Solvent-tolerant transaminase mutant, genetically engineered bacterium and application in preparation of remegapam intermediate

Abstract

The invention relates to the field of engineering enzymes, in particular to a solvent-tolerant transaminase mutant, a genetically engineered bacterium and application of the solvent-tolerant transaminase mutant in preparation of a remegapam intermediate. The invention provides an omega-transaminase mutant. The omega-transaminase mutant is obtained by carrying out single-site or multi-site combined mutation on the 22th site, the 398th site and the 419th site of an amino acid sequence as shown in SEQ ID NO.2. The invention further provides a preparation method of the omega-transaminase mutant. The omega-transaminase mutant provided by the invention is relatively high in preparation and synthesis conversion rate, organic solvent tolerance and product stereoselectivity of a remegapam intermediate, and compared with the prior art, the omega-transaminase mutant has a relatively good industrial application prospect, is relatively low in cost and is beneficial to wide application.

Description

Technical Field

[0001] The present invention relates to the field of engineered enzymes, and in particular to a solvent-tolerant transaminase mutant, a genetically engineered bacterium and applications thereof in the preparation of a remegipam intermediate. Background Art

[0002] Chiral amines are the structural units of many important biologically active molecules and key intermediates for the synthesis of many chiral drugs. At present, there are three main methods for the synthesis of chiral amines, including chemical method, biological resolution method and biological asymmetric synthesis method. Among them, the chemical method has the disadvantages of long reaction routes and harsh conditions, the use of toxic transition metal catalysts in the synthesis, low product stereoselectivity and low yield; and the theoretical maximum yield of the biological resolution method is only 50%. Both methods have certain limitations in scale-up production. The bioasymmetric synthesis of chiral amines catalyzed by transaminase has attracted more and more attention due to its advantages such as high selectivity, high conversion rate, mild reaction conditions and environmental friendliness. It has now become a widely used method for the preparation of chiral amines. However, most wild-type transaminases have a limited substrate range and are generally difficult to synthesize large sterically hindered chiral amine compounds.

[0003] Rimegepant is a small molecule calcitonin gene-related peptide (CGRP) receptor antagonist specifically used for the acute treatment and prevention of migraine. Its mechanism is to reduce the symptoms of migraine by blocking the activity of CGRP. Rimegepant was first launched in the United States in 2020 and was approved in China in 2024, becoming the first drug suitable for both acute and preventive treatment. The currently accepted theory of migraine pathophysiology believes that dysfunction of the central nervous system (especially the trigeminal ganglion) is the root cause of the disease. Stimulation of the trigeminal ganglion triggers the activation of trigeminal afferent nerves, which project to the spinal cord and various pain-sensing synapses inside and outside the skull. The pain signal is then further transmitted to the brainstem, hypothalamus and thalamic nuclei through secondary ascending neurons, and from there to several cortical areas such as hearing and vision. The trigeminal ganglion amplifies and maintains migraine by activating perivascular fibers and releasing molecules (CGRP) involved in pain generation. CGRP levels are acutely elevated during migraine attacks, return to normal following treatment with triptans, and intravenous infusions of CGRP have been shown to trigger migraine-like headaches in migraine patients. In addition to its vasodilatory properties, CGRP appears to be a pro-nociceptive factor that modulates neuronal excitability to promote pain responses. Remgipam is an antagonist of CGRP receptors, which competes with CGRP for occupancy of these receptors, blocking the effects of CGRP and its ability to amplify and maintain migraines, ultimately relieving the headache.

[0004] In recent years, due to the advantages of high selectivity and environmental optimization, the chemical-enzymatic method has gradually become the preferred option for synthesizing chiral pharmaceutical chemicals and their intermediates. ω-transaminase is the key enzyme for the production of Remigipam. Many ω-transaminase genes have been cloned, and some of them have been expressed in different hosts (Escherichia coli, Pichia pastoris, etc.), obtaining genetically engineered bacteria with high enzyme activity and selectivity. Despite this, there are few reports on natural ω-transaminases for R-type selective transamination, and the substrate spectrum catalyzed by these ω-transaminases is relatively narrow, and they are often the most suitable biocatalysts screened for specific reactions, which greatly limits their scope of application.

[0005] Chinese patents CN116083385A, CN114875006A, CN113817699A, CN108048419A, CN112980899A, CN112980810A, CN112094830A, CN110592042A, and CN108384767A disclose a rational evolution strategy based on a ω-transaminase, and obtain enzyme variants with catalytic activity for large sterically hindered chiral amines, thereby improving the stability of the transaminase under extreme conditions, so as to further promote the immobilization and continuous application of the transaminase and improve production efficiency, but there is a problem of low conversion rate. Summary of the invention

[0006] The purpose of the present invention is to overcome the problems of low catalytic activity, low thermal stability and narrow substrate spectrum of transaminase, as well as low production efficiency and expensive catalysts in the existing engineered transaminase technology for synthesizing remegipam or its chiral amino intermediates, and provide a solvent-tolerant transaminase mutant, a genetically engineered bacterium and its use in the preparation of remegipam intermediates.

[0007] In order to achieve the above object, the present invention is implemented by the following technical solutions: In a first aspect, the present invention first provides an ω-aminotransferase mutant, which is obtained by performing single-site or multi-site combined mutations at positions 22, 398 and 419 of the amino acid sequence shown in SEQ ID NO.2.

[0008] ω-transaminase is the only enzyme in the transaminase family that can transfer the amino group at the non-α position of amino acids. ω-transaminase is commonly found in animals, plant tissues and microorganisms. The content of ω-transaminase is relatively high in the myocardium, brain, liver, kidney and other parts of animal tissues. ω-transaminase can catalyze the regio- and stereo-selective transamination reactions of substrates such as aliphatic and aromatic keto acids, aldehydes, ketones and ketose. This reaction is of great significance for the synthesis of chiral amines, amino acids and their derivatives.

[0009] Preferably, the ω-aminotransferase mutant is a mutant in which the amino acid sequence shown in SEQ ID NO.2 is mutated into one of the following: (1) the phenylalanine at position 22 is mutated into leucine; (2) the phenylalanine at position 22 is mutated into leucine, and the glycine at position 398 is mutated into alanine; (3) the phenylalanine at position 22 is mutated into leucine, the glycine at position 398 is mutated into alanine, and the glycine at position 419 is mutated into threonine.

[0010] In a second aspect, the present invention provides a gene encoding an ω-aminotransferase mutant.

[0011] The phenylalanine at position 22 mutates to leucine, that is, F22L, with an amino acid sequence as shown in SEQ ID No.4 and a nucleotide sequence as shown in SEQ ID NO.3; the phenylalanine at position 22 mutates to leucine and the glycine at position 398 mutates to alanine, that is, F22L / G398A, with an amino acid sequence as shown in SEQ ID No.6 and a nucleotide sequence as shown in SEQ ID NO.5; the phenylalanine at position 22 mutates to leucine, the glycine at position 398 mutates to alanine and the glycine at position 419 mutates to threonine, that is, F22L / G398A / G419T, with an amino acid sequence as shown in SEQ ID No.8 and a nucleotide sequence as shown in SEQ ID NO.7.

[0012] The ω-aminotransferase (amino acid sequence shown in SEQ ID No. 2) of the present invention is derived from Chromobacterium violaceum, and can also be isolated and obtained from a transformant expressing the protein recombinantly, or can be obtained by artificial synthesis. The identity between two amino acid sequences or two nucleotide sequences can be obtained by algorithms commonly used in the art, preferably by using NCBI Blastp and Blastn software to calculate according to default parameters.

[0013] The amino acid sequences derived from the amino acid sequences shown in SEQ ID No. 4, SEQ ID No. 6, and SEQ ID No. 8 of the present invention, which are substituted, deleted, or added with one or more amino acid residues and have transaminase activity, and proteins with at least 95% identity, all fall within the protection scope of the present invention.

[0014] Due to the degeneracy of nucleotide codons, the polynucleotide sequence encoding the amino acid sequence of SEQ ID No.4, SEQ ID No.6, and SEQ ID No.8 is not limited to SEQ ID No.3, SEQ ID No.5, and SEQ ID No.7, but may also be any other nucleic acid sequence encoding the amino acid sequence shown in SEQ ID No.4, SEQ ID No.6, and SEQ ID No.8 in the sequence table.

[0015] In a third aspect, the present invention provides a recombinant vector encoding a gene.

[0016] The recombinant vector of the present invention uses pET-28a(+) as the basic plasmid.

[0017] In a fourth aspect, the present invention provides a genetically engineered bacterium encoding a gene.

[0018] The genetically engineered bacteria of the present invention use Escherichia coli BL21 (DE3) as a host bacterium.

[0019] In a fifth aspect, the present invention provides a use of the ω-aminotransferase mutant in the preparation of a Remegipam intermediate from a Remegipam intermediate precursor ketone by microbial catalysis.

[0020] Preferably, the biocatalytic reaction is carried out by using wet cells obtained from recombinant genetically engineered bacteria containing a gene encoding a mutant ω-aminotransferase or pure enzyme solution extracted by ultrasonic crushing of wet cells as a catalyst, preparing a buffer solution as a reaction medium to form a reaction system; after the reaction, the reaction solution is separated and purified to obtain (5S, 6S, 9R)-5-amino-6-(2,3-difluorophenyl)-6,7,8,9-tetrahydro-5H-cycloheptyl[b]pyridine-9-ol dihydrochloride; the intermediate precursor ketone of remegipam refers to (6S, 9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cycloheptyl[b]pyridine-5-one.

[0021] The invention uses the intermediate precursor ketone of remegipam as a substrate, dimethyl sulfoxide (methanol) as a cosolvent, pyridoxal phosphate (PLP) as a coenzyme, isopropylamine hydrochloride as a cosubstrate, and a buffer solution of pH 9.0 as a reaction medium to form a reaction system, and performs a biocatalytic reaction under the conditions of 45° C.-55° C. and 800 rpm-1200 rpm.

[0022] The wet bacterial cell dosage of the present invention is 100 g / L, and the pure enzyme solution dosage is 200-300 g / L in terms of protein content. When the final substrate concentration is 10 g / L, the final methanol volume concentration is 10-30%, pyridoxal phosphate is 0.25-2 g / L, and isopropylamine hydrochloride is 82.59 g / L. When the final substrate concentration is 10 g / L, the final methanol volume concentration is 10-30%, pyridoxal phosphate is 0.25-2 g / L, and isopropylamine hydrochloride is 412.96 g / L.

[0023] Preferably, the wet cells are prepared as follows: a recombinant genetically engineered bacterium containing a gene encoding a ω-aminotransferase mutant is inoculated into an LB liquid culture medium containing kanamycin for culture, and then inoculated into a fresh kanamycin-resistant LB liquid culture medium for culture, IPTG is added to induce the culture, the supernatant is discarded by centrifugation, and the precipitate is collected to obtain the wet cells.

[0024] The method for culturing the recombinant genetically engineered bacteria of the present invention is as follows: inoculate into LB liquid culture medium containing 50 μg / ml kanamycin, and culture at 35-39°C, 150rpm-250rpm for 11h-13h. After the genetically engineered bacteria are cultured, inoculate into fresh LB liquid culture medium containing 50 μg / ml kanamycin resistance at a volume concentration of 1%-3%, and culture at 35°C-39°C, 100rpm-200rpm until the bacterial OD reaches 0. 600 When the pH value reaches 0.6-0.8, add IPTG with a final concentration of 0.1 mM, induce and culture at 26°C-30°C for 10h-14h, centrifuge at 4°C, 7000rpm-9000rpm for 10min, discard the supernatant, collect the precipitate, and obtain the wet bacteria.

[0025] Preferably, the pure enzyme solution is prepared as follows: the wet bacteria are resuspended with binding buffer, broken in an ice bath, centrifuged to remove foreign proteins, then eluted with buffer and collected the target protein, dialyzed with sodium phosphate buffer, and the intercepted liquid is collected as the pure enzyme solution.

[0026] The buffer of the present invention is a 50mM sodium phosphate buffer with a pH of 7.0-9.0, containing 250mM-350mM NaCl. Ultrasonic disruption is performed in an ice bath, 300W is disrupted for 10min, working for 1s and pausing for 3s, and centrifuged at 11000rpm-13000rpm for 10min. The supernatant is incubated with the Ni affinity chromatography resin equilibrated with the above-mentioned binding solution, and then rinsed with a washing buffer until there is basically no impurity protein, and then with an elution buffer. After the purity is identified by electrophoresis, the target protein is combined and dialyzed with a buffer. After dialysis for 48h, the intercepted liquid is collected to be the pure enzyme solution.

[0027] Preferably, the catalyst includes wet cells of recombinant genetically engineered bacteria of ω-aminotransferase and its mutants, crude enzyme solution, crude enzyme powder, and pure enzyme solution.

[0028] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: (1) The ω-aminotransferase mutant provided by the present invention has a higher conversion rate, organic solvent tolerance and product stereoselectivity for the preparation of remegipam intermediates, and has a better industrial application prospect than the prior art. (2) The application of the ω-aminotransferase mutant of the present invention in the preparation of the Remegipam intermediate from the Remegipam intermediate precursor ketone by microbial catalysis has low cost and is conducive to wide application. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the reaction formula for synthesizing the intermediate of Remigipam.

[0030] Figure 2 Schematic diagram of the conversion rate of ω-transaminase mutants at a substrate concentration of 2 g / L.

[0031] Figure 3 Schematic diagram of the conversion rate of ω-transaminase mutants at a substrate concentration of 10 g / L. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of the present invention. Example 1: Amplification of the wild-type ω-aminotransferase gene WT

[0033] According to the ω-aminotransferase gene sequence information from Chromobacterium violaceum included in Genbank, The RNA of Chromobacterium violaceum was extracted using the SPIN Kit, and DNA was obtained by reverse transcription. The DNA was used as a template for PCR amplification under the action of primers 1 and 2.

[0034] Primer 1: ATGCAGAAACAGCGTACCTGTAGC; Primer 2: TTAGTGGTGGTGGTGATGGTGT.

[0035] PCR reaction system (total volume 50 μL): 10×Pfu DNA Polymerase Buffer 25 μL, 10 mM dNTPmixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, cloning primer 1 and primer 2 at a concentration of 50 μM each 1 μL, genomic DNA 1 μL, Pfu DNA Polymerase 1 μL, ddH2O 20 μL.

[0036] The PCR instrument of BioRad was used, and the PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles, and final extension at 72°C for 10 min.

[0037] The results showed that the nucleotide sequence amplified by primers 1 and 2 was 1399 bp in length, which was the wild-type ω-aminotransferase gene, denoted as WT gene, and its nucleotide sequence was shown in SEQ ID NO.1. The amino acid sequence of the encoded protein was shown in SEQ ID NO.2, which encoded a complete open reading frame. Example 2: Construction of wild-type recombinant expression vector pET-28a-WT

[0038] Primers 3 and 4 were designed according to the WT gene sequence in Example 1, and the WT gene sequence was obtained using the recombinant plasmid pET28a-WT as a template under the action of the high-fidelity polymerase Phanta Max Super-FIdelity DNA Polymerase. The amplified fragment was treated with PCR Buffer, and the WT gene (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) was connected to the plasmid vector pET-28a (Invitrogen) by one-step cloning to obtain the recombinant expression vector pET-28a-WT.

[0039] Primer 3: AGAAGGAGATATACCATGCAGAAACAGCG; Primer 4: TTCTGCATGGTATATCTCCTTCTTAAAGTTAAA. Example 3: Construction of wild-type recombinant Escherichia coli BL21 / pET28a-WT

[0040] The recombinant expression vector pET28a-WT constructed in Example 2 was transformed into Escherichia coli BL21 (DE3) (Invitrogen) (42°C, 90s), spread on an LB plate containing 50μg / ml kanamycin resistance, and cultured at 37°C for 12h. Clones were randomly picked to extract plasmids for sequencing and identification, and wild-type recombinant Escherichia coli BL21 (DE3) / pET28a-WT was screened and obtained. Example 4: Induced expression of wild-type recombinant Escherichia coli BL21 / pET28a-WT The wild-type recombinant Escherichia coli BL21 (DE3) / pET28a-WT obtained in Example 3 was inoculated into LB liquid culture medium containing 50μg / ml kanamycin resistance, cultured at 37°C, 200rpm for 12h, and then inoculated into fresh LB liquid culture medium containing 50μg / ml kanamycin resistance at a 1% (v / v) inoculation amount, and cultured at 37°C, 150rpm until the bacterial OD 600 When the pH reaches 0.6-0.8, add IPTG with a final concentration of 0.1 mM, induce and culture at 28°C for 12 hours, centrifuge at 4°C and 8000 rpm for 10 minutes, discard the supernatant, collect the precipitate, and obtain the wild-type recombinant Escherichia coli BL21 / pET28a-WT wet bacteria. The bacteria can be directly used as a biocatalyst or for protein purification. Example 5: Preparation of wild-type ω-aminotransferase-WT pure enzyme solution

[0041] The wet cells obtained in Example 4 were resuspended with a binding buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl), ultrasonically disrupted (under ice bath conditions, 220 W for 20 min, working for 1 s and pausing for 2 s), and centrifuged at 12000 rpm for 10 min; the supernatant was incubated with a Ni affinity chromatography resin equilibrated with the above-mentioned binding buffer, and then rinsed with a wash buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 50 mM imidazole) until there was substantially no impurity protein, and then eluted with an elution buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 500 mM imidazole) and the target protein was collected. After the purity was identified by electrophoresis, the target proteins were combined and dialyzed with a dialysis buffer (50 mM, pH 8.0 sodium phosphate buffer) for 48 h (dialysis bag molecular cutoff 33 KDa). The intercepted liquid was collected, i.e., the wild-type ω-aminotransferase-WT pure enzyme liquid, and the protein content was determined by the Coomassie Brilliant Blue method. The enzyme liquid was diluted with 50 mM, pH 8.0 sodium phosphate buffer to a final concentration of 0.5 mg / mL, aliquoted, and frozen at -80°C. Example 6: Construction of ω-aminotransferase mutant library

[0042] According to the wild-type ω-aminotransferase gene sequence from Chromobacterium violaceum included in Genbank (the amino acid sequence is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.1), mutation primers for site-directed mutagenesis were designed. Rapid PCR technology was used to introduce single mutations at positions 22, 398, and 419 using the recombinant vector pET-28a-WT as a template. The primers were: F22L-F: TGCATCCGTTAACCGACACCG; F22L-R: GGATGCAGATGGTGAGCAGCA. G398A-F: CTTCGCCGAAATCGGTAGCCT; G398A-R: CCGATTTCGGCGAAGTCTGGA. G419T-F: CATCTGTACCGATCACATCGTAGCG; G419T-R: TGGTGCCGCTACGATGTGATC.

[0043] PCR reaction system (total reaction system is 50 μL): 1×Phanta max Buffer 25 μL, 10 mM dNTPmixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, Phanta Max Super-FIDelity DNA Polymerase 1 μL, 1 μL each of upstream and downstream primers with a concentration of 50 μM, 1 μL of recombinant vector pET-28a-WT, and 20 μL of ddH2O.

[0044] PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 6 min 40 s, for a total of 30 cycles, and final extension at 72°C for 10 min.

[0045] Take 10 μL of PCR product and transfer it into competent cells containing 100 μL of Escherichia coli BL21 (DE3), heat shock in a 42°C water bath for 90 seconds, immediately put it on ice for 3 minutes, add 600 μL of LB liquid culture medium to the tube, culture it in a 37°C incubator at 180 rpm for 1 hour, centrifuge the cultured bacterial solution at 12000 rpm for 1 minute, discard 600 μL of supernatant, mix the remaining 100 μL bacterial solution thoroughly and apply it to LB plate containing 50 μg / ml kanamycin resistance, culture it inverted at 37°C for 14 to 16 hours, pick out the monoclonal strain, send it to Hangzhou Qingke Sequencing Company for sequence detection, and use software to analyze the sequencing results. Example 7: Determination of conversion rate of ω-transaminase mutants at 2 g / L substrate concentration

[0046] Catalyst: The wild-type recombinant Escherichia coli BL21 / pET-28a-WT in Example 3 and the monoclonal strain verified by sequencing in Example 6 were used as catalysts by preparing wet cells according to the method in Example 4.

[0047] The final concentration composition of 1 ml reaction system is as follows: enzyme catalyst 10 g / L, pH 9.0 isopropylamine hydrochloride buffer, 2 g / L Remigipam intermediate precursor ketone (6S, 9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one as substrate, methanol final concentration 20% (v / v), pyridoxal phosphate 1 g / L, isopropylamine hydrochloride 82.59 g / L.

[0048] Reaction conditions: temperature 50°C, stirring speed 1000 r / min, reaction time 2h. After the reaction, samples were taken for HPLC detection of product peak area values, and the conversion rate was calculated based on the product standard curve.

[0049] The HPLC detection conditions are: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 ml / min; detection wavelength: 205 nm; detection temperature: 40°C. Several excellent mutants were obtained from the test results, and the conversion rates of some excellent mutants are shown in Table 1. Table 1 Conversion rate of the synthesis of remegipam intermediates catalyzed by wild-type aminotransferase WT and its mutants Recombinant bacteria Mutation site Conversion rate BL21 / pET-28a-WT WT 53.2％ BL21 / pET-28a-MUT1 F22L 57.34％ BL21 / pET-28a-MUT2 G398A 78.09％ BL21 / pET-28a-MUT3 G419T 61.89％ BL21 / pET-28a-MUT4 F22L / G398A / G419T 95.47％ Example 8: Determination of conversion rate of ω-aminotransferase mutants at a substrate concentration of 10 g / L

[0050] Catalyst: The wild-type recombinant Escherichia coli BL21 / pET-28a-WT in Example 3 and the monoclonal strain verified by sequencing in Example 6 were used as catalysts by preparing wet cells according to the method in Example 4.

[0051] The final concentration composition of 1ml reaction system is as follows: enzyme catalyst 10g / L, pH 9.0 isopropylamine hydrochloride buffer, 10g / L Remigipam intermediate precursor ketone (6S, 9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one as substrate, methanol final concentration 20% (v / v), pyridoxal phosphate 1g / L, isopropylamine hydrochloride 412.96g / L.

[0052] Reaction conditions: temperature 50°C, stirring speed 1000 r / min, reaction time 2h. After the reaction, samples were taken for HPLC detection of product peak area values, and the conversion rate was calculated based on the product standard curve.

[0053] The HPLC detection conditions are: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 ml / min; detection wavelength: 205 nm; detection temperature: 40°C. Several excellent mutants were obtained from the test results, and the conversion rates of some excellent mutants are shown in Table 2. Table 2 Conversion rate of synthesis of remegipam intermediates catalyzed by wild-type aminotransferase WT and its mutants Recombinant bacteria Mutation site Conversion rate BL21 / pET-28a-WT WT 22.14％ BL21 / pET-28a-MUT1 F22L 35.69％ BL21 / pET-28a-MUT2 G398A 48.35％ BL21 / pET-28a-MUT3 G419T 37.43％ BL21 / pET-28a-MUT4 F22L / G398A / G419T 83.76％ Example 9: Determination of conversion rate of ω-aminotransferase mutants at 20 g / L substrate concentration

[0054] Catalyst: The wild-type recombinant Escherichia coli BL21 / pET-28a-WT in Example 3 and the monoclonal strain verified by sequencing in Example 6 were used as catalysts by preparing wet cells according to the method in Example 4.

[0055] The final concentration composition of 1 ml reaction system is as follows: enzyme catalyst 10 g / L, pH 9.0 isopropylamine hydrochloride buffer, 20 g / L of remegipam intermediate precursor ketone (6S, 9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one as substrate, methanol final concentration 40% (v / v), 1 g / L of pyridoxal phosphate, and 600 g / L of isopropylamine hydrochloride.

[0056] Reaction conditions: temperature 50°C, stirring speed 1000 r / min, reaction time 2h. After the reaction, samples were taken for HPLC detection of product peak area values, and the conversion rate was calculated based on the product standard curve.

[0057] The HPLC detection conditions are: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 ml / min; detection wavelength: 205 nm; detection temperature: 40°C. Several excellent mutants were obtained from the test results, and the conversion rates of some excellent mutants are shown in Table 2. Table 2 Conversion rate of synthesis of remegipam intermediates catalyzed by wild-type aminotransferase WT and its mutants Recombinant bacteria Mutation site Conversion rate BL21 / pET-28a-WT WT 18.20％ BL21 / pET-28a-MUT1 F22L 23.45％ BL21 / pET-28a-MUT2 G398A 35.61％ BL21 / pET-28a-MUT3 G419T 41.69％ BL21 / pET-28a-MUT4 F22L / G398A / G419T 78.98％

[0058] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: by evolving the transaminase, a mutant with improved activity is obtained, and a high-conversion rate of large steric chiral amines can be synthesized under high temperature and organic solvent conditions, saving production costs while not requiring the participation of heavy metal catalysts and toxic reagents, thereby realizing green chemistry.

[0059] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A ω-transaminase mutant with improved stability, characterized in that: The ω-aminotransferase mutant is obtained by performing single-site or multi-site combined mutation on the 22nd, 398th and 419th positions of the amino acid sequence shown in SEQ ID NO.

2.

2. The ω-aminotransferase mutant according to claim 1, characterized in that The ω-aminotransferase mutant is a mutant in which the amino acid sequence shown in SEQ ID NO.2 is mutated into one of the following: (1) the phenylalanine at position 22 is mutated into leucine; (2) the phenylalanine at position 22 is mutated into leucine, and the glycine at position 398 is mutated into alanine; (3) the phenylalanine at position 22 is mutated into leucine, the glycine at position 398 is mutated into alanine, and the glycine at position 419 is mutated into threonine.

3. A gene encoding the ω-aminotransferase mutant according to claim 2.

4. A recombinant vector containing the coding gene according to claim 3.

5. A genetically engineered bacterium containing the coding gene according to claim 3.

6. Use of the ω-aminotransferase mutant with improved stability as claimed in claim 1 or 2 in the preparation of a Remegipam intermediate from a Remegipam intermediate precursor ketone catalyzed by microorganisms.

7. The use according to claim 6, characterized in that The application is as follows: using wet bacteria obtained by fermentation culture of recombinant genetic engineering bacteria containing the gene encoding the ω-transaminase mutant or pure enzyme liquid extracted by ultrasonic crushing of wet bacteria as a catalyst, preparing a buffer solution as a reaction medium to form a reaction system, and carrying out a biocatalytic reaction. After the reaction is completed, the reaction liquid is separated and purified to obtain (5S, 6S, 9R)-5-amino-6-(2,3-difluorophenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-9-ol dihydrochloride; the remegipam intermediate precursor ketone refers to (6S, 9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-5-one.

8. The use according to claim 7, characterized in that The wet bacterial cells are prepared as follows: a recombinant genetically engineered bacterium containing a gene encoding a ω-aminotransferase mutant is inoculated into an LB liquid culture medium containing kanamycin for culture, and then inoculated into a fresh LB liquid culture medium with kanamycin resistance for culture, IPTG is added for induction culture, the supernatant is discarded by centrifugation, and the precipitate is collected to obtain the wet bacterial cells.

9. The use according to claim 8, characterized in that The pure enzyme solution is prepared as follows: the wet bacteria are resuspended in a binding buffer, broken under ice bath conditions, centrifuged to remove foreign proteins, then eluted with a buffer and collected the target protein, dialyzed with a sodium phosphate buffer, and the intercepted liquid is collected as the pure enzyme solution.

10. The use according to claim 7, characterized in that The catalyst includes wet bacterial bodies of recombinant genetic engineering bacteria of ω-aminotransferase and mutants thereof, crude enzyme liquid, crude enzyme powder and pure enzyme liquid.

Images