Artificially circularized circular rna and applications thereof

By designing artificially circularized circular RNA (circmiR) to competitively bind with miRNAs, the problem of miRNAs binding with PTEN mRNA was solved, resulting in the upregulation of PTEN expression and enhanced sensitivity of lung adenocarcinoma to EGFR-TKIs, significantly inhibiting tumor proliferation, invasion and metastasis.

CN119955784BActive Publication Date: 2026-02-27PEKING UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510065235.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-15
Publication Date
2026-02-27
Estimated Expiration
2045-01-15

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively prevent miRNAs from binding to PTEN mRNA, resulting in low PTEN expression levels, which promotes cancer progression. Furthermore, the efficacy of EGFR-TKIs in treating lung cancer varies, and there are issues with drug resistance.

Method used

An artificially circularized circular RNA (circmiR) with the nucleotide sequence SEQ ID NO.1 was designed. By competitively binding to hsa-miR-21-5p and hsa-miR-9-5p, it inhibits their binding to PTEN mRNA, thereby upregulating PTEN expression and enhancing the sensitivity of tumors to EGFR-TKIs.

Benefits of technology

circmiR significantly increased endogenous PTEN mRNA and protein levels, downregulated the PI3K/AKT signaling pathway, inhibited tumor proliferation, invasion and metastasis, and enhanced the sensitivity of lung adenocarcinoma to osimertinib, providing a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955784B_ABST
    Figure CN119955784B_ABST
Patent Text Reader

Abstract

The application belongs to the field of medicine and biotechnology, and particularly relates to an artificially circularized circular RNA and application thereof. The application provides an artificially circularized circular RNA, wherein the nucleotide sequence of the circular RNA is shown as SEQ ID NO. 1. The circular RNA (circmiR) can inhibit the function of miRNAs, improve the endogenous PTEN mRNA and PTEN protein levels, and enhance the sensitivity of LUAD to osimertinib. The results of examples show that the circmiR can improve the endogenous PTEN mRNA and PTEN protein levels, down-regulate the PI3K / AKT signaling pathway, and then significantly inhibit the proliferation, migration and invasion of LUAD cell lines, and can significantly enhance the sensitivity of the LUAD osimertinib-resistant cell line to osimertinib. The circular RNA based on the application can provide a new treatment mode for LUAD, and provide a new treatment strategy for LUAD osimertinib-resistant patients.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of medical biotechnology, and particularly relates to an artificially circularized circular RNA and application thereof. BACKGROUND

[0002] Phosphatase and tensin homolog deleted from chromosome 10 (PTEN) is a tumor suppressor gene with phosphatase activity, which plays an important role in tumor occurrence, growth and metastasis. The expression level of PTEN in lung adenocarcinoma (LUAD) tissue is significantly lower than that in paracancerous tissue.

[0003] At present, in the clinical treatment of lung cancer, Epithelial growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) are one of the main target drugs, and EGFR-TKIs are widely used in non-small cell lung cancer (NSCLC) patients with EGFR sensitive mutations. However, the clinical efficacy of EGFR-TKIs in the treatment of lung cancer is not the same, and the median survival of lung cancer patients is only 8-20 months. Among them, the abnormal activation of PTEN / PI3K / AKT / mTOR is one of the important mechanisms of EGFR-TKIs resistance. Therefore, based on the importance of PTEN protein level in regulating the progression of lung adenocarcinoma, the sensitivity of EGFR-TKIs drug, and the low mutation rate of PTEN gene in lung cancer, designing a related tool to up-regulate the endogenous PTEN protein level can provide a new research idea and solution for EGFR-TKIs resistance.

[0004] MicroRNAs (miRNAs) are small non-coding RNA molecules, and their effect on downstream target genes mainly depends on the degree of complementarity with the 3'UTR sequence of the target gene. They bind to the target mRNA complementarily, inhibit mRNA translation or promote mRNA degradation, thereby exerting biological functions. Many miRNAs can bind to the 3'UTR of PTEN, inhibit the expression of PTEN, and thus promote cancer progression. MiRNA molecule sponges can prevent miRNAs from binding to target mRNA by competitive means. However, how to design suitable molecular sponges to efficiently prevent miRNAs from binding to PTEN mRNA and thus inhibit cancer progression is still a problem to be solved in the field. SUMMARY

[0005] The application aims to provide artificial circular RNA and application thereof, which can inhibit the binding of miRNAs and PTEN mRNA, up-regulate PTEN expression, and further inhibit cancer progression.

[0006] The application provides artificial circular RNA, and a nucleotide sequence of the circular RNA is shown as SEQ ID NO. 1.

[0007] The application also provides application of the circular RNA in the above scheme in preparation of an anti-tumor drug.

[0008] As a preferred scheme, the anti-tumor includes at least one of inhibiting tumor proliferation, invasion and metastasis.

[0009] As a preferred scheme, the tumor includes lung cancer.

[0010] As a preferred scheme, the lung cancer includes lung adenocarcinoma.

[0011] The application also provides application of the circular RNA in the above scheme in preparation of a product for inhibiting miRNAs, including hsa-miR-21-5p and / or hsa-miR-9-5p.

[0012] The application also provides application of the circular RNA in the above scheme in preparation of a product for enhancing PTEN protein expression.

[0013] The application also provides application of the circular RNA in the above scheme in preparation of a product for enhancing the sensitivity of tumor to EGFR-TKIs drug.

[0014] The application also provides application of the circular RNA in combination with EGFR-TKIs in preparation of an anti-tumor drug.

[0015] The application also provides an anti-tumor drug, and an active ingredient of the drug includes the circular RNA in the above scheme.

[0016] Beneficial effects: the application provides an artificially circularized circular RNA, the nucleotide sequence of which is shown as SEQ ID NO. 1. The circular RNA (circmiR) of the application can inhibit the binding of miRNAs to PTEN mRNA in a competitive binding manner with miRNAs, and increase the endogenous PTEN mRNA and PTEN protein levels. In addition, the circmiR of the application can improve the sensitivity of tumors to EGFR-TKIs drugs. It has been proved through in vitro and in vivo tests that the circmiR can enhance the sensitivity of LUAD Osimertinib (OR) resistant cell lines and LUAD Osimertinib resistant model mice to EGFR-TKIs drugs. In addition, the results of the examples show that the circmiR can increase the endogenous PTEN mRNA and PTEN protein levels, down-regulate the PI3K / AKT signaling pathway, and thus significantly inhibit the proliferation, migration and invasion of LUAD Osimertinib cell lines, and can significantly enhance the sensitivity of LUAD Osimertinib resistant cell lines to Osimertinib. Based on the artificially circularized circular RNA nucleic acid sequence of the application, a new treatment method for LUAD can be provided, and a new treatment strategy for LUAD Osimertinib resistant patients can be provided. In addition, the circmiR of the application is more stable than the linear RNA with the same sequence, and thus can up-regulate the PTEN level for a long time and play an anticancer role. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.

[0018] Figure 1 is a result graph of the binding ability of 10 miRNAs to PTEN mRNA 3'UTR; in the graph, ** indicates that the data is significantly different, p<0.01, and *** indicates that the data is extremely significantly different, p<0.001;

[0019] Figure 2 is a result graph of the regulation of 10 miRNAs on the PTEN mRNA and PTEN protein levels of A549 and H1299 cells; A is a result graph of the PTEN mRNA expression level, ** indicates that the data is significantly different, p<0.01, and *** indicates that the data is extremely significantly different, p<0.001; B is a result graph of the PTEN protein level;

[0020] Figure 3Figure showing the results of the significant up-regulation of PTEN mRNA expression levels in A549 and H1299 cells by the inhibitor of hsa-miR-21-5p, hsa-miR-9-5p, hsa-miR-96-5p, and hsa-miR-183-5p; wherein A is A549 cells; B is H1299 cells; ** indicates that the data are significantly different, p < 0.01, *** indicates that the data are extremely significantly different, p < 0.001;

[0021] Figure 4 Figure showing the results of the significant up-regulation of PTEN mRNA expression levels in A549 and H1299 cells by the inhibitor of hsa-miR-21-5p and hsa-miR-9-5p in combination; wherein A is A549 cells; B is H1299 cells; * indicates that the data are significantly different, p < 0.05, ** indicates that the data are significantly different, p < 0.01, *** indicates that the data are extremely significantly different, p < 0.001, **** indicates that the data are extremely significantly different, p < 0.0001;

[0022] Figure 5 Figure showing the results of the 6 groups of random sequences; wherein A is a figure showing the efficiency of the 6 groups of random sequences; B is a figure showing the results of the adsorption effect of the 6 groups of random sequences; * indicates that the data are significantly different, p < 0.05, ** indicates that the data are significantly different, p < 0.01, *** indicates that the data are extremely significantly different, p < 0.001, **** indicates that the data are extremely significantly different, p < 0.0001;

[0023] Figure 6 Figure showing the results of the combination of circmiR and miRNAs; wherein A is a figure showing the expression levels of circmiR in different combination modes of circmiR and miRNAs; B is a figure showing the results of the dual luciferase reporter gene analysis experiment; ** indicates that the data are significantly different, p < 0.01, *** indicates that the data are extremely significantly different, p < 0.001, **** indicates that the data are extremely significantly different, p < 0.0001;

[0024] Figure 7 Figure showing the results of the different number of interval bases of hsa-miR-21-5p reverse complementary sequences and hsa-miR-9-5p reverse complementary sequences in the circmiR sequence; ** indicates that the data are significantly different, p < 0.01, *** indicates that the data are extremely significantly different, p < 0.001;

[0025] Figure 8Figure showing the results of the experiment with different numbers of repeats of the reverse complement of hsa-miR-21-5p and the reverse complement of hsa-miR-9-5p in the circmiR sequence; ** indicates that the data are significantly different, p < 0.01, **** indicates that the data are extremely significantly different, p < 0.0001;

[0026] Figure 9 Figure showing the results of the stable expression of the circmiR sequence in the circular form in lung adenocarcinoma A549 and H1299 cells;

[0027] Figure 10 Figure showing that the half-life of the circmiR sequence in the circular form is higher than that of the linear form in lung adenocarcinoma A549 and H1299 cells; A is A549 cells; B is H1299 cells;

[0028] Figure 11 Figure showing that the circmiR sequence significantly up-regulates the PTEN mRNA and PTEN protein levels in lung adenocarcinoma A549 and H1299 cells; A is the PTEN mRNA expression level results figure, ** indicates that the data are significantly different, p < 0.01, *** indicates that the data are extremely significantly different, p < 0.001; B is the PTEN protein level results figure; C is the P-AKT 308 and P-AKT 473 protein level results figure;

[0029] Figure 12 Figure showing that the circmiR sequence can significantly inhibit cell viability in lung adenocarcinoma A549 and H1299 cells; A is A549 cells; B is H1299 cells;

[0030] Figure 13 Figure showing that the circmiR sequence can significantly inhibit the cell invasion and metastasis ability in lung adenocarcinoma cells; A is the microscopic photograph of the invasion and metastasis of A549 cells; B is the statistical diagram of the number of A549 cell invasion and metastasis cells; C is the microscopic photograph of the invasion and metastasis of H1299 cells; D is the statistical diagram of the number of H1299 cell invasion and metastasis cells; **** indicates that the data are extremely significantly different, p < 0.0001;

[0031] Figure 14 Figure showing that the circmiR sequence can significantly inhibit tumor growth in mice;

[0032] Figure 15 Figure showing that the circmiR sequence can significantly inhibit tumor metastasis in mice; A is a typical diagram of the inhibition of tumor metastasis by the circmiR sequence; B is a diagram of the number of metastatic nodules; ** indicates that the data are significantly different, p < 0.01;

[0033] Figure 16Figure 1 is a result graph of circmiR sequence can significantly reduce the IC50 value of lung adenocarcinoma osimertinib-resistant cell lines; wherein A is the LUAD cell line PC9; B is the LUAD cell line H1975;

[0034] Figure 17 Figure 2 is a result graph of circmiR sequence stably expressed in a circular form in lung adenocarcinoma osimertinib-resistant cells;

[0035] Figure 18 Figure 1 is a result graph of circmiR sequence can significantly reduce the IC50 value of lung adenocarcinoma osimertinib-resistant cell lines; wherein A is the LUAD cell line PC9; B is the LUAD cell line H1975;

[0036] Figure 19 Figure 3 is a result graph of circmiR sequence combined with osimertinib in mice can significantly reduce the subcutaneous transplanted tumor of osimertinib-resistant cells;

[0037] Figure 20 Figure 4 is a result graph of circmiR sequence combined with osimertinib in mice can significantly reduce lung adenocarcinoma osimertinib-resistant cells orthotopic implantation tumor. DETAILED DESCRIPTION

[0038] The application provides a circular RNA artificially circularized, the nucleotide sequence of the circular RNA is shown as SEQ ID NO. 1, and the circular RNA is specifically as follows: GUUGGCACCGCGGCUGAUCGCACCUGGCACUGCAUCUAGAUAUCGGAUCCAUCAG CUCAACAUCAGGACAUAAGCUAAGAUCCAUCAGCUCAUACAGCUACGAACCAAAGAAGAUCCAUCAGCUCAACAUCAGGACAUAAGCUAAGAUCCAUCAGCUCAUACAGCUACGAACCAAAGAAGAUCCAUCAGCUCAACAUCAGGACAUAAGCUAAGAUCCAUCAGCUCAUACAGCUACGAACCAAAGAAGAUCCAUCAGCUCAACAUCAGGACAUAAGCUAAGAUCCAUCAGCUCAUACAGCUACGAACCAAAGAAGAUCCAUCAGCUCAACAUCAGGACAUAAGCUAAGAUCCAUCAGCUCAUACAGCUACGAACCAAAGAAGAUCCAUCAGCUCAACAUCAGGACAUAAGCUAAGAUCCAUCAGCUCAUACAGCUACGAACCAAAGAAGAUCUUCCUAAGGUUGGGCAGGGACGAAGACACCGAUGAGCUUGGGAGUGAUGAG.

[0039] The circular RNA (circmiR) described in the application is a circular RNA artificially circularized by repeating 6 times after splicing of reverse complementary sequences of hsa-miR-21-5p and hsa-miR-9-5p. In the application, the circmiR inhibits the functions of hsa-miR-21-5p and hsa-miR-9-5p by competitively combining with hsa-miR-21-5p and hsa-miR-9-5p, and then up-regulates the expression of an endogenous PTEN gene, and inhibits the proliferation, invasion and metastasis of tumors. In vivo and in vitro experiments verify that the circular RNA can enhance the sensitivity of an LUAD osimertinib-resistant cell line and a drug-resistant mouse model to osimertinib.

[0040] The application also provides the use of the circular RNA in the preparation of an anti-tumor drug. As an embodiment, the anti-tumor includes at least one of inhibiting tumor proliferation, invasion and metastasis. As an embodiment, the tumor includes lung cancer; as an embodiment, the lung cancer includes lung adenocarcinoma. The circular RNA of the application can increase the endogenous PTEN mRNA and PTEN protein level, down-regulate the PI3K / AKT signal pathway, and then inhibit the proliferation, migration and invasion of the tumor.

[0041] The application also provides the use of the circular RNA in the preparation of a product for inhibiting miRNAs, including hsa-miR-21-5p and / or hsa-miR-9-5p. The circular RNA (circmiR) of the application is an artificial circular RNA spliced by the reverse complementary sequences of hsa-miR-21-5p and hsa-miR-9-5p repeated 6 times, which can competitively bind to hsa-miR-21-5p and hsa-miR-9-5p, and then inhibit the functions of hsa-miR-21-5p and hsa-miR-9-5p.

[0042] The application also provides the use of the circular RNA in the preparation of a product for enhancing the expression of PTEN protein.

[0043] The application also provides the use of the circular RNA in the preparation of a product for enhancing the sensitivity of the tumor to EGFR-TKIs drugs. As an embodiment, the EGFR-TKIs drug includes osimertinib.

[0044] The application also provides the use of the circular RNA combined with EGFR-TKIs in the preparation of an anti-tumor drug. The circular RNA of the application can inhibit the binding of miRNA to PTEN mRNA, up-regulate the expression of PTEN, and then improve the drug resistance of the tumor to EGFR-TKIs.

[0045] The application also provides an anti-tumor drug, and the active ingredient of the drug includes the circular RNA described in the above scheme. As an embodiment, the active ingredient of the drug includes the circular RNA described in the above scheme and EGFR-TKIs. As an embodiment, the drug further includes a pharmaceutically acceptable excipient. As an embodiment, the excipient includes one or more of a pharmaceutical excipient or a pharmaceutical carrier, and the pharmaceutical carrier preferably includes at least one of a lentivirus, an adeno-associated virus and a nanoparticle. The application does not have special limitations on the dosage form and preparation method of the drug, and the circmiR in a medically acceptable dosage form and the relative dosage form preparation method can be used.

[0046] In order to further illustrate the present application, the artificial circularized circular RNA and its application provided by the present application are described in detail below in combination with the accompanying drawings and examples, but they cannot be understood as limiting the scope of protection of the present application.

[0047] Screening of miRNAs for artificial circularized circular RNA (circmiR) in Example 1

[0048] In this example, miRNAs binding to PTEN were determined by bioinformatics means combined with biological techniques, as follows:

[0049] 1. Screening of miRNAs binding to PTEN 3'UTR

[0050] (1) In order to determine the miRNAs capable of significantly regulating the PTEN gene, first, by bioinformatics means, the data sets provided in the public database were used to analyze the binding ability of PTEN 3'UTR to miRNAs by three databases, Targetscan (http: / / www.targetscan.org / ), mirTarbase (https: / / mirtarbase.cuhk.edu.cn / ) and miRecord (http: / / mirecords.biolead.org / ). The data analyzed by the three databases were intersected, and the results showed that 428 miRNAs had the potential to bind to PTEN mRNA. Combined with the data of miRNAs with higher expression level in LUAD cancer tissue than in paired para-cancer tissue provided in the GSE110907 data set of the public database GEO datasets, further analysis showed that the expression level of 10 miRNAs in the LUAD tissue was significantly higher than that in the para-cancer, and had the potential to bind to PTEN mRNA, meeting the screening requirements. The 10 miRNAs were hsa-miR-148a-3p, hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-200b-3p, hsa-miR-21-5p, hsa-miR-301b-3p, hsa-miR-429, hsa-miR-577, hsa-miR-9-5p and hsa-miR-96-5p. The sequence information of the above 10 miRNAs is disclosed at https: / / mirbase.org.

[0051] (2) Dual luciferase assay was used to determine the binding of 10 different miRNAs to PTEN mRNA (published in: Human PTEN ENST00000371953.3, 3'UTR length: 645, https: / / www.targetscan.org / cgi-bin / targetscan / vert_80 / view_gene.cgi?rs=ENST00000371953.3&taxid=9606&show cnc=0&shownc=0&shownc_nc=&showncf1=&showncf2=&subset=1) in step (1), and then the PTEN mRNA 3'UTR sequence was divided into three segments, wherein the first segment was 1-2783 bp of the PTEN mRNA sequence, the second segment was 2784-5321 bp, and the third segment was 5322-6458 bp. The connection of 10 different miRNAs to each segment of PTEN mRNA is shown in Table 1.

[0052] Table 1 Connection of miRNA to PTEN mRNA 3'UTR

[0053]

[0054] Suzhou GenePharma Co., Ltd. was commissioned to design and synthesize mimics of 10 miRNAs and mimics negative control (mimics-NC) for verifying the binding of 10 miRNAs to PTEN.

[0055] The three segments of PTEN mRNA 3'UTR sequences described above were respectively constructed into pmirGLO plasmid vectors (insertion site, construction method reference: Kober, P, Mossakowska, BJ, Rusetska, N, et al. Epigenetic Downregulation of Hsa-miR-193b-3p Increases Cyclin D1 Expression Level and Cell Proliferation in Human Meningiomas. Int JMol Sci. 2023; 24(17): doi:10.3390 / ijms241713483), and 10 miRNA mimics were co-transfected into HEK-293T cells with the corresponding number of PTEN mRNA 3'UTR. The binding of PTEN mRNA 3'UTR and 10 miRNAs was detected by dual luciferase reporter gene analysis experiment, and the results are shown in Figure 1 According to the results, it can be seen that the above-mentioned 10 miRNAs all have the ability to bind to PTEN mRNA 3'UTR. Figure 1

[0056] 2. Regulation of miRNAs on PTEN mRNA and protein

[0057] The above results prove that the above 10 miRNAs can bind to PTEN mRNA 3'UTR, and then the biological technology is used to detect the regulation ability of the 10 miRNAs on PTEN mRNA and PTEN protein in LUAD.

[0058] (1) A, the 10 miRNAs mimics synthesized in step 1 and control mimics-NC were respectively dissolved in 125 μL ddH2O as storage solution, the storage solution concentration was 20 μM, and the final concentration was 50 nM.

[0059] ​B, ①LUADA549 and NCI-H1299 cells were plated into 6-well plates, and divided into experimental and control groups. ②According to the calculation of 2 mL of medium per well of 6-well plate, the amount of step A storage solution used per well was 5 μL; ③Group each well to take 1.5 mL sterile EP tube, add 200 μL jetprime buffer solvent, 5 μL step A storage solution and 8 μL jetprime transfection reagent to the EP tube, mix well, and stand at room temperature for 15 min. ④The reagent in step ③ EP tube was added to the 6-well plate, and the liquid was changed after 12 h, and the cells were lysed after 36 h, and the RNA or protein was extracted, and the qRT-PCR experiment was used to quantitatively analyze the PTEN mRNA expression, and the Western Blot experiment was used to quantitatively analyze the PTEN protein expression.

[0060] The qRT-PCR was selected from Nanjing Novozyme Biotech Co., Ltd. kit, GAPDH was used as an internal reference gene, and the primer sequence of the qRT-PCR was as follows:

[0061] qP-h / m PTEN-F (SEQ ID NO. 2): 5'-TGGATTCGACTTAGACTTGACCT-3';

[0062] qP-h / m PTEN-R (SEQ ID NO. 3): 5'-GGTGGGTTATGGTCTTCAAAAGG-3';

[0063] qp-GAPDH-F (SEQ ID NO. 4): 5'-GGAGCGAGATCCCTCCAAAAT-3';

[0064] qp-GAPDH-R (SEQ ID NO. 5): 5'-GGCTGTTGTCATACTTCTCATGG-3'.

[0065] The reaction system of the qRT-PCR experiment was 2x TaqPro Universal SYBR qPCR Master Mix 10.0 μL, 10 μM Primer F 0.4 μL, 10 μM Primer R 0.4 μL, Template DNA / cDNA 1.0 μL and ddH2O 8.2 μL. The reaction program of the qRT-PCR experiment was 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, cycle number 40; and the default melting curve acquisition program of the instrument was used.

[0066] The results of qRT-PCR and Western Blot are as follows Figure 2As shown, the above 10 miRNAs can down-regulate PTEN mRNA level and PTEN protein level to different degrees compared with the control group (mimics-NC), wherein hsa-miR-21-5p, hsa-miR-9-5p, hsa-miR-96-5p and hsa-miR-183-5p have the most significant down-regulation effect on PTEN mRNA and PTEN protein.

[0067] (2) Next, Suzhou GenePharma Co., Ltd. was commissioned to design and synthesize inhibitors of the four miRNAs (hsa-miR-21-5p, hsa-miR-9-5p, hsa-miR-96-5p and hsa-miR-183-5p) and their controls (inhibitors negative control, inhibitors-NC).

[0068] A. The above four miRNAs inhibitors miR-inhibitors and controls inhibitors-NC were respectively dissolved in 250 μL ddH2O as stock solutions, and the stock solution concentration was 20 μM, and the final concentration was 50 nM.

[0069] B. The operation method of (1) B in step 2 was used, with the difference being that the synthesized miR-inhibitors and inhibitors-NC were added to the LUADA549 and NCI-H1299 cell lines, respectively, and the PTEN mRNA expression was quantitatively analyzed by qRT-PCR experiment, and the results are shown in Figure 3 The results show that when the four miRNAs are inhibited respectively, PTEN mRNA expression level in A549 and NCI-H1299 cell lines can be up-regulated to different degrees compared with the control group (inhibitors-NC). Among them, the effect of inhibiting hsa-miR-21-5p and hsa-miR-9-5p is the most significant.

[0070] 3. Regulation of PTEN by two miRNAs combined inhibitors

[0071] A. Design two miRNAs inhibitor combinations, respectively: hsa-miR-21-5p and hsa-miR-9-5p; hsa-miR-21-5p and hsa-miR-96-5p; hsa-miR-21-5p and hsa-miR-183-5p; hsa-miR-9-5p and hsa-miR-96-5p; hsa-miR-9-5p and hsa-miR-183-5p; and hsa-miR-96-5p and hsa-miR-183-5p. B. Simultaneously transfect the miRNAs inhibitors combined in step A into LUAD cell lines A549 and NCI-H1299 cells, respectively, and the control group is transfected with the corresponding inhibitors-NC. Quantitative analysis of PTEN mRNA expression by qRT-PCR experiment, and the results are shown in Figure 4 .

[0072] According to Figure 4 , compared with any single miRNA inhibitor treatment, the miRNAs inhibitor combination can more obviously up-regulate the PTEN mRNA level. Among them, the combination of simultaneously inhibiting hsa-miR-21-5p and hsa-miR-9-5p has the most obvious effect on up-regulating the PTEN mRNA level.

[0073] At the same time, three miRNAs inhibitor combinations (three combinations) and four miRNAs inhibitor combinations (four combinations) are designed to observe the regulation effect on PTEN, and the results show that the three combinations and the four combinations also have obvious effect on up-regulating the PTEN mRNA level, but compared with the combination of hsa-miR-21-5p and hsa-miR-9-5p, the PTEN mRNA level is not obviously improved, and there is a risk of increasing off-target. Therefore, the combination of targeting hsa-miR-21-5p and hsa-miR-9-5p is selected in the subsequent experiment to improve the endogenous PTEN expression level in LUAD cells.

[0074] Example 2 Sequence design of miRNA molecular sponge inhibitor

[0075] In order to explore the sequence composition of the molecular sponge inhibitor and optimize its sequence composition, in this embodiment, the sequence design and cyclization scheme of the miRNA molecular sponge inhibitor are determined by biological technology, and the specific content is as follows:

[0076] 1. Sequence composition of miRNA molecular sponge inhibitor

[0077] Considering that the stability of covalently closed circular structure is stronger than that of linear molecular sponge, and that the circular structure RNA molecule has long half-life in vivo and in vitro and is not easy to be degraded, the molecular sponge is designed into a circular structure. The effect and efficiency of the molecular sponge and the success rate of the circularization of the molecular sponge in in vivo and in vitro experiments are closely related to the sequence composition of the molecular sponge. The random sequences with protective effect and conducive to ring formation and the reverse complementary sequences for mediating ring formation are added to the two ends (5' end and 3' end) of the RNA molecular sponge composed of the reverse complementary sequences of hsa-miR-21-5p and hsa-miR-9-5p, and the expected circular structure is called circmiR.

[0078] (1) A, 6 groups of random sequences were designed by using a random sequence design website (http: / / mkwak.org / oligorand / index.html), each group was designed for the two ends (5' end and 3' end) of the molecular sponge, 50 bp was designed for each end, and the sequence information before and after the 6 groups of random sequences is shown in Table 2.

[0079] Table 2 Sequence information before and after 6 groups of random sequences

[0080]

[0081] The above 6 groups of random sequences do not have miRNAs binding sites and special secondary structures, and then according to the sequence composition: "random sequence before + hsa-mir-21-5p reverse complementary sequence + spacer sequence + hsa-mir-9-5p reverse complementary sequence + random sequence after", a sequence fragment is synthesized, wherein the spacer sequence is AGAUCC.

[0082] B, each group of sequence fragments is constructed into pLV-circ-Puro plasmid between EcoR I and BamH I, to construct 6 plasmids with different random sequences; the plasmids are transfected into HEK-293T cells, divergent primers crossing the splicing sites are designed, and the circularization efficiency is detected by qRT-PCR technology. The qRT-PCR experimental system and procedure are the same as those in Example 1, and the sequence information of the divergent primers is as follows:

[0083] Random-verification loop-F (SEQ ID NO. 18): 5'-CTCATACAGCTACGAACCAAAG-3';

[0084] Random-verification loop-R (SEQ ID NO. 19): 5'-GATCTTAGCTTATGTCCTGATGTTG-3'.

[0085] The detection results are as follows: Figure 5As shown in Table A, the results show that the No. 2 random sequence has the highest loop efficiency.

[0086] (2) The adsorption effect of different random sequences in the HEK-293T cells in step (1) was detected by using a dual-luciferase reporter assay experiment, and the results are shown in Table B. Figure 5

[0087] According to Table B, the No. 2 random sequence has the best adsorption effect. Therefore, the No. 2 random sequence is selected to complete the subsequent circmiR sequence optimization experiment, and the pLV-circ-Puro plasmid with the No. 2 random sequence is called circmiR-1 (SEQ ID NO. 20), and the sequence information is as follows: Figure 5

[0088] The underlined part is the sequence before and after the No. 2 random sequence, the italic part is the reverse complementary sequence of hsa-miR-21-5p, the black and bold part is the reverse complementary sequence of hsa-miR-9-5p, and the lower case part is the spacer sequence. 2. Optimization of circmiR sequence

[0089] (1) Optimization of the binding mode of circmiR and miRNAs.

[0090] In mammals, there is a phenomenon of imperfect binding (bulged binding site) when miRNAs bind to target mRNAs. In the present application, the degradation efficiency and binding efficiency of two different binding modes are compared.

[0091] The above-mentioned circmiR-1 sequence is modified into an imperfect binding mode by point mutation, which is called cirmiR-2 (SEQ ID NO. 21). The sequence information of the circmiR-2 is as follows: the second pair of random sequences is selected, and the reverse complementary sequence is combined with PTEN 3'UTR from perfect to bug, which is as follows:

[0092] circmiR-1 and cirmiR-2 are respectively transfected into HEK-293T cells, and the expression amount of circmiR is detected by qRT-PCR, and the primers, reaction system and procedure used in the qRT-PCR are the same as those in step 1, and the results are shown in Table A.

[0093] As shown in Table A, the perfect in the figure corresponds to circmiR-1, and the bulged corresponds to circmiR-2. The results show that cirmiR-2 is less degraded than cirmiR-1. Figure 6

[0094] ​​(2) Transfect circmiR-1 and circmiR-2 into HEK-293T cells respectively, and use dual luciferase reporter gene analysis to analyze the binding effect of circmiR and miRNAs.

[0095] The HEK-293T cells were randomly divided into a negative control group, a positive control group, an experimental group 1 and an experimental group 2, and each group was treated as follows: negative control: transfection of pLV-circ-Puro empty plasmid and mimics-NC; positive control: transfection of pLV-circ-Puro empty plasmid and miRNA mimics of hsa-miR-21-5p and hsa-miR-9-5p; experimental group 1: circmiR-1 and miRNA mimics of hsa-miR-21-5p and hsa-miR-9-5p; experimental group 2: circmiR-2 and miRNA mimics of hsa-miR-21-5p and hsa-miR-9-5p.

[0096] The results of the dual luciferase reporter gene analysis experiment are shown in Table B of Figure 6 The results show that the binding effect of circmiR-2 and miRNAs is better. Therefore, the circmiR sequence is designed to be imperfectly combined, i.e. circmiR-2 sequence is selected for subsequent optimization experiments.

[0097] (3) Determine the number of spacer bases between the two miRNAs reverse complementary sequences in the circmiR sequence

[0098] The binding ability of miRNAs and target points is affected by the secondary structure near the target point sequence, and the number of spacer bases between the molecular sponge sequences may regulate the adsorption efficiency of circmiR by affecting the secondary structure of circmiR. On the basis of step (2) circmiR-2, 6, 12, 24, 36 and 72 bases were introduced between the reverse complementary sequences of hsa-miR-21-5p and hsa-miR-9-5p respectively, and the sequence information is shown in Table 3. Among them, the circmiR constructed when the number of spacer bases is 6 is circmiR-2 in step (2).

[0099] Table 3 Spacer base sequence information

[0100]

[0101] The hsa-miR-21-5p and hsa-miR-9-5p reverse complementary sequences between the hsa-miR-21-5p and hsa-miR-9-5p of the circmiR-2 plasmid of step (2) were introduced with 6, 12, 24, 36 and 72 bases, respectively; the plasmids with different base numbers were transiently transfected into HEK-293T cells, wherein, the negative control group was transfected with pLV-circ-Puro empty plasmid and mimics-NC, and the positive control group was transfected with pLV-circ-Puro empty plasmid and miRNA mimics of hsa-miR-21-5p and hsa-miR-9-5p; the results of the dual luciferase reporter gene analysis experiment are shown in FIG. 8. Figure 7 The results show that when the interval is 12 bases, the adsorption of circmiR on hsa-miR-21-5p and hsa-miR-9-5p is best, which is called circmiR-3 (SEQ ID NO. 26), which is used for subsequent optimization experiments. The sequence information of the circmiR-3 is as follows:

[0102] (4) Determining the number of times of repeating the reverse complementary sequences of two miRNAs in circmiR

[0103] Increasing the number of sequence repetitions within a certain range can increase the adsorption capacity of molecular sponge on corresponding miRNAs. On the basis of step (3) circmiR-3, the hsa-miR-21-5p and hsa-miR-9-5p reverse complementary sequences were repeated 2, 4, 8, 12, 16 and 24 times (reference: Türkel, S, Farabaugh, P. Comment on Blachinsky et al. "Procedure for controlling number of repeats, orientation, and order during cloning of oligonucleotides" Biotechniques 36: 933-936 (June 2004). BIOTECHNIQUES. 2004; 37(4): 562; author reply 562. doi: 10.2144 / 04374BF01). Among them, when the number of repetitions is 2, the circmiR constructed is circmiR-3 in step (3), and when the number of repetitions is 4, 8, 12, 16 and 24, the sequence AUCAGC is added at the end before the random sequence, and the sequence AGAUCU is added at the front after the random sequence.

[0104] Different number of repeats of plasmid were transiently transfected into HEK-293T cells, wherein the negative control group was transfected with pLV-circ-Puro empty plasmid and mimics-NC, the positive control group was transfected with pLV-circ-Puro empty plasmid and miRNA mimics of hsa-miR-21-5p and hsa-miR-9-5p, and the results of dual luciferase reporter gene analysis experiment are shown in Figure 8 As shown in the results, with the increase of the number of repeats, the adsorption capacity of circmiR to hsa-miR-21-5p and hsa-miR-9-5p gradually increased, and when the number of repeats reached 12 times, the adsorption effect reached a plateau.

[0105] The results of the optimization experiment of circmiR showed that the circmiR sequence contained 12 miRNA reverse complementary sequences, the reverse complementary sequences of hsa-miR-21-5p and hsa-miR-9-5p were arranged in turn, each reverse complementary sequence was separated by 12 bases, and the binding mode of the reverse complementary sequence to hsa-miR-21-5p and hsa-miR-9-5p was imperfect binding. The sequence information of the obtained circmiR is shown in SEQ ID NO. 1:

[0106] Among them, the underlined part is the sequence before and after the 2nd random sequence, the lower case is the interval base, the italic part is the hsa-miR-21-5p reverse complementary sequence, and the black bold part is the hsa-miR-9-5p reverse complementary sequence.

[0107] 3. Stability verification of circmiR

[0108] The circmiR formed in step 2 was tested for stability. In LUAD cells A549 and NCI-H1299 cells, using lentiviral infection technology, stable expression of circmiR (referred to as A549 circmiR and NCI-H1299 circmiR) and its linear form linemiR (referred to as A549 linemiR and NCI-H1299 linemiR) were constructed. Stable cell lines were also constructed for the control group containing only pLV-circ-puro empty plasmid (referred to as A549 ctrl and NCI-H1299 ctrl).

[0109] Wherein the sequence information of linemiR is consistent with that of circmiR, the difference is that circmiR does not need to modify the plasmid when connected into pLV-circ-puro plasmid, and linemiR needs to delete the reverse complementary sequence for efficient ring formation in the plasmid when connected into pLV-circ-puro plasmid. The reverse complementary sequence for efficient ring formation of the pLV-circ-puro plasmid is divided into two segments, wherein one segment is shown in SEQ ID NO. 27: 5'-GAGTTCTAAAATTAAACTATGTGGAGTCATGTCCAACCGCACAATGCATCTTTATGTGAAACTTGCTAGAGTTTTTGTTTTCCTTCTATGTAAAAGTCCAGTTGGGAAGCTTTATTTCTGATAGATTAAATGGTATAGGTCTTTCAGTTTTCTCTTCATTTCTGACAACTGAACTGCTCTCGCCTTGAACCTGTTTTGGC-3'; the other segment is shown in SEQ ID NO. 28: 5'-GCCAAAACAGGTTCAAGGCGAGAGCAGTTCAGTTGTCAGAAATGAAGAGAAAACTGAAAGACCTATACCATTTAATCTATCAGAAATAAAGCTTCCCAACTGGACTTTTACATAGAAGGAAAACAAAAACTCTAGCAAGTTTCACATAAAGATGCATTGTGCGGTTGGACATGACTCCACATAGTTTAATTTTAGAACTC-3'.

[0110] Northern blot experiment is an effective hybridization technique for specific detection of RNA level, which is the gold standard for RNA identification. The circmiR and linemiR can be quantitatively and qualitatively detected using probes. Referring to the instructions of DIG Northern Starter Kit labeling and hybridization detection kit (Roche, 12039672910), the primers crossing the circmiR cyclization linker site are synthesized, and the digoxin (DIG) labeled RNA probe synthesis reaction is carried out by in vitro transcription method, and the substrate chemiluminescence detection of hybridization molecules is carried out by enzyme-linked immunoassay method and CDP-Star. The GAPDH probe is used as an internal control probe, and the circmiR probe and the linemiR probe are used for detection, and the results show that the circmiR (502 nt) is stably expressed in the form of a ring in the cell Figure 9 ).

[0111] The primer sequences used are as follows: Northern-F (SEQ ID NO. 29): 5'-TCCTAAGGTTGGGCAGGGAC-3'; Northern-R (SEQ ID NO. 30): 5'-TAATACGACTCACTATAGGGGCTGATGGATCCGATATCTAG-3'.

[0112] Actinomycin D was used to inhibit the synthesis of nascent RNA in the circmiR and linemiR stable cell lines of A549 and NCI-H1299 (Reference: Zheng, L, Liang, H, Zhang, Q, et al. circPTEN1, a circular RNA generated from PTEN, suppresses cancer progression through inhibition of TGF-β / Smad signaling. Mol Cancer. 2022; 21(1): 41. doi: 10.1186 / s12943-022-01495-y), in order to verify the stability of circmiR. The degradation rate of circmiR and linemiR within 24h was detected by qRT-PCR, and the results are shown in Figure 10 The reference primers, reaction system and procedure used in the qRT-PCR experiment are the same as in Example 1, the circmiR primers in the qRT-PCR are the same as in step 1 of Example 2, and the linemiR primers are as follows: linemiR-F (SEQ ID NO. 31): 5'-TCCATCAGCTCAACATCAGGAC-3'; linemiR-R (SEQ ID NO. 32): 5'-GAAGATCTTCTTTGGTTCGTAGCTG-3'.

[0113] It was found that at 24h, the linemiR had almost completely degraded, while the half-life of the circmiR was greater than 24h, indicating that the circmiR had high stability.

[0114] The above experiments further confirmed the circular biological characteristics of circmiR and proved that it can be stably expressed in cell lines. In summary, circmiR can be efficiently circularized in LUAD cell lines A549 and NCI-H1299 and has strong stability, which takes advantage of the circular structure.

[0115] Example 3 Inhibition of LUAD by circmiR in in vivo and in vitro experiments

[0116] The experimental operation in this example is performed according to the reference (Zheng, L, Liang, H, Zhang, Q, et al. circPTEN1, a circular RNA generated from PTEN, suppresses cancer progression through inhibition of TGF-β / Smad signaling. Mol Cancer. 2022; 21(1): 41. doi: 10.1186 / s12943-022-01495-y).

[0117] (1) In vitro experiment to detect the effect of circmiR on PTEN mRNA and protein levels

[0118] A, by qRT-PCR experiment, GAPDH was used as an internal reference gene, and the PTEN mRNA level change was detected by using the A549 circmiR and NCI-H1299 circmiR stable cell lines in Example 2. The primers, reaction system and procedure used in the qRT-PCR experiment were the same as in Example 1, and the results are shown in Figure 11 B. The results showed that compared with A549 ctrl and NCI-H1299 ctrl cells, the PTEN mRNA levels of A549 circmiR and NCI-H1299 circmiR cell lines were significantly up-regulated. B, by Western Blot experiment, GAPDH was used as an internal reference protein, and the PTEN protein level change was detected by using the A549 circmiR and NCI-H1299 circmiR stable cell lines in Example 2, and the results are shown in Figure 11 B. The results showed that compared with A549 ctrl and NCI-H1299 ctrl cells, the PTEN protein levels of A549 circmiR and NCI-H1299 circmiR cell lines were significantly up-regulated. C, by Western Blot experiment, the total AKT protein expression was used as a control, and the P-AKT 308 and P-AKT 473 protein level changes were detected by using the A549 circmiR and NCI-H1299 circmiR stable cell lines in Example 2, and the results are shown in Figure 11 C. According to Figure 11 C, compared with A549 ctrl and NCI-H1299 ctrl cells, the P-AKT 308 and P-AKT 473 protein levels of A549 circmiR and NCI-H1299 circmiR groups were significantly down-regulated, indicating that circmiR can further down-regulate the PI3K / AKT signaling pathway, thereby inhibiting the proliferation, migration and invasion of tumors.

[0119] Step (1) results show that circmiR can up-regulate PTEN expression level in LUAD cell lines, suggesting that circmiR can inhibit the proliferation, invasion and metastasis of LUAD cell lines.

[0120] (2) In vitro experiment to detect the regulation of circmiR on the proliferation, invasion and metastasis ability of LUAD

[0121] A. The change of cell viability in A549 circmiR and NCI-H1299 circmiR cell lines and A549 ctrl and NCI-H1299 ctrl cell lines was detected by CCK8 experiment as described in Example 2, and the results are shown in Figure 12 The results show that stable expression of circmiR can inhibit cell viability.

[0122] B. The cell invasion and metastasis ability in A549 and NCI-H1299 cell lines stably expressing circmiR was detected by Transwell experiment, and the results are shown in Figure 13 The results show that circmiR can inhibit cell invasion and metastasis.

[0123] (3) In vivo experiment to detect the regulation of circmiR on the proliferation and metastasis ability of LUAD

[0124] A. Regulation of circmiR on the proliferation of LUAD in vivo environment: ① A549 cells stably expressing circmiR were used to construct experimental group CDX model (A549 circmiR) by subcutaneous tumor implantation, and injected subcutaneously in one side of the axilla of mice, with 1×10 6 cells per mouse, once injection; ② The control group CDX model (A549) was constructed according to the method of step ①. ③ After 39d, the tumor pictures were taken, and the results are shown in Figure 14 The results show that the average tumor volume of A549 circmiR group is 90.03mm 3 , which is significantly lower than the tumor volume of A549 group 385.36mm 3 , indicating that circmiR can inhibit tumor growth.

[0125] B. Regulation of circmiR on the metastasis of LUAD in vivo environment: A549 cell lines stably expressing circmiR were injected into mice by tail vein injection, with 8×10 5 cells per mouse, once injection, to detect the effect of circmiR on lung metastasis, and the results are shown in Figure 15 The results show that circmiR can inhibit the ability of lung metastasis of LUAD cells.

[0126] In this embodiment, experiments such as Western blot and qRT-PCR reveal that circmiR inhibits the proliferation, invasion and metastasis of LUAD cells, inhibits the formation of tumors in CDX subcutaneous tumor mouse models, and inhibits the metastasis of tumors in tail vein lung metastasis mouse models.

[0127] Example 4 Effect of circmiR on LUAD osimertinib resistance

[0128] (1) The IC50 value of osimertinib in LUAD cell lines PC9 and PC9 OR and NCI-H1975 and NCI-H1975 OR cells was detected by CCK8 technology, and the results are shown in Figure 16 The results show that the IC50 value of osimertinib-resistant cells is significantly higher than that of parental cells, indicating that the osimertinib-resistant cell lines (PC9 OR and NCI-H1975 OR) have lower sensitivity to osimertinib compared to parental cells.

[0129] (2) Effect of circmiR on LUAD osimertinib-resistant cell lines in vitro

[0130] A, by lentiviral infection technology, using lentivirus packaged with circmiR sequence (circmiR) to infect LUAD cell lines PC9 OR and NCI-H1975 OR cells, using empty lentivirus (ctrl) to infect LUAD cell lines PC9, PC9 OR, NCI-H1975 and NCI-H1975 OR cells, and infecting twice, each time for 12 h, PC9 ctrl, PC9 OR ctrl, PC9 OR circmiR, NCI-H1975 ctrl, NCI-H1975 OR ctrl, NCI-H1975 OR circmiR stable cell lines can be constructed. B, the Northern Blot experiment was used to verify the ring formation efficiency of PC9 OR circmiR and NCI-H1975 OR circmiR, and the operation of the Northern Blot experiment was the same as in Example 2, and the results are shown in Figure 17 , indicating that circmiR in the constructed drug-resistant cell circmiR stable line can be stably formed into a ring, and the efficiency is very high. C, by CCK8 experiment, the IC50 value of osimertinib in PC9 ctrl, PC9 OR ctrl, PC9 OR circmiR, NCI-H1975 ctrl, NCI-H1975 OR ctrl, NCI-H1975 OR circmiR cells was detected, and the results are shown in Figure 18The results showed that PC9 OR ctrl IC50 value was significantly higher than its parental PC9 ctrl cell line, and NCI-H1975 OR ctrl IC50 value was significantly higher than its parental NCI-H1975 ctrl cell line. However, the circmiR group can significantly improve this phenomenon.

[0131] (3) In vivo experiment to detect the influence of circmiR on osimertinib sensitivity

[0132] Adeno-associated virus AAV6-circmiR and its negative control (AAV-Control) for expressing circmiR in mice were designed and synthesized by Shanghai GeneChem Co., Ltd (Shanghai, China), and osimertinib was administered by gavage, which was provided by Selleck Company. The gavage was performed every day for 14 consecutive days, and the gavage amount was 30 mg / kg. KP cells (published in the literature: Cao, F, Yang, D, Tang, F, et al. Girdin Promotes Tumorigenesis and Chemoresistance in Lung Adenocarcinoma by Interacting with PKM2. Cancers (Basel). 2022; 14(22): doi: 10.3390 / cancers14225688) were stably expressed Luciferase (referred to as KP-Luci, operation reference: Zheng, L, Liang, H, Zhang, Q, et al. circPTEN1, a circular RNA generated from PTEN, suppresses cancer progression through inhibition of TGF-β / Smad signaling. Mol Cancer. 2022; 21(1): 41. doi: 10.1186 / s12943-022-01495-y) by lentivirus infection technology, which was used for subsequent small animal live imaging experiments.

[0133] A, Construct subcutaneous xenograft CDX model, group PC9+osimertinib solvent (CMC-Na)+AAV-Control, PC9+osimertinib+AAV-Control, PC9 OR+osimertinib+AAV-Control, PC9 OR+osimertinib+AAV6-circmiR group, in turn, PC9+CMC-Na+aav6-control, PC9+Osi+aav6-control, PC9 OR+Osi+aav6-control and PC9 OR+Osi+aav6-circmiR. Wherein AAV-Control and AAV6-circmiR are administered by intratumoral injection (reference: Sun, Y, Xie, J, Cai, S, et al. Elevated expression of nuclear receptor-binding SET domain 3 promotes pancreatic cancer cell growth. Cell Death Dis. 2021; 12(10): 913. doi: 10.1038 / s41419-021-04205-6). The detection results are shown in Figure 19 , the results show that the average tumor volume of PC9+CMC-Na+aav6-control, PC9+Osi+aav6-control, PC9 OR+Osi+aav6-control and PC9 OR+Osi+aav6-circmiR four groups is 750.60mm 3 , 161.96mm 3 , 620.60mm 3 and 61.98mm 3 . It is shown that circmiR can significantly inhibit tumor formation.

[0134] B, build orthotopic tumor model to simulate primary LUAD (reference: Wilson, AN, Chen, B, Liu, X, et al. A Method for Orthotopic Transplantation of Lung Cancer in Mice. Methods Mol Biol. 2022; 2374 231-242. doi: 10.1007 / 978-1-0716-1701-4_20), grouped as KP-Luci+osimertinib solvent (CMC-Na)+AAV-Control, KP-Luci+osimertinib+AAV-Control, KP-Luci OR+osimertinib solvent+AAV-Control, KP-Luci+osimertinib+AAV6-circmiR group, in turn KP+CMC-Na+AAV6-control, KP+Osi+AAV6-control, KP OR+Osi+AAV6-control and KP OR+Osi+AAV6-circmiR. Among them, AAV-Control and AAV6-circmiR are administered by nasal inhalation, once every 7 days, a total of 3 times. Virus titer 1.00E+12 V.G. / mL, 40 μL per mouse each time. The results are shown in Figure 20 As shown in the results, the results show that circmiR can significantly inhibit tumor generation.

[0135] It can be seen that the artificial circularization of circular RNA in the present application can increase the endogenous PTEN mRNA and PTEN protein level, down-regulate the PI3K / AKT signaling pathway, and then significantly inhibit the proliferation, migration and invasion of the LUAD cell line, and can enhance the sensitivity of the LUAD osimertinib-resistant cell line and the LUAD osimertinib-resistant model mouse to EGFR-TKIs drugs in in vivo and in vitro experiments by up-regulating the PTEN expression level, providing a new treatment strategy for LUAD osimertinib-resistant patients.

[0136] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiment of the present application, not all embodiments, and people can also obtain other embodiments according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. Artificially circularized circular RNA, characterized in that, The nucleotide sequence of the circular RNA is shown as SEQ ID NO.

1.

2. The circular RNA of claim 1 in the preparation of an anti-tumor drug; the tumor is lung cancer.

3. Use according to claim 2, characterized in that, The anti-tumor includes at least one of inhibiting tumor proliferation, invasion and metastasis.

4. Use according to claim 2, characterized in that, The lung cancer includes lung adenocarcinoma.

5. The circular RNA of claim 1 in the preparation of a product for inhibiting miRNAs, including hsa-miR-21-5p and / or hsa-miR-9-5p; the product is used for anti-tumor; the tumor is lung cancer.

6. The circular RNA of claim 1 in the preparation of a product for enhancing the expression of PTEN protein; the product is used for anti-tumor; the tumor is lung cancer.

7. The circular RNA of claim 1 in the preparation of a product for enhancing the sensitivity of tumor to EGFR-TKIs drugs; the EGFR-TKIs is osimertinib.

8. The circular RNA of claim 1 in combination with EGFR-TKIs in the preparation of an anti-tumor drug; the EGFR-TKIs is osimertinib.

9. An antitumor agent, characterized by comprising a compound of the formula (I) or a pharmaceutically acceptable salt thereof. The active ingredient of the drug includes the circular RNA of claim 1.

Citation Information

Patent Citations

  • microRNA function inhibition methods

    CN102264898A

  • Group of miRNAs and application of group of miRNAs in biological targeted therapy of breast cancer

    CN110787181A