Recombinant bacterium for fermentation production of D-panthenol and application thereof

Abstract

The invention discloses a recombinant bacterium for fermentation production of D-panthenol and application of the recombinant bacterium. The invention relates to the technical field of biology, and provides a recombinant bacterium for fermentation production of D-panthenol, which is obtained by expressing tyrosine decarboxylase and D-pantothenic acid synthetase in a chassis host bacterium, the chassis host bacteria are escherichia coli capable of synthesizing D-pantoic acid and L-homoserine by using glucose. Compared with an existing chemical synthesis method, pure biosynthesis from glucose to D-panthenol is achieved, the method has the advantages of being environmentally friendly, low in cost and the like, and a good foundation is laid for large-scale industrial production of D-panthenol.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant bacterium for producing D-panthenol by fermentation and an application thereof. Background Art

[0002] D-Panthenol is an alcohol derivative of pantothenic acid (vitamin B5) and is widely used in medicine, cosmetics and food industries.

[0003] At present, the production of D-panthenol mainly relies on chemical synthesis, but this method has problems such as harsh reaction conditions, severe environmental pollution and high cost. In recent years, with the development of synthetic biology, the use of microbial cell factories to synthesize D-panthenol has become a green and sustainable alternative. However, the efficiency of microbial synthesis of D-panthenol in the existing technology is low and it is difficult to meet the needs of industrial production.

[0004] Therefore, developing a genetically engineered strain that can efficiently synthesize D-panthenol has important application value. Summary of the invention

[0005] The purpose of the present invention is to provide a recombinant bacterium for producing D-panthenol by fermentation and application thereof.

[0006] In a first aspect, the present invention claims a recombinant bacterium for producing D-panthenol by fermentation.

[0007] The recombinant bacteria for fermentation production of D-panthenol claimed in the present invention are obtained by expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacteria; Wherein, the chassis host bacteria is Escherichia coli which can synthesize D-pantoic acid and L-homoserine by utilizing glucose.

[0008] Furthermore, the tyrosine decarboxylase may be derived from Enterococcus faecalis V583 ( Enterococcus faecalis ) or a variant thereof, specifically, it may be as follows (A1) or (A2): (A1) a protein having an amino acid sequence as shown in SEQ ID No. 1; (A2) Fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0009] Furthermore, the D-pantothenate synthase may be a D-pantothenate synthase derived from Mycobacterium tuberculosis or a variant thereof, which may be specifically as follows (B1) or (B2): (B1) a protein having an amino acid sequence as shown in SEQ ID No. 2; (B2) Fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1).

[0010] The purpose of adding the protein tag may be to facilitate the purification of the target protein, such as 6His.

[0011] Furthermore, the expression of the tyrosine decarboxylase and the D-pantothenate synthetase in the chassis host bacteria can be achieved by introducing a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthetase into the chassis host bacteria.

[0012] Furthermore, the coding gene capable of expressing the tyrosine decarboxylase and the coding gene capable of expressing the D-pantothenate synthetase can be introduced into the chassis host bacteria in the form of a recombinant vector.

[0013] In one embodiment of the present invention, the recombinant vector is specifically a recombinant plasmid obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pTrc99A with the mutV583ADC gene (i.e., the tyrosine decarboxylase encoding gene) shown in SEQ ID No.3 and the MtpanC gene (i.e., the D-pantothenate synthase encoding gene) fragment shown in SEQ ID No.4.

[0014] Furthermore, the sequence of the gene encoding the tyrosine decarboxylase may be as follows (C1) or (C2): (C1) SEQ ID No. 3; (C2) The sequence obtained by connecting the coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No. 3.

[0015] Among them, SEQ ID No.3 encodes the amino acid sequence shown in SEQ ID No.1.

[0016] Furthermore, the sequence of the gene encoding the D-pantothenate synthase may be as follows (D1) or (D2): (D1) SEQ ID No. 4; (D2) The sequence obtained by connecting the coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No. 4.

[0017] Among them, SEQ ID No.4 encodes the amino acid sequence shown in SEQ ID No.2.

[0018] Furthermore, the chassis host bacteria is Escherichia coli that expresses acetolactate synthase alsS, dihydroxyacid dehydratase ilvD, α-ketoisovalerate hydroxymethyltransferase panB, ketovalerate reductase panE, homoserine dehydrogenase thrA*, and does not express fumarate reductase frdABCD, acetate kinase ackA, lactate dehydrogenase ldhA, alcohol dehydrogenase adhE, pyruvate oxidase poxB, pyruvate formate lyase pflB, phosphotransacetylase pta, propionate kinase tdcD, 2-ketobutyrate formate lyase tdcE, methylglyoxal synthase mgsA, choline dehydrogenase betA, Toll-Pal system protein tolR, and putative PTS enzyme IIC component frwC.

[0019] Among them, the amino acid sequence of the acetolactate synthase alsS is SEQ ID No.18, and the corresponding coding gene sequence is the reverse complementary sequence of positions 504-2215 of SEQ ID No.15; the amino acid sequence of the dihydroxyacid dehydratase ilvD is SEQ ID No.19, and the corresponding coding gene sequence is positions 548-2398 of SEQ ID No.16; the amino acid sequence of the α-ketoisovalerate hydroxymethyltransferase panB is SEQ ID No.20, and the corresponding coding gene sequence is positions 1516-2310 of SEQ ID No.17; the amino acid sequence of the ketovalerate reductase panE is SEQ ID No.21, and the corresponding coding gene sequence is positions 553-1464 of SEQ ID No.17; the amino acid sequence of the homoserine dehydrogenase thrA* is SEQ ID No.22, and the corresponding coding gene sequence is positions 1114-3576 of SEQ ID No.14. The amino acid sequence of the fumarate reductase frdABCD is the sequence shown in genbank No. NP_418577.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 948666; the amino acid sequence of the acetate kinase ackA is the sequence shown in genbank No. NP_416799.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 946775; the amino acid sequence of the lactate dehydrogenase ldhA is the sequence shown in genbank No. NP_415898.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 946315; the amino acid sequence of the alcohol dehydrogenase gene adhE is the sequence shown in genbank No. NP_415757.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945837; the amino acid sequence of the pyruvate oxidase poxB is the sequence shown in genbank No. NP_415392.1 (updated date, 20220309), and the corresponding coding gene sequence is GeneID: 946132; the amino acid sequence of the pyruvate formate lyase pflB is the sequence shown in genbank No. NP_415423.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945514; the amino acid sequence of the phosphotransacetylase pta is the sequence shown in genbank No. NP_416800.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 946778; the amino acid sequence of the propionate kinase tdcD is the genbank No. NP_417585.2 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 947635; the amino acid sequence of the 2-ketobutyrate formate lyase gene tdcE is the sequence shown in genbank No. YP_026205.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 947623; the amino acid sequence of the methylglyoxal synthase mgsA is the sequence shown in genbank No. NP_415483.2 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945574; the amino acid sequence of the choline dehydrogenase betA is the genbank No. NP_414845.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945716; the amino acid sequence of the Toll-Pal system protein tolR is the sequence shown in genbank number NP_415266.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 945328; the amino acid sequence of the putative PTS enzyme IIC component frwC is the sequence shown in genbank number NP_418384.1 (updated date, 20220309), and the corresponding coding gene sequence is Gene ID: 948448. .

[0020] In one embodiment of the present invention, the recipient Escherichia coli is obtained by performing the following transformations on Escherichia coli ATCC 9637: (a1) knocking out the coding gene of the fumarate reductase frdABCD in the genome; (a2) knocking out the coding gene of the acetate kinase ackA in the genome; (a3) ​​knocking out the coding gene of the lactate dehydrogenase ldhA in the genome; (a4) knocking out the coding gene of the alcohol dehydrogenase adhE in the genome; (a5) knocking out the coding gene of the pyruvate oxidase poxB in the genome; (a6) knocking out the coding gene of the pyruvate formate lyase pflB in the genome; (a7) knocking out the coding gene of the phosphotransacetylase pta in the genome; (a8) knocking out the coding gene of the propionate kinase tdcD in the genome; (a9) knocking out the coding gene of the 2-ketobutyrate formate lyase tdcE in the genome; (a10) knocking out the putative PTS enzyme IIC component protein frwC (amino acid sequence as shown in SEQ ID NO: 1) in the genome. ID No.23) is replaced by an expression cassette containing a gene encoding homoserine dehydrogenase thrA* (amino acid sequence as shown in SEQ ID No.22) (i.e., expression cassette 1); (a11) the gene encoding methylglyoxal synthase mgsA (amino acid sequence as shown in SEQ ID No.24) in the genome is replaced by an expression cassette containing a gene encoding acetolactate synthase alsS (amino acid sequence as shown in SEQ ID No.18) (i.e., expression cassette 2); (a12) the gene encoding choline dehydrogenase betA (amino acid sequence as shown in SEQ ID No.25) in the genome is replaced by an expression cassette containing a gene encoding dihydroxyacid dehydratase ilvD (amino acid sequence as shown in SEQ ID No.19) (i.e., expression cassette 3); (a13) the gene encoding Toll-Pal system protein tolR (amino acid sequence as shown in SEQ ID No.26) in the genome is replaced by an expression cassette containing a gene encoding α-ketoisovalerate hydroxymethyltransferase panB (amino acid sequence as shown in SEQ ID No.20) and the expression cassette (i.e., expression cassette 4) encoding the gene of the ketovalerate reductase panE (amino acid sequence is shown in SEQ ID No.21).

[0021] In the expression cassette 1, the promoter that initiates the transcription of the homoserine dehydrogenase thrA* encoding gene is the P119 promoter. Further, the expression cassette 1 comprises the P119 promoter, the RBS sequence (AAAGAGGAGAAA) and the homoserine dehydrogenase thrA* encoding gene. The sequence of the P119 promoter is shown in positions 998-1032 of SEQ ID No. 14.

[0022] In the expression cassette 2, the promoter that initiates the transcription of the gene encoding the acetolactate synthase alsS is the J119 promoter. Further, the expression cassette 2 comprises the P119 promoter, the RBS sequence (AGGAG), and the gene encoding the acetolactate synthase alsS. The sequence of the P119 promoter is shown in the reverse complementary sequence of positions 2232-2266 of SEQ ID No. 15.

[0023] In the expression cassette 3, the promoter that initiates the transcription of the gene encoding the dihydroxyacid dehydratase ilvD is the P119 promoter. Further, the expression cassette 3 comprises the P119 promoter, the RBS sequence (AGGAG) and the gene encoding the dihydroxyacid dehydratase ilvD. The sequence of the P119 promoter is shown in positions 497-531 of SEQ ID No. 16.

[0024] In the expression cassette 4, the promoter that initiates the transcription of the gene encoding the α-ketoisovalerate hydroxymethyltransferase panB and the gene encoding the ketovalerate reductase panE is the P119 promoter. Further, the expression cassette 4 comprises the P119 promoter, the gene encoding the α-ketoisovalerate hydroxymethyltransferase panB and the gene encoding the ketovalerate reductase panE. The sequence of the P119 promoter is shown in positions 502-536 of SEQ ID No. 17.

[0025] More specifically, (a1) to (a13) can all be achieved by Crispr / cas9 technology. In a specific implementation case of the present invention, the nucleotide sequence of the targeting fragment (donor fragment) used in (a1) is shown as SEQ ID No.5; the nucleotide sequence of the targeting fragment (donor fragment) used in (a2) is shown as SEQ ID No.6; the nucleotide sequence of the targeting fragment (donor fragment) used in (a3) ​​is shown as SEQ ID No.7; the nucleotide sequence of the targeting fragment (donor fragment) used in (a4) is shown as SEQ ID No.8; the nucleotide sequence of the targeting fragment (donor fragment) used in (a5) is shown as SEQ ID No.9; the nucleotide sequence of the targeting fragment (donor fragment) used in (a6) is shown as SEQ ID No.10; the nucleotide sequence of the targeting fragment (donor fragment) used in (a7) is shown as SEQ ID No.11; the nucleotide sequence of the targeting fragment (donor fragment) used in (a8) is shown as SEQ ID No.12; the nucleotide sequence of the targeting fragment (donor fragment) used in (a9) is shown as SEQ ID No.13; the nucleotide sequence of the targeting fragment (donor fragment) used in (a10) is shown in SEQ ID No.14; the nucleotide sequence of the targeting fragment (donor fragment) used in (a11) is shown in SEQ ID No.15; the nucleotide sequence of the targeting fragment (donor fragment) used in (a12) is shown in SEQ ID No.16; the nucleotide sequence of the targeting fragment (donor fragment) used in (a13) is shown in SEQ IDNo.17.

[0026] In a second aspect, the present invention claims protection for the use of the recombinant bacteria described in the first aspect in the fermentation production of D-panthenol.

[0027] In a third aspect, the present invention claims a method for producing D-panthenol by fermentation.

[0028] The method for producing D-panthenol by fermentation claimed in the present invention may include the following steps: fermenting and culturing the recombinant bacteria described in the first aspect above in a fermentation medium containing glucose to obtain D-panthenol from the fermentation product.

[0029] The recombinant bacteria can synthesize L-homoserine and D-pantoic acid by using glucose, then the tyrosine decarboxylase expressed by the recombinant bacteria synthesizes 3-amino-1-propanol by using L-homoserine as a substrate, and finally the D-pantothenate synthase expressed by the recombinant bacteria synthesizes D-pantoic acid and 3-amino-1-propanol as substrates to obtain D-pantothenic alcohol.

[0030] Furthermore, the solvent of the fermentation medium is water, and the solutes and concentrations are as follows: 4g / L (NH4)2HPO4, 6g / L KH2PO4, 1.8g / L citric acid monohydrate, 2g / L magnesium sulfate heptahydrate, 2g / L yeast powder, 0.8g / L lysine, 0.4g / L threonine, 0.25g / L methionine, 0.4g / L isoleucine, and 20g / L glucose monohydrate.

[0031] Furthermore, the fermentation culture conditions are: pH is controlled at 6.8-7.2, dissolved oxygen is controlled at 25%-30%, residual sugar is controlled below 2g / L, the fermentation culture time is 48h, and the temperature is 37°C.

[0032] In a fourth aspect, the present invention claims protection for a complete set of products consisting of the chassis host bacteria and the recombinant expression vector described in the first aspect above; The recombinant expression vector carries a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthetase described in the first aspect.

[0033] In one embodiment of the present invention, the recombinant vector is specifically a recombinant plasmid obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pTrc99A with the mutV583ADC gene (i.e., the tyrosine decarboxylase encoding gene) shown in SEQ ID No.3 and the MtpanC gene (i.e., the D-pantothenate synthase encoding gene) fragment shown in SEQ ID No.4.

[0034] In a fifth aspect, the present invention claims protection for the use of the set of products described in the fourth aspect above in the preparation of the recombinant bacteria described in the first aspect above.

[0035] In a sixth aspect, the present invention claims a method for preparing the recombinant bacteria described in the first aspect above.

[0036] The method for preparing the recombinant bacteria in the first aspect of the present invention may include the following steps: expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacteria to obtain the recombinant bacteria; The chassis host bacteria is the chassis host bacteria described in the first aspect above; The tyrosine decarboxylase is the tyrosine decarboxylase described in the first aspect above; The D-pantothenate synthetase is the D-pantothenate synthetase described in the first aspect above.

[0037] In the method, the method for expressing the tyrosine decarboxylase and the D-pantothenate synthetase in the chassis host bacteria can be found in the first aspect described above.

[0038] The present invention proves through experiments that the method of the present invention realizes direct synthesis of D-panthenol by biological fermentation, and the D-panthenol production strain constructed by the present invention can generate about 0.22g / L of D-panthenol by glucose reaction. Compared with the existing chemical synthesis method, the present invention realizes pure biological synthesis from glucose to D-panthenol, has the advantages of green environmental protection and low cost, and lays a good foundation for large-scale industrial production of D-panthenol. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The schematic diagram of the production of D-panthenol by Escherichia coli fermentation is shown in the figure.

[0040] Figure 2 This is the HPLC detection spectrum of D-panthenol standard.

[0041] Figure 3 This is the HPLC detection spectrum of the ADC reaction conversion product of the D-panthenol synthesis strain DP13-pTrc99A-MtpanC-mutV583 in Example 3. DETAILED DESCRIPTION

[0042] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0043] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0044] The quantitative data involved in the following examples are the mean values ​​of the results of at least three repeated experiments.

[0045] The experimental materials involved in the following examples are as follows: D-panthenol standard: Yuanye Biotechnology, product number S11131.

[0046] pET28a plasmid: YEASEN Biotechnology, catalog number 11905ES03.

[0047] pTrc99a plasmid: Qincheng Biotechnology, catalog number QCP0389.

[0048] pCas plasmid and pTargetF plasmid: both are recorded in the reference "Multigene Editing in theEscherichia coli Genome via the CRISPR-Cas9 System. Applied EnvironmentalMicrobiology. 2015, 81(7): 2506-2514", which are available to the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0049] Figure 1 The schematic diagram of the principle of producing D-panthenol by fermentation of Escherichia coli of the present invention is shown. The expression / activity of key enzymes in the D-pantoic acid and homoserine synthesis pathway (acetolactate synthase alsS, dihydroxy acid dehydratase ilvD, α-ketoisovalerate hydroxymethyltransferase panB, ketovalerate reductase panE and homoserine dehydrogenase thrA*) are enhanced by gene editing technology (CRISPR-Cas9), and the genes in the competitive pathway (fumarate reductase frdABCD, acetate kinase ackA, lactate dehydrogenase ldhA, alcohol dehydrogenase adhE, pyruvate oxidase p oxB, pyruvate formate lyase pflB, phosphotransacetylase pta, propionate kinase tdcD, 2-ketobutyrate formate lyase tdcE, methylglyoxal synthase mgsA, choline dehydrogenase betA, Toll-Pal system protein tolR, putative PTS enzyme IIC component frwC), tyrosine decarboxylase mutant S126M-N100A-E299A and D-pantothenate synthase MtpanC were co-expressed in plasmid pTrc99A to achieve de novo synthesis of D-panthenol.

[0050] Example 1. Construction of D-pantoic acid and L-homoserine producing strain DP13 The purpose of this example is to construct a recombinant Escherichia coli (named strain DP13) that can synthesize D-pantoic acid and L-homoserine from glucose. The synthesized D-pantoic acid and L-homoserine serve as catalytic substrates for subsequent tyrosine decarboxylase mutants and D-pantothenate synthase to further synthesize D-panthenol.

[0051] The primer sequences involved in this example are shown in Table 1.

[0052]

[0053]

[0054] 1. The coding gene of fumarate reductase frdABCD in the genome of Escherichia coli ATCC 9637 was knocked out to obtain strain DP01 1. Preparation of targeting fragment ΔfrdABCD Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair frdABCD-UP-F / frdABCD-UP-R and the primer pair frdABCD-DOWN-F / frdABCD-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli frdABCD gene by PCR amplification, and the upstream and downstream homologous arms of the frdABCD gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔfrdABCD, and its sequence is shown in SEQ ID No. 5. The 1st to 500th positions of SEQ ID No. 5 are the upstream homologous arms of the frdABCD site, and the 501st to 1000th positions are the downstream homologous arms of the frdABCD site.

[0055] 2. Construction of targeting plasmid pTargetF-frdABCD Using the pTargetF plasmid as a template and pTargetF-frdABCD-F and pTargetF-frdABCD-R as primers (see Table 1 for the specific sequence), PCR amplification was performed to obtain a 2118 bp plasmid containing the frdABCD site recognition N20, which was named pTargetF-frdABCD after sequencing verification. The nucleotide sequence of its N20 was ATGACCCAACTGGAACTGTG (positions 1-20 of SEQ ID No. 31).

[0056] 3. Genome Editing (1) Prepare electrocompetent cells of the target strain according to the preparation method of electrocompetent cells of Escherichia coli, transform the pCas9 plasmid into Escherichia coli ATCC 9637 by electrocompetent cells, spread on kanamycin (40 mg / L) resistant LB plates, and culture at 30°C to obtain transformants ATCC 9637 / pCas.

[0057] (2) The obtained Escherichia coli ATCC 9637 / pCas was inoculated into LB medium containing kanamycin and 0.2% final concentration of L-arabinose, and cultured at 30°C for 3-4 hours to prepare electrocompetent cells; (3) The targeting fragment ΔfrdABCD (SEQ ID No. 5) prepared in step 1 and the targeting plasmid pTargetF-frdABCD constructed in step 2 were simultaneously transferred into the electroporation competent medium obtained in step (2), and after being revived at 30°C for 1 h, they were spread on LB plates containing kanamycin, streptomycin (100 mg / L) and 0.2% final concentration of L-arabinose, and cultured in a 30°C incubator; (4) Colony PCR was performed on the single colonies grown on the screening plate using the primer pairs frdABCD-UP-F and frdABCD-DOWN-R (see Table 1) on the chromosomes at both ends of the target gene site, and verified by agarose gel electrophoresis. Single colonies with a fragment band size of 1000 bp were selected and cultured in LB medium containing kanamycin and 0.5 mM IPTG (isopropyl-β-D-thiogalactopyranoside) at 30°C overnight; (5) Use an inoculation loop to dip the overnight cultured bacterial solution and streak three zones on an LB plate containing kanamycin, and then culture it in a 30°C incubator. After a single colony grows, streak it on an LB plate containing kanamycin and streptomycin, respectively, and then culture it in a 30°C incubator. If there is no growth on the LB plate containing streptomycin, the targeting plasmid has been eliminated. (6) Pick out single colonies that have eliminated the targeting plasmid, streak them onto LB plates without antibiotics, and culture them at 42°C overnight. (7) The grown single colonies were spotted on LB plates without antibiotics and containing kanamycin, and cultured in a 37°C incubator. If there was no growth on the LB plate containing kanamycin, the pCas9 plasmid was successfully eliminated and a genetically recombinant strain was obtained, named DP01 strain. The genotype of DP01 strain is ATCC 9637ΔfrdABCD.

[0058] 2. Knockout the gene encoding acetate kinase ackA in the genome of Escherichia coli DP01 to obtain strain DP02 1. Preparation of targeting fragment ΔackA Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair ackA-UP-F / ackA-UP-R and the primer pair ackA-DOWN-F / ackA-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli ackA gene by PCR amplification, and the upstream and downstream homology arms of the ackA gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔackA, and its sequence is shown in SEQ ID No. 6. The 1st to 500th positions of SEQ ID No. 6 are the upstream homology arms of the ackA site, and the 501st to 1000th positions are the downstream homology arms of the ackA site.

[0059] 2. Construction of targeting plasmid pTargetF-ackA Using the pTargetF plasmid as a template and pTargetF-ackA-F and pTargetF-ackA-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the ackA site recognition N20, which was named pTargetF-ackA after sequencing verification. The nucleotide sequence of its N20 was GGTCACCGTATCGTACACGG (positions 1-20 of SEQ ID No. 37).

[0060] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔackA (SEQ ID No. 6) prepared in step 1 and the targeting plasmid pTargetF-ackA constructed in step 2 into the DP01 strain at the same time. Among them, the detection primers are ackA-UP-F and ackA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained is named DP02 strain. The genotype of DP02 strain is ATCC 9637ΔfrdABCDΔackA.

[0061] 3. Knockout of the gene encoding lactate dehydrogenase ldhA in the genome of Escherichia coli DP02 to obtain strain DP03 1. Preparation of the targeting fragment ΔldhA Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair ldhA-UP-F / ldhA-UP-R and the primer pair ldhA-DOWN-F / ldhA-DOWN-R (specific sequences are shown in Table 1) were used to obtain the upstream 505bp fragment and the downstream 504bp fragment of the Escherichia coli ldhA gene by PCR amplification, and the upstream and downstream homologous arms of the ldhA gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔldhA, and its sequence is shown in SEQ ID No. 7. Positions 1-505 of SEQ ID No. 7 are the upstream homologous arms of the ldhA site, and positions 506-1009 are the downstream homologous arms of the ldhA site.

[0062] 2. Construction of targeting plasmid pTargetF-ldhA Using the pTargetF plasmid as a template and pTargetF-ldhA-F and pTargetF-ldhA-R as primers (see Table 1 for the specific sequence), PCR amplification was performed to obtain a 2118 bp plasmid containing the ldhA site recognition N20, which was named pTargetF-ldhA after sequencing verification. The nucleotide sequence of its N20 was TTTGCCATACATAGTAAAGC (positions 1-20 of SEQ ID No. 43).

[0063] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔldhA (SEQ ID No. 7) prepared in step 1 and the targeting plasmid pTargetF-ldhA constructed in step 2 into the DP02 strain at the same time. Among them, the detection primers are ldhA-UP-F and ldhA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1009bp. The recombinant strain finally obtained is named DP03 strain. The genotype of DP03 strain is ATCC 9637ΔfrdABCDΔackAΔldhA.

[0064] 4. Knockout of the gene encoding alcohol dehydrogenase adhE in the genome of Escherichia coli DP03 to obtain strain DP04 1. Preparation of targeting fragment ΔadhE Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair adhE-UP-F / adhE-UP-R and the primer pair adhE-DOWN-F / adhE-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500bp fragment and the downstream 501bp fragment of the Escherichia coli adhE gene by PCR amplification, and the upstream and downstream homologous arms of the adhE gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔadhE, and its sequence is shown in SEQ ID No. 8. Positions 1-500 of SEQ ID No. 8 are the upstream homologous arms of the adhE site, and positions 501-1001 are the downstream homologous arms of the adhE site.

[0065] 2. Construction of targeting plasmid pTargetF-adhE Using the pTargetF plasmid as a template and pTargetF-adhE-F and pTargetF-adhE-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the adhE site recognition N20, which was named pTargetF-adhE after sequencing verification. The nucleotide sequence of its N20 was GGATCAGGTTGATGTCTGGG (positions 1-20 of SEQ ID No. 49).

[0066] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔadhE (SEQ ID No. 8) prepared in step 1 and the targeting plasmid pTargetF-adhE constructed in step 2 into the DP03 strain at the same time. Among them, the detection primers are adhE-UP-F and adhE-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1001bp. The recombinant strain finally obtained is named DP04 strain. The genotype of DP04 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhE.

[0067] 5. Knockout of the gene encoding pyruvate oxidase poxB in the genome of Escherichia coli DP04 to obtain strain DP05 1. Preparation of the targeting fragment ΔpoxB Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, primer pairs poxB-UP-F / poxB-UP-R and primer pairs poxB-DOWN-F / poxB-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli poxB gene by PCR amplification, and the upstream and downstream homologous arms of the poxB gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔpoxB, and its sequence is shown in SEQ ID No. 9. Positions 1-500 of SEQ ID No. 9 are the upstream homologous arms of the poxB site, and positions 501-1000 are the downstream homologous arms of the poxB site.

[0068] 2. Construction of targeting plasmid pTargetF-poxB Using the pTargetF plasmid as a template and pTargetF-poxB-F and pTargetF-poxB-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the poxB site recognition N20, which was named pTargetF-poxB after sequencing verification. The nucleotide sequence of its N20 was GGTGAAAATAGCGTCATCGG (positions 1-20 of SEQ ID No. 55).

[0069] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔpoxB (SEQ ID No. 9) prepared in step 1 and the targeting plasmid pTargetF-poxB constructed in step 2 into the DP04 strain at the same time. Among them, the detection primers are poxB-UP-F and poxB-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained is named DP05 strain. The genotype of DP05 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxB.

[0070] 6. Knockout of the gene encoding pyruvate formate lyase pflB in the genome of Escherichia coli DP05 to obtain strain DP06 1. Preparation of the targeting fragment ΔpflB Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair pflB-UP-F / pflB-UP-R and the primer pair pflB-DOWN-F / pflB-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli pflB gene by PCR amplification, and the upstream and downstream homologous arms of the pflB gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔpflB, and its sequence is shown in SEQ ID No. 10. The 1st to 500th positions of SEQ ID No. 10 are the upstream homologous arms of the pflB site, and the 501st to 1000th positions are the downstream homologous arms of the pflB site.

[0071] 2. Construction of targeting plasmid pTargetF-pflB Using the pTargetF plasmid as a template and pTargetF-pflB-F and pTargetF-pflB-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the pflB site recognition N20, which was named pTargetF-pflB after sequencing verification. The nucleotide sequence of its N20 was ACAGCCAGGTCATCTACACG (positions 1-20 of SEQ ID No. 61).

[0072] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔpflB (SEQ ID No. 10) prepared in step 1 and the targeting plasmid pTargetF-pflB constructed in step 2 into the DP05 strain at the same time. Among them, the detection primers are pflB-UP-F and pflB-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained is named DP06 strain. The genotype of DP06 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflB.

[0073] 7. Knockout the gene encoding phosphotransacetylase pta in the genome of Escherichia coli DP06 to obtain strain DP07 1. Preparation of Targeting Fragment Δpta Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair pta-UP-F / pta-UP-R and the primer pair pta-DOWN-F / pta-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500bp fragment and the downstream 500bp fragment of the Escherichia coli pta gene by PCR amplification, and the upstream and downstream homologous arms of the pta gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named Δpta, and its sequence is shown in SEQ ID No. 11. The 1st to 500th positions of SEQ ID No. 11 are the upstream homologous arms of the pta site, and the 501st to 1000th positions are the downstream homologous arms of the pta site.

[0074] 2. Construction of targeting plasmid pTargetF-pta Using the pTargetF plasmid as a template and pTargetF-pta-F and pTargetF-pta-R as primers (see Table 1 for the specific sequence), PCR amplification was performed to obtain a 2118 bp plasmid containing the pta site recognition N20, which was named pTargetF-pta after sequencing verification. The nucleotide sequence of its N20 was GTAACCGCCAGTCAGCAGCA (positions 1-20 of SEQ ID No. 67).

[0075] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment Δpta (SEQ ID No. 11) prepared in step 1 and the targeting plasmid pTargetF-pta constructed in step 2 into the DP06 strain at the same time. Among them, the detection primers are pta-UP-F and pta-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained is named DP07 strain. The genotype of DP07 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔpta.

[0076] 8. Knockout of the gene encoding propionate kinase tdcD in the genome of Escherichia coli DP07 to obtain strain DP08 1. Preparation of the targeting fragment ΔtdcD Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair tdcD-UP-F / tdcD-UP-R and the primer pair tdcD-DOWN-F / tdcD-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500bp fragment and the downstream 500bp fragment of the Escherichia coli tdcD gene by PCR amplification, and the upstream and downstream homologous arms of the tdcD gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔtdcD, and its sequence is shown in SEQ ID No. 12. The 1st to 500th positions of SEQ ID No. 12 are the upstream homologous arms of the tdcD site, and the 501st to 1000th positions are the downstream homologous arms of the tdcD site.

[0077] 2. Construction of targeting plasmid pTargetF-tdcD Using the pTargetF plasmid as a template and pTargetF-tdcD-F and pTargetF-tdcD-R as primers (see Table 1 for the specific sequence), PCR amplification was performed to obtain a 2118 bp plasmid containing the tdcD site recognition N20, which was named pTargetF-tdcD after sequencing verification. The nucleotide sequence of its N20 was TTAATGTCAGGTATTGCCGA (positions 1-20 of SEQ ID No. 73).

[0078] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔtdcD (SEQ ID No. 12) prepared in step 1 and the targeting plasmid pTargetF-tdcD constructed in step 2 into the DP07 strain at the same time. Among them, the detection primers are tdcD-UP-F and tdcD-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained was named DP08 strain. The genotype of DP08 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcD.

[0079] 9. Knockout of the gene encoding 2-ketobutyrate formate lyase tdcE in the genome of Escherichia coli DP08 to obtain strain DP09 1. Preparation of the targeting fragment ΔtdcE Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pair tdcE-UP-F / tdcE-UP-R and the primer pair tdcE-DOWN-F / tdcE-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500bp fragment and the downstream 500bp fragment of the Escherichia coli tdcE gene by PCR amplification, and the upstream and downstream homologous arms of the tdcE gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔtdcE, and its sequence is shown in SEQ ID No. 13. The 1st to 500th positions of SEQ ID No. 13 are the upstream homologous arms of the tdcE site, and the 501st to 1000th positions are the downstream homologous arms of the tdcE site.

[0080] 2. Construction of targeting plasmid pTargetF-tdcE Using the pTargetF plasmid as a template and pTargetF-tdcE-F and pTargetF-tdcE-R as primers (see Table 1 for the specific sequence), PCR amplification was performed to obtain a 2118 bp plasmid containing the tdcE site recognition N20, which was named pTargetF-tdcE after sequencing verification. The nucleotide sequence of its N20 was TGATGCCATACAGCGCTACG (positions 1-20 of SEQ ID No. 79).

[0081] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔtdcE (SEQ ID No. 13) prepared in step 1 and the targeting plasmid pTargetF-tdcE constructed in step 2 into the DP08 strain at the same time. Among them, the detection primers are tdcE-UP-F and tdcE-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained was named DP09 strain. The genotype of DP09 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcE.

[0082] 10. The strain DP10 was obtained by replacing the gene encoding the putative PTS enzyme IIC component frwC in the genome of Escherichia coli DP09 with an expression cassette containing the gene encoding the homoserine dehydrogenase thrA* 1. Preparation of the targeting fragment ΔfrwC::P119-thrA* Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, primer pairs thrA*-F / thrA*-R, primer pairs frwC-UP-F / frwC-UP-R, and primer pairs frwC-DOWN-F / frwC-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 997bp fragment of the frwC gene, the thrA* expression cassette (including the P119 promoter, RBS sequence (AAAGAGGAGAAA), and thrA* gene expression sequence) that can express the homoserine dehydrogenase gene from Escherichia coli in Escherichia coli, and the downstream 1002bp fragment of the frwC gene by PCR amplification. The thrA* expression cassette was connected to the upstream and downstream homology arms of the frwC site on the genome by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔfrwC::P119-thrA*, and its sequence is shown in SEQ ID No.14. The 1st to 997th positions of SEQ ID No. 14 are the upstream homology arms of the frwC site, the 998th to 1032nd positions are the P119 promoter sequence, the 1114th to 3576th positions are the thrA* gene sequence, and the 3577th to 4578th positions are the downstream homology arms of the frwC site.

[0083] 2. Construction of targeting plasmid pTargetF-frwC Using pTargetF as a template and pTargetF-frwC-F and pTargetF-frwC-R as primers (see Table 1 for details), PCR amplification was performed to obtain a 2118 bp plasmid containing the frwC site recognition N20, which was named pTargetF-frwC after sequencing verification. The nucleotide sequence of its N20 was CCGGTTTATCGCAAGTTATG (positions 1-20 of SEQ ID No. 87).

[0084] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔfrwC::P119-thrA* (SEQ ID No.14) prepared in step 1 and the targeting plasmid pTargetF-frwC constructed in step 2 into the DP09 strain at the same time. Among them, the detection primers are frwC-UP-F and frwC-DOWN-R (see Table 1), and the size of the positive amplified fragment is 4578bp. The recombinant strain finally obtained was named DP10 strain. The genotype of DP10 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*.

[0085] 11. The gene encoding methylglyoxal synthase mgsA in the genome of Escherichia coli DP10 was replaced with an expression cassette containing the gene encoding acetolactate synthase alsS to obtain strain DP11 1. Preparation of the targeting fragment ΔmgsA::P119-alsS Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pairs alsS-F / alsS-R, mgsA-UP-F / mgsA-UP-R, and mgsA-DOWN-F / mgsA-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 502bp fragment of the mgsA gene, the alsS expression cassette (containing the P119 promoter, RBS sequence (AGGAG), and alsS gene expression sequence) that can express the acetolactate synthase gene from Escherichia coli in Escherichia coli, and the downstream 503bp fragment of the mgsA gene by PCR amplification. The alsS expression cassette was connected to the upstream and downstream homologous arms of the mgsA site on the genome by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔmgsA::P119-alsS, and its sequence is shown in SEQ ID No.15. Positions 1-502 of SEQ ID No. 15 are the upstream homology arms of the mgsA site, positions 2232-2266 are the reverse complementary sequence of the P119 promoter sequence, positions 504-2215 are the reverse complementary sequence of the alsS gene sequence, and positions 2267-2769 are the downstream homology arms of the mgsA site.

[0086] 2. Construction of targeting plasmid pTargetF-mgsA Using pTargetF as a template and pTargetF-mgsA-F and pTargetF-mgsA-R as primers (see Table 1 for details), PCR amplification was performed to obtain a 2118 bp plasmid containing the mgsA site recognition N20, which was named pTargetF-mgsA after sequencing verification. The nucleotide sequence of its N20 was ACAAATGCTGATGAGCTGGG (positions 1-20 of SEQ ID No.95).

[0087] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔmgsA::P119-alsS (SEQ ID No. 15) prepared in step 1 and the targeting plasmid pTargetF-mgsA constructed in step 2 into the DP10 strain at the same time. Among them, the detection primers are mgsA-UP-F and mgsA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 2769bp. The recombinant strain finally obtained was named DP11 strain. The genotype of DP11 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*ΔmgsA::P119-alsS.

[0088] 12. The gene encoding choline dehydrogenase betA in the genome of Escherichia coli DP11 was replaced with an expression cassette containing the gene encoding dihydroxyacid dehydratase ilvD to obtain strain DP12 1. Preparation of the targeting fragment ΔbetA::P119-ilvD Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, primer pairs ilvD-F / ilvD-R, primer pairs betA-UP-F / betA-UP-R, and primer pairs betA-DOWN-F / betA-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 496 bp fragment of the betA gene, the expression cassette of the Escherichia coli-derived dihydroxyacid dehydratase gene ilvD (including the P119 promoter, RBS sequence (AGGAG), and ilvD gene expression sequence) that can express Escherichia coli in Escherichia coli, and the downstream 546 bp fragment of the betA gene by PCR amplification. The ilvD expression cassette was connected to the upstream and downstream homologous arms of the betA site on the genome by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔbetA::P119-ilvD, and its sequence is shown in SEQ ID No.16. The 1st to 496th positions of SEQ ID No. 16 are the homology arms upstream of the betA site, the 497th to 531st positions are the P119 promoter sequence, the 548th to 2398th positions are the ilvD gene sequence, and the 2399th to 2944th positions are the homology arms downstream of the betA site.

[0089] 2. Construction of targeting plasmid pTargetF-betA Using pTargetF as a template and pTargetF-betA-F and pTargetF-betA-R as primers (see Table 1 for details), PCR amplification was performed to obtain a 2118 bp plasmid containing betA site recognition N20, which was named pTargetF-betA after sequencing verification. The nucleotide sequence of its N20 was AAAGCCAGCATCATGAATAC (positions 1-20 of SEQ ID No. 103).

[0090] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragment ΔbetA::P119-ilvD (SEQ ID No. 16) prepared in step 1 and the targeting plasmid pTargetF-betA constructed in step 2 into the DP11 strain at the same time. Among them, the detection primers are betA-UP-F and betA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 2944bp. The recombinant strain finally obtained was named DP12 strain. The genotype of DP12 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*ΔmgsA::P119-alsSΔbetA::P119-ilvD.

[0091] 13. The strain DP13 was obtained by replacing the gene encoding the Tol-Pal system protein tolR in the genome of Escherichia coli DP12 with an expression cassette containing the genes encoding α-ketoisovalerate hydroxymethyltransferase panB and ketopantothenate reductase panE 1. Preparation of the targeting fragment ΔtolR::P119-panB / panE Using the genome of the laboratory-preserved Escherichia coli strain ATCC 9637 as a template, the primer pairs panB-F / panB-R, panE-F / panE-R, tolR-UP-F / tolR-UP-R and tolR-DOWN-F / tolR-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 501bp fragment of the tolR gene, the panB / ketopantothenate reductase panE gene expression cassette (including the P119 promoter, RBS sequence (AGGAG), and panB / panE gene expression sequence) that can express Escherichia coli in Escherichia coli, and the downstream 503bp fragment of the tolR gene by PCR amplification. The panB / panE expression cassette was connected to the upstream and downstream homology arms of the tolR site on the genome by Gibson to construct the targeting fragment. The resulting targeting fragments were named ΔtolR::P119-panB and panE, and their sequences are shown in SEQ ID No.17. Positions 1-501 of SEQ ID No. 17 are the upstream homology arms of the tolR site, positions 502-536 are the P119 promoter sequence, positions 553-1464 are the panE gene sequence, positions 1516-2310 are the panB gene sequence, and positions 2311-2813 are the downstream homology arms of the tolR site.

[0092] 2. Construction of targeting plasmid pTargetF-tolR Using pTargetF as a template and pTargetF-tolR-F and pTargetF-tolR-R as primers (see Table 1 for details), PCR amplification was performed to obtain a 2118 bp plasmid containing the tolR site recognition N20, which was named pTargetF-tolR after sequencing verification. The nucleotide sequence of its N20 was TGGTATTGGTCAGTACACCG (positions 1-20 of SEQ ID No. 113).

[0093] 3. Genome Editing Refer to step 1-3, and transfer the targeting fragments ΔtolR:: P119-panB and panE (SEQ ID No. 17) prepared in step 1 and the targeting plasmid pTargetF-tolR constructed in step 2 into the DP12 strain at the same time. Among them, the detection primers are tolR-UP-F and tolR-DOWN-R (see Table 1), and the size of the positive amplified fragment is 2813bp. The recombinant strain finally obtained was named DP13 strain. The genotype of DP13 strain is ATCC 9637ΔfrdABCDΔackAΔldhAΔadhEΔpoxBΔpflBΔptaΔtdcDΔtdcEΔfrwC::P119-thrA*ΔmgsA::P119-alsSΔbetA::P119-ilvDΔtolR::P119-panB and panE.

[0094] Example 2: Construction of D-panthenol-producing strain 1. Construction of recombinant plasmid 1. Construction of recombinant plasmid pET28a-MtpanC The D-pantothenate synthase in this example is derived from Mycobacterium tuberculosis and is hereinafter abbreviated as MtpanC.

[0095] The amino acid sequence of MtpanC is shown in SEQ ID No. 2. The MtpanC gene fragment (SEQ ID No. 4) is derived from Mycobacterium tuberculosis ( Mycobacterium tuberculosis ) genome, with EcoRI and HindIII double restriction sites at both ends of the MtpanC gene fragment. The gene fragment MtpanC double-digested with EcoRI and HindIII was then ligated with the expression vector pET28a double-digested with EcoRI and HindIII under the action of T4 DNA ligase (product of Takara) at 16°C overnight to obtain the ligation solution MtpanC.

[0096] The ligation solution MtpanC was transformed into DH5α competent cells (product of Beijing Qingke Biotechnology Co., Ltd.) and sequenced to obtain the positive recombinant plasmid pET28a-MtpanC. The structural description of the recombinant plasmid pET28a-MtpanC: The recombinant plasmid pET28A-MtpanC was obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pET28a with the MtpanC gene fragment shown in SEQ ID No.4.

[0097] 2. Construction of recombinant plasmid pET28a-mutV583ADC The tyrosine decarboxylase mutant in the embodiment of the present invention is derived from Enterococcus faecalis V583 ( Enterococcus faecalis The amino acid sequence of the mutated V583ADC (hereinafter referred to as mutV583ADC) is shown in SEQ ID No. 1.

[0098] The mutV583ADC gene fragment (SEQ ID No. 3) is derived from Enterococcus faecalis V583 ( Enterococcus faecalis ) genome and mutated, with double restriction sites of SpeI and EcoRI at both ends of the mutV583ADC gene fragment. Subsequently, mutV583ADC was double-digested with SpeI and EcoRI and ligated with the expression vector pET28a that had been double-digested with the same under the action of T4 DNA ligase (product of Takara) at 16°C overnight to obtain the ligation solution mutV583ADC.

[0099] The ligation solution mutV583ADC was transformed into DH5α competent cells (product of Beijing Qingke Biotechnology Co., Ltd.) and sequenced to obtain the positive recombinant plasmid pET28a-mutV583ADC. Structural description of the recombinant plasmid pET28A-mutV583ADC: The recombinant plasmid was obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pET28a with the mutV583ADC gene fragment shown in SEQ ID No.3.

[0100] The positive recombinant plasmid pET28a-mutV583ADC was transformed into the expression host bacterium Escherichia coli BL21 (DE3) (Beijing Qingke Biotechnology Co., Ltd.) to obtain the prokaryotic expression strain pET28a-mutV583ADC-BL21 (DE3).

[0101] 3. Construction of recombinant plasmid pTrc99A-MtpanC-mutV583ADC The MtpanC and mutV583ADC gene fragments were amplified by PCR using pET28a-MtpanC and pET28a-mutV583ADC as templates, respectively, and connected to the pTrc99A vector using the Goldgate kit. The connected products were transformed into DH5α competent cells (products of Beijing Qingke Biotechnology Co., Ltd.) and sequenced for verification, thereby obtaining the positive recombinant plasmid pTrc99A-MtpanC-mutV583ADC. The structural description of the recombinant plasmid pTrc99A-MtpanC-mutV583ADC is as follows: the recombinant plasmid is obtained by replacing the small fragment between the restriction sites EcoRI and HindIII of the expression vector pTrc99A with the DNA fragment obtained by connecting the mutV583ADC gene fragment shown in SEQ ID No.3 and the MtpanC gene fragment shown in SEQ ID No.4 in sequence from head to tail.

[0102] 2. Obtaining recombinant E. coli DP13-pTrc99A-MtpanC-mutV583ADC The recombinant plasmid pTrc99A-MtpanC-mutV583ADC was transferred into the Escherichia coli DP13 constructed in Example 1 to obtain the recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC.

[0103] Example 3: Fermentation production of D-panthenol by recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC A single colony of the recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC constructed in Example 2 was inoculated in LB medium and cultured overnight at 37°C. The overnight culture solution was inoculated in 100 mL LB liquid medium containing 50 μg / mL gentamicin at a volume percentage of 1% and the seeds were cultured at 37°C for 8 hours. The obtained seed solution was inoculated in 2L fermentation medium at a volume percentage of 5% and fermented in a 5L fermenter for 48 hours. The formula of the fermentation medium is: 4g / L (NH4)2HPO4, 6g / L KH2PO4, 1.8g / L citric acid monohydrate, 2g / L magnesium sulfate heptahydrate, 2g / L yeast powder, 0.8g / L lysine, 0.4g / L threonine, 0.25g / L methionine, 0.4g / L isoleucine, 20g / L glucose monohydrate, dissolved in ultrapure water. The pH is controlled at 6.8-7.2, the dissolved oxygen is controlled at 25%-30%, and the residual sugar is controlled below 2g / L.

[0104] The yield of D-panthenol was detected by Agilent HPLC (Agilent 1260 series; Agilent Technologies, Santa, Clara, CA, USA) equipped with Agilent extended-C18 5.0μm (4.6×250mm) column. The column temperature was 25°C. Mobile phase A was 20mM KH2PO4 aqueous solution (pH3.0), mobile phase B was acetonitrile, the A:B ratio (volume ratio) was 10:90, and the flow rate was 0.8mL / min. The fermentation broth was filtered through a 0.22μm polyethersulfone (PES) filter membrane and sampled for detection. The absorbance at 215nm was measured using a diode array detector (DAD). A regression curve of peak area versus concentration was established using D-panthenol standards.

[0105] The fermentation results are as follows Figure 2 and Figure 3 As shown in the figure, the D-panthenol production of the recombinant strain DP13-pTrc99A-MtpanC-mutV583ADC was 0.22 g / L after 48 hours of high-density fermentation.

[0106] The above results show that the present invention achieves pure biosynthesis of D-panthenol from glucose.

[0107] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A recombinant bacterium for fermentation production of D-panthenol, characterized in that: The recombinant bacteria are obtained by expressing tyrosine decarboxylase and D-pantothenate synthase in the chassis host bacteria; The chassis host bacteria is Escherichia coli which can synthesize D-pantoic acid and L-homoserine by utilizing glucose.

2. The recombinant bacterium according to claim 1, characterized in that: The tyrosine decarboxylase is as follows (A1) or (A2): (A1) a protein having an amino acid sequence as shown in SEQ ID No. 1; (A2) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); and / or The D-pantothenate synthase is as follows (B1) or (B2): (B1) a protein having an amino acid sequence as shown in SEQ ID No. 2; (B2) Fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1).

3. The recombinant bacterium according to claim 1, characterized in that: The expression of the tyrosine decarboxylase and the D-pantothenate synthetase in the chassis host bacteria is achieved by introducing a gene encoding the tyrosine decarboxylase and a gene encoding the D-pantothenate synthetase into the chassis host bacteria.

4. The recombinant bacterium according to claim 3, characterized in that: The sequence of the gene encoding the tyrosine decarboxylase is as follows (C1) or (C2): (C1) SEQ ID No. 3; (C2) a sequence obtained by connecting a coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No. 3; and / or The sequence of the gene encoding the D-pantothenate synthase is as follows (D1) or (D2): (D1) SEQ ID No. 4; (D2) The sequence obtained by connecting the coding sequence of a protein tag to the 5' end and / or 3' end of SEQ ID No.

4.

5. The recombinant bacterium according to any one of claims 1 to 4, characterized in that: The chassis host bacteria is Escherichia coli that expresses acetolactate synthase alsS, dihydroxyacid dehydratase ilvD, α-ketoisovalerate hydroxymethyltransferase panB, ketovalerate reductase panE, homoserine dehydrogenase thrA*, and does not express fumarate reductase frdABCD, acetate kinase ackA, lactate dehydrogenase ldhA, alcohol dehydrogenase adhE, pyruvate oxidase poxB, pyruvate formate lyase pflB, phosphotransacetylase pta, propionate kinase tdcD, 2-ketobutyrate formate lyase tdcE, methylglyoxal synthase mgsA, choline dehydrogenase betA, Toll-Pal system protein tolR, and putative PTS enzyme IIC component frwC.

6. Use of the recombinant bacterium according to any one of claims 1 to 5 in the fermentation production of D-panthenol.

7. A method for producing D-panthenol by fermentation, comprising the following steps: fermenting and culturing the recombinant bacterium according to any one of claims 1 to 5 in a fermentation medium containing glucose, and obtaining D-panthenol from the fermentation product.

8. A complete set of products consisting of the chassis host bacteria and the recombinant expression vector described in claim 1 or 5; The recombinant expression vector carries a gene encoding the tyrosine decarboxylase described in claim 1 or 2 and a gene encoding the D-pantothenate synthetase described in claim 1 or 2.

9. Use of the complete set of products according to claim 8 in the preparation of the recombinant bacteria according to any one of claims 1 to 5.

10. A method for preparing the recombinant bacterium according to any one of claims 1 to 5, comprising the following steps: expressing tyrosine decarboxylase and D-pantothenate synthase in a chassis host bacterium to obtain the recombinant bacterium; The chassis host bacteria is the chassis host bacteria described in any one of claims 1-5; The tyrosine decarboxylase is the tyrosine decarboxylase described in any one of claims 1 to 5; The D-pantothenate synthetase is the D-pantothenate synthetase described in any one of claims 1-5.

Images