformation.

[0066] Preferably, the steroid is 4-androsten-3,17-dione.

[0067] The method for producing 4-androsten-3,17-dione using the genetically engineered bacteria as described above comprises the following steps:

[0068] The seed culture of the genetically engineered bacteria was transferred to the fermentation medium at an inoculation rate of 2-10%, and cultured at 25-35°C and 50-200 rpm for 24-168 h.

[0069] Preferably, the yield of 4-androstene-3,17-dione can reach 0.3-30 g / L, and the molar conversion rate can reach 50%-100%.

[0070] Preferably, the formula of the fermentation medium is: K2HPO4 0.1-3 g / L, MgSO4 0.1-3 g / L, ammonium ferric citrate 0.01-0.2 g / L, citric acid 1-5 g / L, diammonium hydrogen phosphate 1-10 g / L, glucose 5-50 g / L, phytosterol 1-50 g / L, and the rest is water, pH 6.0-7.5;

[0071] The formula of seed culture medium is: K2HPO40.1~3 g / L, MgSO40.1~3 g / L, ammonium ferric citrate 0.01~0.2g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO31~5 g / L, and the rest is water, pH 6.0~7.5.

[0072] Specifically, the relevant preparation and detection are as follows:

[0073] Some of the amplification primers involved in the embodiments of the present invention are as follows:

[0074] dosR upper arm primers DosR-UP-F and DosR-UP-R:

[0075] DosR-UP-F: cataaactaccgcattaaagcttcggaaagatccccggc;

[0076] DosR-UP-R:ttcttcaccgtcttctcggcgagcgcctcggcgaccgtgc;

[0077] dosR down arm primers DosR-down-F and DosR-down-R:

[0078] DosR-down -F:gccgagaagacggtgaagaa;

[0079] DosR-down-R: actatagaatacataggatcccgcttcacccgcgcagtc.

[0080] Tgs1 upper arm primers Tgs1-UP-F and Tgs1-UP-R:

[0081] Tgs1-UP-F: taaactaccgcattaaagcttgaggcagcgccgcagaccgc;

[0082] Tgs1-UP-R:gttgtacgactcatagccgagcccaccg;

[0083] Tgs1 down arm primers Tgs1-down-F and Tgs1-down-R:

[0084] Tgs1-down-F:tcggctatgagtcgtacaacggatgctctactT;

[0085] Tgs1-down-R: actatagaatacataggatccatggaggtggggatcaggtt.

[0086] The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions, such as those described in the Molecular Cloning Experiment Guide (Fourth Edition) (Science Press, 2017).

[0087] The present invention is further explained below by means of specific examples.

[0088] Example 1 Construction of DosR and Tgs1 encoding gene deletion engineered bacteria

[0089] Construct a mycobacterium gene knockout plasmid, electrotransform it into mycobacterium competent cells, use hygromycin and kanamycin for dual resistance screening and blue-white screening at the same time. The correct strains are screened on sucrose plates and kanamycin resistance is screened again to obtain gene knockout positive clones. The gene knockout clones are verified by PCR. The specific steps are as follows:

[0090] 1. Preparation of MNR M3 competent cells: Inoculate the MNR M3 strain (the strain is a fast-growing new golden mycobacterium acid rod-shaped bacterium (Mycobacterium sp.) MNR M3, which is selected from Chinese patent CN115216435A, application number 202210421339.3, a method for improving sterol conversion by enhancing intracellular cofactor metabolism and sugar metabolism) into LB medium and culture at 30°C until OD 600 When the inoculum volume is about 1.0, transfer to the seed culture medium at 10% of the volume of the culture medium for secondary seed culture; after 24 hours, add 2% glycine and continue to culture at 30℃, 200rpm for 24 hours. Collect the bacteria by centrifugation at 4℃, wash and suspend the bacteria with 1 times, 3 / 4 times, 1 / 2 times and 1 / 4 times the volume of the seed liquid with a concentration of 10% pre-cooled glycerol and centrifuge at 4℃, finally add 1 / 25 times the volume of 10% glycerol to suspend the bacteria and store them in aliquots.

[0091] Seed culture medium composition: K2HPO40.1~3 g / L, MgSO40.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO31~5 g / L, and the rest is water, pH 6.0~7.5.

[0092] Fermentation medium composition: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, diammonium hydrogen phosphate 1~10 g / L, glucose 5~50 g / L, phytosterols 1~50 g / L, and the rest is water, pH 6.0~7.5.

[0093] 2. Construction of knockout plasmid: Design primers for the upper and lower arms of dosR and tgs1 genes, and use the genomic DNA of M3 (Mycobacterium sp. MNR M3, the genome of the starting strain) as a template to amplify the upper and downstream homologous arms of dosR and tgs1.

[0094] The upstream and downstream homologous arm genes of the target genes dosR and tgs1 were amplified by PCR technology, and connected to the mycobacterial gene knockout plasmid p2NIL double-digested with BamHI and HindⅢ using the Minerva Super Fusion Cloning Kit. After that, the above plasmids and pGOAL19 plasmid were digested with PacI and connected with T4 ligase to construct gene knockout plasmids pKO-dosR and pKO-tgs1, and enzyme digestion was verified.

[0095] 3. Take 10 μL of pKO-dosR and pKO-tgs1 knockout plasmids and add them to 100 μL M3 competent bacteria. Place them for 30 minutes and then transfer them to an electroporation cup for electroporation. Electroporation was performed under the conditions of 2 kV / cm, 25 μF, and 720 Ω for 3-6 ms. After placing them on ice for 5 min, they were transferred to a newly sterilized 1.5 mL centrifuge and 500 μL of fresh sterilized LB medium was added. The culture was revived at 30°C and 200 rpm for 3-24 hours. Spread them on LB solid medium containing hyg 50 μg / ml, Kan 20 μg / ml, and X-gal 50 μg / ml and cultured for 5-7 days. The colonies with blue spots were picked and verified as single exchange strains by PCR using the upstream forward primer (DosR-UP-F / Tgs1-UP-F) and the downstream reverse primer (DosR-down-R / Tgs1-down-R). The verified single exchange bacteria were spread on 2% sucrose plates, incubated at 30°C for 3-7 days, and white colonies were picked. The genome was extracted and PCR verified using the upstream forward primer (DosR-UP-F / Tgs1-UP-F) and the downstream reverse primer (DosR-down-R / Tgs1-down-R). Figure 1 , Figure 2), the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.

[0096] Example 2 Comparison of intracellular TAG content in strains with MNR, MNR-ΔdosR, and MNR-Δtgs1

[0097] 1. TAG content detection

[0098] MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 were cultured according to the method of Example 1, and 1 mL of fermentation broth was collected and centrifuged at 12000 r / min and 4°C for 2 min to discard the supernatant. After washing twice with pre-cooled 1×PBS, 200 μL RIPA was added, and liquid nitrogen was repeatedly frozen and thawed 3 times, 800 mL of sterile water was added, and ultrasonic crushing was performed using an ultrasonic crusher for 10 min, with the working condition of ultrasonication for 10 s every 5 s. The bacterial TAG was extracted using isopropanol, and the intracellular triglyceride content was analyzed according to the method of the triglyceride quantitative detection kit.

[0099] 2. Comparison of results

[0100] The intracellular TAG content of the recombinant strains MNR-ΔdosR and MNR-Δtgs1 was measured and compared with that of MNR ( Figure 3 ). It can be found that during the fermentation process, the intracellular TAG content of MNR-ΔdosR and MNR-Δtgs1 was significantly lower than that of MNR. The TAG content of MNR-ΔdosR decreased from 3.81 μmol / g DCW of the starting strain MNR to 2.47 μmol / g DCW at 48 h of fermentation, which was 35.43% lower than that of MNR. The TAG content of MNR-Δtgs1 was the lowest, which was 4.26 μmol / g DCW at 72 h of fermentation, and its TAG content was 36.78% lower than that of MNR at 5.70 μmol / g DCW.

[0101] Example 3 Comparison of intracellular acetyl-CoA content of MNR-ΔdosR, MNR-Δtgs1 and MNR

[0102] 1. Detection of intracellular acetyl CoA content

[0103] MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 were cultured according to the method of Example 1, and the fermentation broth was taken at regular intervals. 0.1 g of the cells were collected by centrifugation and then rapidly frozen and crushed. The samples were deproteinized by PCA precipitation and then used for acetyl-CoA detection. The acetyl-CoA detection kit was purchased from Merck Life Sciences (Acetyl-CoA Kit MAK039) and used for the determination of intracellular acetyl-CoA content according to the reagent ratio in Table 1.

[0104] First, sample preparation and background removal: take 50 μL of standard in the standard well, take 50 μL of sample and add it to the sample well and sample background well respectively. In order to correct the background generated by free CoA and succinyl CoA, add 10 μL of acetyl CoA quencher to the standard well, sample well and sample background well. Incubate at room temperature for 5 minutes. Then add 2 μL of quench remover on the instruction manual, mix well, and incubate for another 5 minutes.

[0105] Secondly, prepare the reaction mixture according to the scheme in Table 1. Add 50 μL of standard well and sample well reaction mixture to each standard well and sample well, add 50 μL of background reaction mixture to each background sample well, mix them evenly with a horizontal shaker or pipette, and incubate the reaction at 37°C in the dark for 10 minutes. Finally, use a microplate reader to measure the fluorescence intensity, with the maximum excitation wavelength of 535 nm and the emission wavelength of 587 nm.

[0106] Table 1 Reaction mixture (reagents from Acetyl Coenzyme A Detection Kit)

[0107]

[0108] 2. Comparison of results

[0109] The synthesis of TAG in mycobacterium acidobacteria begins with the conversion of acetyl CoA. The intracellular acetyl CoA content of the recombinant strains MNR-ΔdosR and MNR-Δtgs1 was significantly increased compared with the original strain MNR. Among them, at 72 h of fermentation, the intracellular acetyl CoA content of MNR-ΔdosR and MNR-Δtgs1 was 6.75 μmol / g DCW and 6.47 μmol / g DCW, respectively, which was 49.97% and 43.46% higher than that of MNR4.51μmol / g DCW, respectively. At the same time, at 24 h of conversion, the intracellular acetyl CoA content of MNR-ΔdosR was 3.73 μmol / g DCW, which was significantly increased by 22.56% compared with 2.97 μmol / g DCW of MNR ( Figure 4 ).

[0110] Example 4 Comparison of intracellular ATP content of MNR, MNR-ΔdosR, and MNR-Δtgs1

[0111] 1. ATP content detection

[0112] MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 were cultured according to the method of Example 1. 100 μL of fermentation broth was taken every 24 h in a black 96-well plate, and an equal volume of BacTiter-Glo™ buffer was added to the sample wells. The plates were incubated at 25°C, 100 r / min for 5 min, and the fluorescence value was detected by an ELISA reader in the Luminescence mode. The sterile culture medium was used as a blank control. The ATP concentration corresponding to the fluorescence value was calculated using the standard curve.

[0113] 2. Comparison of results

[0114] The differences in intracellular ATP content between MNR-ΔdosR and MNR-Δtgs1 were compared with the original strain MNR ( Figure 5 ). The results showed that compared with MNR, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 was significantly increased. Among them, at 48 h after transformation, the intracellular ATP content of MNR-ΔdosR and MNR-Δtgs1 was 5.90 μmol / g DCW and 5.07 μmol / gDCW, respectively, which was 41.93% and 22.46% higher than that of MNR (4.15 μmol / g DCW). In short, the blockage of the TAG synthesis pathway reduced the diversion of acetyl CoA, allowing more acetyl CoA to enter the TCA cycle, promoting the generation of ATP, and thus increasing the biomass of the strain in the early stage of transformation.

[0115] Example 5 Comparison of AD molar production rates of MNR, MNR-ΔdosR, and MNR-Δtgs1

[0116] 3. AD molar generation rate detection

[0117] AD was produced using MNR (MNR M3), MNR-ΔdosR, and MNR-Δtgs1 strains according to the method of Example 1, and 0.8 mL of samples were taken under sterile conditions during the production process.

[0118] Detection of AD generation: ultrasonically extract the sample solution with an equal volume of ethyl acetate, centrifuge at 10,000 rpm for 10 min, take 0.1 mL of the supernatant in a 1.5 mL tube, air dry naturally, add the mobile phase to dissolve, and perform high performance liquid chromatography analysis after passing through a 0.22 μm membrane. Chromatographic conditions: C18 column, mobile phase methanol: water (4:1, volume ratio), flow rate of 1 mL / min, column temperature of 30°C, detection wavelength of 254 nm. The calculation formula for molar conversion is:

[0119] Molar yield % = (Cp × Ms) / (Cs × Mp) × 100%, where Cp is the product concentration (g / L), Cs is the substrate concentration (g / L), Mp is the product molar mass, and Ms is the substrate molar mass.

[0120] 4. Comparison of results

[0121] The AD molar production rates of MNR-ΔdosR and MNR-Δtgs1 were higher than those of MNR. At 72 h of fermentation, the AD molar production rate of MNR-ΔdosR was 53.01%, which was 19.89% higher than that of the original strain and 1.51 times that of MNR ( Figure 6 ). At the same time, the highest AD molar production rate of MNR-ΔdosR was 93.27%, which was 9.49% higher than that of the original strain. Before the end of fermentation, the AD molar production rate of MNR-Δtgs1 was higher than that of MNR, but the highest AD molar production rate was only 1.9% higher than that of the original strain.

[0122] In summary, the present invention obtains recombinant strains MNR-ΔdosR and MNR-Δtgs1 by knocking out the key transcriptional regulatory factor dosR and the key enzyme tgs1 of the TAG synthesis pathway in the steroid hormone drug intermediate production bacteria MNR M3, thereby solving the problem of bacterial growth inhibition. The prior art has not made relevant research on the relationship between DosR, Tgs1 and the TAG pathway. The present invention is the first to improve the energy supply in the early stage of strain transformation, alleviate strain growth inhibition, and significantly improve the conversion rate of AD, among which MNR-ΔdosR has the most obvious effect, and the AD conversion rate of the starting strain MNR at the same period has increased by 9.49%.

[0123] The relevant sequences are as follows:

[0124] SEQ ID NO.1 (tgs1, a key enzyme affecting TAG synthesis pathway):

[0125] GTGGTGAAGGTATTTCTGGTCGAcgaccatgaggtcgtccggcgtggactgatcgacctgctcggctccgatcccgacctcgaggttgtgggggaggcgggcacggtcgccgaggcgctcgccagaattcctgccgtgcggcccgaggtcgccgtgctcgatgtccggttacccgatggcaacggcatcgagctgtgccgcgatctgctctccgagcttcccgatctgcgctgtctgatgctcacctcgttcacctccgacgaagccatgctcgatgccatcctggccggcgccagtggatacgtcgtcaaggacatcaagggcctggaactggccaacgccatcaaggaggtcggggcaggtcgctcgttgctcgacaatcgggccgccgcggcgctgatggccaatctgcgcggtgccgccgagcgtgctgacccgctgaccgggctgaccgagcaggagcgcaccctgctgcacctgttgtccgagggcctcaccaaccgccagatcgcggccaggatgttcctcgccgagaagacggtgaagaactacgtgtccaggttgcttgccaagctcgggatggaacgccgcacgcaggcagcggttttcgcgtccaagctggaatggggagagagcgggcgcggccgttcagcactGCCACTCGACGACCGTTGA

[0126] SEQ ID NO.2 (Transcriptional regulator dosR affecting the TAG synthesis pathway):

[0127]

[0128] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered bacterium capable of sterol conversion, characterized in that: The strain is obtained by knocking out the key gene affecting the TAG synthesis pathway in the starting strain; The starting strain is a strain capable of producing steroid hormone drug intermediates.

2. The genetically engineered bacterium according to claim 1, characterized in that: The starting strains include Escherichia coli BL21 strain, Mycobacterium tuberculosis, and Mycobacterium neoaurum; Alternatively, the steroid hormone drug intermediates include androst-4-ene-3,17-dione, androst-1,4-diene-3,17-dione, and 9α-hydroxyandrost-4-ene-3,17-dione.

3. The genetically engineered bacterium according to claim 1, characterized in that: The strain is obtained by using the fast-growing new golden mycobacterium acid rod-shaped bacteria (Mycobacterium sp.) MNR M3 as the starting strain and knocking out tgs1 and dosR respectively.

4. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that: The key genes of the TAG synthesis pathway include: transcriptional regulatory factor dosR and key enzyme tgs1, the nucleotide sequence of the key enzyme tgs1 is shown in SEQ ID NO.1, and the nucleotide sequence of the transcriptional regulatory factor dosR is shown in SEQ ID NO.

2.

5. The method for constructing a genetically engineered bacterium according to any one of claims 1 to 3, characterized in that: The steps include: (1) Preparation of MNR M3 competent cells: Inoculate the fast-growing new golden mycobacterium acid rod-shaped bacteria (Mycobacterium sp.) MNR M3 into LB medium and culture at 30°C until OD 600 The inoculum volume was 1.0, and the inoculum volume was transferred to the seed culture medium at 10% of the volume of the culture medium for secondary seed culture. After 24 hours, 2% glycine was added and cultured at 30°C, 200rpm for 24 hours. The cells were collected by centrifugation at 4°C, and the suspended cells were washed with 1 times, 3 / 4 times, 1 / 2 times and 1 / 4 times the volume of the seed liquid with a concentration of 10% pre-cooled glycerol, respectively, and centrifuged at 4°C. Finally, 1 / 25 times the volume of 10% glycerol was added to suspend the cells to obtain MNRM3 competent cells, which were packaged and stored. The seed culture medium consists of: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO3 1~5 g / L, and the rest is water, pH 6.0~7.5; Fermentation medium composition: K2HPO4 0.1~3 g / L, MgSO4 0.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, diammonium hydrogen phosphate 1~10 g / L, glucose 5~50 g / L, phytosterol 1~50 g / L, the rest is water, pH 6.0~7.5; (2) Construction of knockout plasmid: Design primers for the upper and lower arms of dosR and tgs1 genes, and use the genomic DNA of MNR M3 as a template to amplify the upper and lower homologous arms of dosR and tgs1; the primers for the upper and lower arms of dosR and tgs1 genes are primers DosR-UP-F, DosR-UP-R, DosR-down -F, DosR-down-R, Tgs1-UP-F, Tgs1-UP-R, Tgs1-down-F, Tgs1-down-R, and their nucleotide sequences are shown in SEQ ID NO.3 to SEQ ID NO.10, respectively; The upstream and downstream homologous arm genes of the target genes dosR and tgs1 were amplified by PCR technology, and connected to the mycobacterial gene knockout plasmid p2NIL that was double-digested with BamHⅠ and HindⅢ. After that, the above plasmids and pGOAL19 plasmid were digested with PacI and connected with T4 ligase to construct gene knockout plasmids pKO-dosR and pKO-tgs1, and the enzyme digestion was verified. (3) Take 10 μL of pKO-dosR and pKO-tgs1 knockout plasmids and add them to 100 μL MNR M3 competent cells. Place them for 30 minutes and then transfer them to an electroporation cup for knockout. Electroporation was performed at 2 kV / cm, 25 μF, and 720 Ω for 3-6 ms. After that, the cells were placed on ice for 5 min and then transferred to a freshly sterilized 1.5 mL centrifuge and 500 μL of fresh sterilized LB medium was added. The cells were revived at 30°C and 200 rpm for 3-24 hours. The cells were spread on LB solid medium containing 50 μg / ml hyg, 20 μg / ml Kan, and 50 μg / ml X-gal and cultured for 5-7 days. The colonies with blue spots were picked and the upstream forward primers DosR-UP-F / Tgs1-UP-F and the downstream reverse primers DosR-down-R / Tgs1-down-R was verified as a single exchange strain by PCR; the verified single exchange bacteria were spread on 2% sucrose plates, inverted and cultured at 30°C for 3-7 days, white colonies were picked, and the genome was extracted and verified by PCR using the upstream forward primer DosR-UP-F / Tgs1-UP-F and the downstream reverse primer DosR-down-R / Tgs1-down-R. After successful verification, the dosR gene deletion strain was named MNR-ΔdosR, and the tgs1 gene deletion strain was named MNR-Δtgs1.

6. Use of the genetically engineered bacteria according to any one of claims 1 to 4 in steroid transformation.

7. The use according to claim 6, characterized in that: The steroid is 4-androstene-3,17-dione.

8. A method for producing 4-androsten-3,17-dione using the genetically engineered bacteria according to any one of claims 1 to 4, characterized in that: The steps include: The seed culture of the genetically engineered bacteria was transferred to the fermentation medium at an inoculation rate of 2-10%, and cultured at 25-35°C and 50-200 rpm for 24-168 h.

9. The method according to claim 8, characterized in that: The yield of 4-androstene-3,17-dione can reach 0.3-30 g / L, and the molar conversion rate can reach 50%-100%.

10. The method according to claim 8 or 9, characterized in that: The formula of the fermentation medium is: K2HPO4 0.1-3 g / L, MgSO4 0.1-3 g / L, ammonium ferric citrate 0.01-0.2 g / L, citric acid 1-5 g / L, diammonium hydrogen phosphate 1-10 g / L, glucose 5-50 g / L, phytosterol 1-50 g / L, and the rest is water, pH 6.0-7.5; The formula of seed culture medium is: K2HPO40.1~3 g / L, MgSO40.1~3 g / L, ammonium ferric citrate 0.01~0.2 g / L, citric acid 1~5 g / L, ammonium nitrate 1~5 g / L, glycerol 5~50 g / L, glucose 5~50 g / L, CaCO31~5 g / L, and the rest is water, pH 6.0~7.5.

Images