SiRNA targeting gus3 gene of plutella xylostella and application thereof
By using siRNA silencing technology targeting the GST3 gene of the diamondback moth, the problem of increased toxicity of the diamondback moth to diamide insecticides with temperature was solved, improving the control effect of insecticides. In particular, the sensitivity of the diamondback moth to tetrachlorantraniliprole was enhanced at low temperatures, showing significant application prospects.
Patent Information
- Application Number
- CN202510080803.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-20
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2045-01-20
AI Technical Summary
In existing technologies, the toxicity of diamondback moth to diamide insecticides increases with rising temperature, making control more difficult in high-temperature environments. Furthermore, the GSTs detoxification enzymes in the insect's body play an important regulatory role in this process, leading to enhanced resistance.
We designed siRNA targeting the GST3 gene of diamondback moth to reduce the positive temperature effect of pesticides on diamondback moths by silencing the GST3 gene, thereby increasing their sensitivity to low-temperature environments. The siRNA was then introduced into the intestines of diamondback moths via feeding.
It significantly reduced the positive temperature effect of tetrachlorantraniliprole on diamondback moth, improved the control effect of the insecticide, especially at low temperatures, it significantly increased the sensitivity of diamondback moth to tetrachlorantraniliprole, reduced the amount of pesticide used and protected the ecological environment.
Smart Images

Figure CN119955785B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically, to a siRNA targeting the GST3 gene of the diamondback moth and its application. Background Technology
[0002] The diamondback moth (Plutella xylostella), belonging to the family Plutellidae in the order Lepidoptera, is a major pest of cruciferous vegetables worldwide. It is widely distributed in my country, occurring across a large geographical area, and exhibits a wide range of temperature adaptability. Temperature has long been considered a key factor influencing insecticide toxicity. The toxicity of diamide insecticides acting on ryanodine receptors to lepidopterans is mostly positively correlated with temperature. Previous studies found that tetrachlorantraniliprole showed a significant positive temperature effect on the diamondback moth between 15℃ and 35℃, meaning that the toxicity of the pesticide to the diamondback moth increased significantly with increasing temperature.
[0003] Glutathione S-transferases (GSTs) are a multifunctional supergene family capable of eliminating both endogenous and exogenous toxic substances. Insect GSTs play a crucial role in their detoxification metabolism and resistance formation in insecticides. For example, resistance to imidacloprid in the Xinjiang cotton aphid population is associated with enhanced GST activity, and increased GST activity in resistant diamondback moths is one of the mechanisms by which they develop resistance to organophosphate insecticides. It has been reported that the enzyme activity of detoxification enzymes GSTs significantly increases after induction with tetrachlorantraniliprole at 15°C. Transcriptome sequencing revealed that GSTs are closely related to the positive temperature effect of tetrachlorantraniliprole and may participate in regulating this effect.
[0004] siRNA (Small Interfering RNA) is a double-stranded RNA of 20 to 25 nucleotides in length. It achieves gene silencing by selectively targeting specific genes through complementary base pairing, leading to efficient and specific degradation of mRNA. Compared to dsRNA, siRNA is more stable in the insect digestive system and more effectively triggers the RNAi pathway in lepidopteran insects, which also helps to optimize RNAi pest control strategies.
[0005] In view of this, the present invention is hereby proposed. Summary of the Invention
[0006] The toxicity of diamide insecticides to diamondback moths increases with rising temperature, exhibiting a significant positive temperature response (PTR). Metabolic detoxification enzymes within insects play a crucial regulatory role in the temperature-dependent response to insecticide toxicity. This invention reduces the PTR effect of insecticides on diamondback moths by silencing key GST genes involved in the PTR effect, thereby increasing the moth's sensitivity to pesticides under specific environmental temperatures. This is of great significance for the efficient control of agricultural pests.
[0007] The first objective of this invention is to provide an siRNA that targets the GST3 gene of diamondback moth, wherein the nucleotide sequence of the sense strand of the siRNA is shown in Sequence 7 of the sequence listing and the nucleotide sequence of the antisense strand is shown in Sequence 8 of the sequence listing.
[0008] The aforementioned siRNA targeting the GST3 gene of the diamondback moth can induce silencing of the GST3 gene expression in the diamondback moth, affecting the positive temperature effect of the insecticide tetrachlorantraniliprole on the diamondback moth and increasing the sensitivity of the diamondback moth to tetrachlorantraniliprole at low temperatures.
[0009] A third object of the present invention is to provide the use of the siRNA in the control of diamondback moth or in the preparation of agents for the control of diamondback moth.
[0010] A fourth objective of this invention is to provide a method for controlling the diamondback moth by applying the aforementioned miRNA to the diamondback moth. This method can alleviate the problem of increasing pesticide resistance in the diamondback moth, making control increasingly difficult, in the existing technology.
[0011] Preferably, the above-mentioned siRNA is introduced into the diamondback moth to regulate the positive temperature effect of tetrachlorantraniliprole on the diamondback moth, thereby changing the sensitivity of the diamondback moth to tetrachlorantraniliprole at different temperatures and achieving efficient control of the diamondback moth.
[0012] Preferably, the introduction involves preparing siRNA into a solution and then introducing it into the diamondback moth.
[0013] Preferably, it is introduced into the intestines of the diamondback moth by feeding.
[0014] Preferably, the diamondback moth is a diamondback moth larva.
[0015] Preferably, the feeding concentration of the siRNA solution is 100 μg / g.
[0016] A fifth objective of the present invention is a pesticide for controlling diamondback moth, said pesticide comprising the above-mentioned miRNA.
[0017] The beneficial effects of this invention are: compared to dsRNAs, using siRNA to silence target genes in the diamondback moth is a more precise and effective method. siRNA has advantages such as specificity, high efficiency, and high stability. This invention identifies an siRNA with outstanding silencing efficiency against the diamondback moth's GST3 gene, significantly interfering with the regulation of the positive temperature effect of the GST3 gene on the insecticide tetrachlorantraniliprole. It holds promise for field application in improving the control efficacy of diamide insecticides against the diamondback moth and has excellent application prospects. Attached Figure Description
[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show the embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 The relative expression level of the GST3 gene after feeding with siRNA. Detailed Implementation
[0020] Unless otherwise specified, the methods used in the following embodiments are conventional methods.
[0021] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0022] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0023] Example 1: Cloning of the GST3 gene in the diamondback moth
[0024] 1. Primers were designed to amplify the diamondback moth GST3 gene, NCBI accession number AB232916.1.
[0025] Based on the found sequence, primers for amplifying the diamondback moth GST3 gene were designed using primer design software, and primers for amplifying the internal reference gene (rpL-32, GenBank: NM_001309136.1) were also designed. The primer sequences are shown in Table 1.
[0026] Table 1 PCR primers
[0027] Gene name Primers Serial Number Sequence (5'-3') GST3 GST3-F Sequence 1 GTCACCTCGCTCGTGTATG GST3-R Sequence 2 GGGCTCGTTCTTGGATTT RpL32 RpL32-F Sequence 3 ATCCGCCATCAGTCCGACCG RpL32-R Sequence 4 GGCTGAACCGTAACCAATGTTG
[0028] 2. The diamondback moth population used in the experiment was obtained from a long-term indoor rearing population at the Institute of Plant Protection, Hebei Academy of Agricultural and Forestry Sciences. The larvae were continuously reared using indoor-grown radish seedlings under conditions of (25±1)℃, relative humidity of 60%-70%, and L:D = 16h:8h. Healthy and active third-instar larvae with consistent physiological states were selected for the experiment.
[0029] 3. RNA Extraction: Collected diamondback moth larvae from each treatment were ground into powder using liquid nitrogen. 0.5 mL of TransZol Up and 0.1 mL of RNA Extraction Agent were added to each treatment. The mixture was repeatedly pipetted and aspirated, vortexed at room temperature for 5 min, and centrifuged at 10000g at 4℃ for 15 min. 200 μL of the colorless aqueous phase was transferred to a new centrifuge tube, and an equal volume of anhydrous ethanol was added. The mixture was gently inverted and then added to a centrifuge column. The column was centrifuged at 12000×g at room temperature for 30 s, and the supernatant was discarded. 500 μL of CB9 was added, and the column was centrifuged at 12000g at room temperature for 30 s, discarding the supernatant. This process was repeated once. Then, 500 μL of WB9 (pre-added with anhydrous ethanol) was added, and the column was centrifuged at 12000g at room temperature for 30 s, discarding the eluent. This process was repeated once, followed by centrifugation at 12000g at room temperature for 2 min to remove residual ethanol. Place the centrifuge column into an enzyme-free centrifuge tube, add 50 μL of RNase-free water to the center of the column, incubate at room temperature for 1 min, then centrifuge at 12000g for 1 min at room temperature to elute RNA. Take a portion to determine the RNA concentration, and store the remainder at -80℃.
[0030] 4. Synthesis of first-strand cDNA
[0031] First-strand cDNA was synthesized from the extracted total RNA using the TransScript One-step gDNA Removal and cDNA SynthesisSuperMix reverse transcription kit, following its instructions. The preparation system is shown in Table 2.
[0032] Table 2 cDNA synthesis
[0033]
[0034] Add the components according to Table 1, mix gently, incubate at 42°C for 15 min, and inactivate by heating at 85°C for 5 s. RT / RI and gDNA Remover, stored at -80°C.
[0035] Example 2: Design and preparation of target gene siRNA
[0036] The green fluorescent protein (GFP) gene was selected as the control gene.
[0037] Starting with the AUG start codon of the mRNA, we searched for the "AA" doublet sequence and generated two different siRNA sequences through NCBI verification to screen for the optimal target site. These were named siGST3-1 and siGST3-2, respectively. The siRNAs were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0038] siGST3-1 Chain of Justice: 5'-GATATCGAGGTGTGCAGAC-3' (Sequence 5)
[0039] Antisense chain: 5'-GTCTGCACACCTCGATATC-3' (Sequence 6)
[0040] siGST3-2 Justice Chain: 5'-GGAGTAACTCAAGTTGGAC-3' (Sequence 7)
[0041] Antonym: 5'-GTCCAACTTGAGTTACTCC-3' (Sequence 8)
[0042] siGFP positive strand: 5'-GGGCGATGCCACCTACGGC-3' (Sequence 9)
[0043] Antisense chain: 5'-GCCGTAGGTGGCATCGCCC-3' (Sequence 10)
[0044] Refer to T7 RiboMAX TM The siRNA was prepared according to the method described in the Express RNAi System (P1700) kit. The sample loading system is shown in Table 3. After that, the DNA template was removed, the siRNA was annealed and purified, and the synthesized siRNA was stored in a -80°C freezer.
[0045] Table 3 siRNA Synthesis
[0046]
[0047] Example 3 RNA interference
[0048] Using a feeding method, synthesized siGST3-1, siGST3-2, and siGFP (control) were added to a certain amount of diamondback moth feed and mixed thoroughly to achieve a feed siRNA content of 100 μg / g. Twenty third-instar diamondback moth larvae were introduced into each treatment after 8 hours of starvation, with three replicates per treatment. After 12 hours, the larvae were re-fed with fresh siRNA feed, and each treatment was transferred to artificial feed and pretreated at 15℃, 25℃, and 35℃ for 24 hours, respectively. Samples were then collected continuously for 4 days, with five larvae from each treatment. RT-qPCR was used to detect changes in the expression level of the diamondback moth GST3 gene, with RpL32 used as an internal reference gene to correct differences in cDNA levels.
[0049] Using the cDNA obtained in Example 1 as a template, RT-qPCR reaction was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Nanjing, China) and gene-specific primers (Table 1).
[0050] The qPCR reaction system is shown in Table 4:
[0051] Table 4. Real-time PCR reaction system
[0052]
[0053] Reaction program: 94℃ pre-denaturation for 30s; 94℃ denaturation for 5s, 60℃ annealing and extension for 30s, 40 cycles. Then, the obtained Ct value is applied using 2... -△△Ct The data were processed using the method described by ΔCt = (ΔCt target gene - ΔCt internal reference gene). SPSS and Microsoft Excel software were used for data analysis. One-way analysis of variance (ANOVA) was used to compare the relative expression levels of the GST3 gene across treatments, and Tukey's method was used for multiple comparisons.
[0054] The results are as follows Figure 1 As shown, compared with the control group siGFP, feeding diamondback moth larvae with siGST3-1 and siGST3-2 significantly reduced the transcription level of the diamondback moth GST3 gene after 1-4 days. However, the interference efficiencies of the two methods differed, with siGST3-2 showing a more pronounced silencing efficiency for the diamondback moth GST3 gene. The silencing efficiencies at 1d, 2d, 3d, and 4d were 78.61%, 87.36%, 89.58%, and 89.56%, respectively, significantly inhibiting the expression of the diamondback moth GST3 gene. Subsequent experiments will use siGST3-2 as the feeding method.
[0055] Example 4: Changes in the temperature effect of tetrachlorantraniliprole on diamondback moth after GST3 gene silencing.
[0056] Diamondback moths starved for 8 hours were fed a diet containing 100 μg / g of siGST3-2, then placed at normal rearing temperature for 12 hours before being re-fed a fresh diet containing siGST3-2. The moths were then pretreated at 15℃, 25℃, and 35℃ for 24 hours before subsequent experiments. Different concentrations of tetrachlorfenapyr were prepared in 0.1% Tween-80 water (15℃: 32, 16, 8, 4, 2 mg / L; 25℃: 4, 2, 1, 0.5, 0.25 mg / L; 35℃: 0.5, 0.25, 0.125, 0.0625, 0.03125 mg / L). The sensitivity of the moths to the pesticide was determined using the feed immersion method. After punching small round pieces (1 cm in diameter) from cabbage leaves, completely immerse them in the pesticide solution for 30 seconds, remove them, and allow them to air dry naturally on absorbent paper before inoculating them with test insects. A 0.1% Tween 80 aqueous solution was used as a control. 15 insects were treated with each concentration, with 3 replicates. The mortality rate of the test insects was checked after 72 hours. The standard for death was that the insects did not react normally when lightly touched with a brush.
[0057] Table 5 shows the toxicity of tetrachlorantraniliprole to diamondback moth at different temperatures and the results of the temperature effect. The bioactivity of tetrachlorantraniliprole to diamondback moth increased with increasing temperature, exhibiting a positive temperature effect. After feeding siGST3-2, the temperature coefficient of tetrachlorantraniliprole at 35℃ decreased from +769.46 to +77.67, significantly reducing the positive temperature effect of tetrachlorantraniliprole on diamondback moth. Especially at a lower temperature of 15℃, feeding siGST3-2 significantly increased the sensitivity of diamondback moth to tetrachlorantraniliprole, LC... 50 The concentration decreased from 26.16 mg / L to 9.72 mg / L. This indicates that the GST3 gene in the diamondback moth mediates the regulation of the positive temperature effect of tetrachlorantraniliprole on the diamondback moth.
[0058] Table 5 Temperature coefficients of tetrachlorantraniliprole's bioactivity on diamondback moth after gene silencing.
[0059]
[0060] * indicates that the lethal concentration at each temperature is significantly different from that at 15℃ (t-test, P<0.05).
[0061] The above results indicate that introducing siRNA that inhibits the GST gene in the diamondback moth into larvae regulates the temperature effect of tetrachlorantraniliprole on the diamondback moth by altering the expression of the GST3 gene, thereby increasing the sensitivity of the diamondback moth to insecticides at specific temperatures. The siGST3-2 interference effect of this invention is outstanding and holds promise for combined application with diamide insecticides in the field to control the diamondback moth, improving insecticide efficacy, reducing pesticide dosage, and protecting the ecological environment, demonstrating excellent application prospects.
[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for controlling the diamondback moth, characterized in that, An siRNA targeting the GST3 gene of the diamondback moth was introduced into the diamondback moth to regulate the positive temperature effect of tetrachlorantraniliprole on the diamondback moth, thereby changing the sensitivity of the diamondback moth to tetrachlorantraniliprole at different temperatures and achieving the control of the diamondback moth. The nucleotide sequence of the sense strand of the siRNA is shown in Sequence 7 of the sequence listing, and the nucleotide sequence of the antisense strand is shown in Sequence 8 of the sequence listing.
2. The method for controlling diamondback moth as described in claim 1, characterized in that, The siRNA was prepared as a solution and then introduced into the diamondback moth.
3. The method for controlling diamondback moth as described in claim 2, characterized in that, It is introduced into the intestines of diamondback moths through feeding.
4. The method for controlling diamondback moth as described in claim 3, characterized in that, The diamondback moth mentioned is the diamondback moth larva.
5. The method for controlling diamondback moth as described in claim 2, characterized in that, The feeding concentration of siRNA solution was 100 μg / g.