Application of cotton GhERF2 gene in saline-alkali resistance of plants

Abstract

The cotton stress resistance related gene GhERF2 is screened in combination with transcriptome data, the application of the gene in improvement of plant salt and alkali resistance is disclosed, the nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the amino acid sequence of the gene is shown as SEQ ID NO: 2. The gene is significantly highly expressed in cotton stems, and is significantly up-regulated under the induction of saline-alkali stress. By silencing the expression of the GhERF2 gene in upland cotton, the sensitivity of the plant to saline-alkali stress is enhanced. The invention has important significance in breeding and research for improving the salt and alkali resistance of cotton, and provides technical support for cultivating new salt and alkali resistant varieties of cotton.

Description

Technical Field

[0001] The invention belongs to the field of plant bioengineering and transgenic technology, and particularly relates to a cotton GhERF2 gene and an application thereof in responding to saline-alkali stress. Background Art

[0002] The disclosure of this background information is intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an acknowledgment or any form of suggestion that this information has become the prior art known to a person of ordinary skill in the art.

[0003] Soil salinization is a major environmental challenge facing mankind, and the increasingly serious salinization threatens the sustainable development of agricultural ecology around the world. Therefore, how to develop and utilize saline land is one of the major challenges that scientists are currently working to solve. Long-term production practice has proved that planting salt-alkali tolerant crops is currently one of the most effective ways to reuse saline-alkali land. This not only solves the direct problems caused by soil salinization, but also provides a way to help enhance agricultural resilience and help discover new ways to achieve sustainable development of the agricultural industry.

[0004] Transcriptome sequencing (RNA-seq) helps to identify gene expression profiles, differentially expressed genes (DEGs) and their transcriptional regulation patterns. By comparing the analysis of multiple samples at different developmental stages, tissues or adverse conditions, RNA-seq can quickly provide information on gene expression and identify new genes that mediate responses to various physiological processes in plants, thereby elucidating the underlying molecular mechanisms of stress response biological processes.

[0005] Cotton cultivation is of great significance to the development and utilization of saline-alkali land and the development of the cotton industry. When cotton faces the complex and diverse secondary saline-alkali environment in the field, the various physiological and biochemical reactions and related metabolic pathways involved will also undergo various changes. However, the differences in the responses of different parts of cotton roots to the compound saline-alkali stress simulated in the secondary saline-alkali environment in the field have not been reported.

[0006] In the present invention, a key gene related to cotton salt-alkali stress resistance was successfully screened out through transcriptome sequencing. GhERF2, The gene was cloned and identified. Through sequence structure, function analysis and expression pattern analysis, it was found that it was expressed in large quantities in the roots when exposed to saline-alkali stress. Subsequently, transgenic plants were created using gene silencing and overexpression methods, further verifying the gene GhERF2 It plays an important role in plant resistance to salt-alkali stress. Summary of the invention

[0007] The problem to be solved by the present invention is to provide a gene for upland cotton GhERF2 and its application in response to saline-alkali stress.

[0008] In order to solve the above technical problems, the present invention adopts the following technical solutions: The present invention provides a cotton GhERF2 Gene, application of the gene in regulating salt-alkali resistance of target plants; GhERF2 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO: 2.

[0009] Furthermore, the cotton GhERF2 Application of genes in improving plant resistance to salt or alkaline stress.

[0010] Furthermore, the plant is cotton.

[0011] Further, by silencing the GhERF2 Gene to reduce cotton resistance to combined saline-alkali stress; or by overexpressing the GhERF2 Genes to improve cotton's resistance to salinity and alkali stress.

[0012] Further, by expressing or overexpressing the GhERF2 Genes to improve the resistance of corresponding plants to saline-alkali stress.

[0013] Further, the application comprises cotton GhERF2 A method for constructing a recombinant vector, expression cassette or recombinant bacteria of a gene.

[0014] The present invention also provides GhERF2 A gene screening method, the method comprising: (1) subjecting upland cotton seedling roots to saline-alkali stress and performing transcriptome sequencing; (2) analyzing the sequencing results to obtain differentially expressed genes; (3) combining qRT-PCR to ultimately screen out key genes GhERF2 .

[0015] The present invention also provides a cotton leaf injection inoculation method, which comprises: (1) transforming Agrobacterium and preparing an infection bacterial solution; and (2) injecting and inoculating upland cotton leaves.

[0016] The present invention also provides GhERF2 A method for cloning a gene and constructing a vector, the method comprising: (1) preparing test materials and reagents; (2) extracting total RNA from upland cotton and synthesizing cDNA; (3) GhERF2 Gene cloning; (4) Construction of VIGS recombinant plasmid vector.

[0017] The present invention also provides GhERF2 A method for verifying gene function, comprising: (1) GhERF2 Bioinformatics analysis of virus-induced GhERF2Gene silencing; (3) GhERF2 Phenotypic analysis of upland cotton under saline-alkali stress after gene silencing.

[0018] Beneficial effect: The present invention obtains the genes related to cotton salt-alkali stress through transcriptome analysis. GhERF2 The gene was cloned and its function was further verified through bioinformatics analysis and VIGS technology. GhERF2 The salt-alkali resistance of the gene can positively regulate the salt-alkali resistance of upland cotton. Therefore, the present invention has important significance in breeding and research for improving the salt-alkali stress resistance of cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Transcriptome analysis of different root parts of upland cotton under mixed salt-alkali stress treatment; (A) The roots of upland cotton seedlings were used as samples for salt-alkali stress treatment, and transcriptome sequencing and analysis were performed to finally obtain differentially expressed genes; (B) The differentially expressed genes specifically in the root tip were obtained through Venn diagram; (C) The key gene GhERF2 was finally screened out by combining KEGG analysis.

[0020] Figure 2 for GhERF2 Gene sequence and expression pattern analysis of the gene; wherein: (A) GhERF2 Gene conservation in Arabidopsis, Gossypium hirsutum, Gossypium barbadense, Gossypium asiatica and Gossypium raimondii AP2 / ERF Domain sequence alignment; (B) GhERF2 Analysis of gene expression patterns in different tissues and organs of cotton; (C) After saline-alkali stress treatment, GhERF2 Analysis of gene expression patterns.

[0021] Figure 3 cotton GhERF2 Analysis of gene protein structure and function; including: (A) GhERF2 Schematic diagram of gene structure; (B) GhERF2 Gene protein secondary structure analysis; (C) GhERF2 Analysis of hydrophilicity of gene proteins; (D) GhERF2 Schematic diagram of the tertiary structure of gene protein.

[0022] Figure 4 for TRV2-GhERF2 Construction of gene silencing recombinant plasmid vector, where M is DL 2000 DNA Marker, (A) is GhERF2 Gel electrophoresis detection of amplified products, (B) GhERF2 PCR amplification diagram of gene silencing fragment, (C) GhERF2 Diagram of ligated vector transformation clones.

[0023] Figure 5 cotton GhERF2 Phenotypic analysis under mixed salt-alkali stress after gene silencing; (A) Albino phenotype after PDS gene silencing; (B) Phenotypic diagram of silenced plants and control plants after 24h of mixed salt-alkali treatment; (C) GhERF2 Analysis of gene silencing efficiency; (D) Whole plant fresh weight of silenced plants and control plants after 24 h of mixed salt-alkali treatment; (E) Chlorophyll content of silenced plants and control plants after 24 h of mixed salt-alkali treatment; (F) Superoxide dismutase content of silenced plants and control plants after 24 h of mixed salt-alkali treatment; (G) Malondialdehyde content of silenced plants and control plants after 24 h of mixed salt-alkali treatment; (H) MDA staining results of silenced plants and control plants after 24 h of mixed salt-alkali treatment.

[0024] Figure 6 cotton GhERF2 Phenotypic analysis under salt and alkali stress after gene silencing; (A) Phenotypic diagram of silenced plants and control plants treated with salt and soda alkali for 24 hours, respectively; (B) Chlorophyll content of silenced plants and control plants treated with mixed salt and alkali for 24 hours; (C) Fresh weight of whole plants of silenced plants and control plants treated with mixed salt and alkali for 24 hours. DETAILED DESCRIPTION

[0025] The scheme of the present invention will be described in detail below with reference to the examples. The methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0026] Example 1 Transcriptome analysis of different parts of the root of upland cotton under mixed salt-alkali stress treatment, including: (A) using upland cotton seedling roots as samples for salt-alkali stress treatment, and performing transcriptome sequencing and analysis to obtain differentially expressed genes; (B) obtaining differentially expressed genes specifically in the root tip through Venn diagram; (C) combining KEGG analysis to finally screen out key genes GhERF2 .

[0027] Seed germination and seedling culture The cotton test material used was the genetic standard line TM-1 of upland cotton. The cotton experiment was carried out in a greenhouse with an average humidity of 45-50% and a light intensity of 14 h: 10 h at 28±0.5℃. The cotton seeds were soaked in 3% hydrogen peroxide for 30 min, surface disinfected, rinsed with deionized water, and soaked in tap water for 12 h. Select plump seeds of basically the same size and arrange them neatly on filter paper. Wet and fold the filter paper and place it obliquely in a plastic seedling box. Shade the seedling box containing the seeds, drip 20 ml of tap water every 2 days, and transfer the cotton seedlings to a hydroponic box containing 6L of modified Hoagland solution after 5 days for use.

[0028] Hoagland's complete nutrient solution (CK) consisted of 2.5 mM KNO3, 2.5 mM Ca(NO3)2, 1 mM MgSO4, 0.5 mM (NH4)H2PO4, 0.1 mM FeNa-EDTA, and trace elements (2 × 10 -4 mM CuSO4, 1×10 -3 mM ZnSO4, 2×10 -2 mM H3BO3, 5×10 -6 mM (NH4)6Mo7O 24 and 1×10 -3 mM MnSO4).

[0029] The hydroponic cotton seedlings obtained by the above-mentioned seedling method (2 days after being moved into the hydroponic box) were treated with compound saline-alkali for 30 minutes. After that, the root tips (root tip length was sampled based on 1 cm) and non-root tip parts of the cotton seedlings were sampled, and a total of three biological replicates were divided into each treatment group, each biological replicate included 20 seedlings. All samples were quickly frozen in liquid nitrogen and stored at -80°C for subsequent transcriptome sequencing. The composition of the compound saline-alkali solution was designed with reference to the ion composition of saline-alkali land in Alaer City, Tarim Region, Xinjiang, and the ion composition of saline-alkali soil was determined at Anyang Institute of Technology.

[0030] The composition of the complete composite saline-alkali solution is CaCl2 0.0970 mol / L, NaHCO3 0.0086 mol / L, Na2SO4 0.1411 mol / L, K2SO4 0.0097 mol / L, MgSO4 7H2O.0583 mol / L, and the final measured pH is 7.9.

[0031] In order to systematically understand the key signaling pathways of the root system of upland cotton TM-1 under combined saline-alkali stress and reveal the key genes that respond to saline-alkali stress, 12 cDNA libraries were constructed using RNA-seq sequencing technology. These cDNA libraries were from the root tips (RTS-1, RTS-2, RTS-3) of cotton seedlings treated with combined saline-alkali stress for 20 minutes; the non-root tips (NRTS-1, NRTS-2, RS-3) of cotton seedlings treated with combined saline-alkali stress for 20 minutes; seedlings treated with water for 20 minutes were used as control plants, and the root tips (RTCK-1, RTCK-2, RTCK-3) and non-root tips (NRTCK-1, NRTCK-2, NRTCK-3) were sampled using the same method (each treatment was divided into three biological replicates).

[0032] To reveal the differences in expressed genes between the control and treatment groups, we screened differentially expressed genes (NRTCK-NRTS and RTCK-RTS) at the same sampling sites of the control and treatment groups, and compared the two samples using the edgeR package in R version 4.4.0. A total of 9419 upregulated DEGs and 7957 downregulated DEGs were identified. Compared with the control group, the non-apical group had a total of 5702 and 4101 upregulated and downregulated DEGs with the corresponding control group; compared with the control group, 3717 and 3856 upregulated and downregulated DEGs were identified in the apical group ( Figure 1 A). We made a Venn diagram to analyze the overlap of DEGs in the roots of upland cotton seedlings treated with compound saline-alkali in different spaces; the results showed that 3939 genes were differentially expressed only in the root tip ( Figure 1 B).

[0033] In order to clarify the expression differences of genes related to pathways related to combined salt-alkali stress, we took the DEGs obtained only in cotton root tips as the main analysis objects, and obtained the three pathways with the highest enrichment through KEGG analysis, which were plant hormone signal transduction (ko04075), MAPK signaling pathway (ko04016), and cysteine ​​and methionine metabolites (ko00270) ( Figure 1 C). These pathways are preliminarily judged to be closely related to combined salt-alkali stress. Among them, we found a key differentially expressed gene GhERF2 ( GH_A08G1918), which is related to plant hormone signal transduction and MAPK signaling pathway.

[0034] Example 2 GhERF2 Analysis of gene sequence and expression pattern of the gene, including: (A) GhERF2 Gene conservation in G. hirsutum, G. barbata, G. raimondii, G. truncatum, D. durian, Theobroma cacao, Begonia trilobata, Umbelliferae, Hibiscus mutabilis, and Roselle AP2 / ERF Domain sequence alignment. (B) GhERF2 Analysis of gene expression patterns in different tissues and organs of cotton. (C) After saline-alkali stress treatment, GhERF2 Analysis of gene expression patterns.

[0035] Screened key genes GhERF2 (GH_A08G1918, ethylene-responsive transcription factor 2-like) AP2 / ERF Transcription factor superfamily ERF Subfamily members have been shown AP2 / ERF Some members of the transcription factor family can appropriately inhibit or weaken stress responses to maintain normal growth in the process of plant stress resistance. Abiotic stress can change the production and distribution of plant hormones, thereby regulating hormone signaling components and AP2 / ERF Family coping responses to stress. AP2 / ERF Transcription factors play an important role in various abiotic stresses. ERF The subfamily can bind to the ethylene response element GCC-box and participate in the regulation of ethylene response and abiotic stress response. GhERF2 The ORF of ERF of AP2 Characteristic sequences, identified through the MEME website (https: / / meme-suite.org / ) GhERF2 The potential conserved motifs in gene protein sequences were shown GhERF2 With other species ERF2 The amino acid sequences of the genes have a high degree of homology ( Figure 2 A).

[0036] Given that GhERF2 It was identified from the root tips of cotton seedlings under saline-alkali stress. GhERF2 Tissue-specific expression in cotton variety TM-1, including roots, stems, flowers and leaves ( Figure 2 B). We can intuitively see GhERF2 It is highly expressed in the stems and ovules of cotton, and also has a relatively considerable expression level in the roots of cotton.

[0037] qRT-PCR was used to detect the expression of β-catenin in cotton at different time periods (0h, 1h, 3h, 6h, 12h, 24h, 48h, and 72h) after salt-alkali stress treatment. GhERF2 The changes in expression ( Figure 2 C). It can be seen that salt-alkali stress can strongly induce the expression of GhERF2. It is worth noting that after 3 hours of salt-alkali stress, the root of cotton GhERF2 The expression level increased by 6 times and reached the highest level at 24 hours, and then decreased to a certain extent after 24 hours.

[0038] Example 3 cotton GhERF2 Analysis of gene protein structure and function, including: (A) GhERF2 Schematic diagram of gene structure. (B) GhERF2 Analysis of gene protein secondary structure. (C) GhERF2 Analysis of the hydrophilicity of gene proteins. (D) GhERF2Schematic diagram of the tertiary structure of gene protein.

[0039] The genome annotation file of upland cotton was used to draw the GhERF2 Gene structure, it was found that the gene does not have an intron structure ( Figure 3 A). The structure and function of proteins are closely related. GhERF2 The protein structure of the gene was analyzed and the results showed that its secondary structure was mainly composed of α-helix, β-fold and random coil ( Figure 3 B), and the proportion of hydrophilic proteins is relatively large, which belongs to hydrophilic proteins ( Figure 3 C), the tertiary structure was predicted by an online website (SWISS: https: / / swissmodel.expasy.org / ), and the results were consistent with the secondary structure ( Figure 3 D).

[0040] Example 4 TRV2-GhERF2 Construction of gene silencing recombinant plasmid vector.

[0041] RNA was extracted using the Total RNA Preparation Pure Plant Kit (Tiangen, Beijing, China). RNA quality was assessed by 1% agarose gel electrophoresis to check for degradation or contamination, and RNA integrity was assessed using the Nano 6000 Detection Kit on the Bioanalyzer 2100 System (Agilent Technologies, USA). cDNA synthesis was performed using FastfastKing One-Step Genomic cDNA First-Strand Synthesis Premix (Tiangen, China). Using the above cDNA as a template, the designed GhERF2Gene-specific primers (forward primer: ATGGAGATGTATCCGAGTAGCA; reverse primer: TTAACTGAATAACACTTGATTGTCATGTG) were used for PCR amplification using high-fidelity DNA polymerase. The specific amplification system was as follows: 2×Phanta Max Buffer 25μL, dNTP Mix (10mM each) 1μL, upstream and downstream primers 2μL each, cDNA template 2μL, Phanta Max Super-Fidelity DNA Polymease (1U / μL) 1μL, ddH2 O supplemented to 50μL. The PCR reaction program was: 95℃, 30s; 95℃, 15s, 56℃ annealing 15s, 72℃ extension 1min, 35 cycles; finally 72℃ extension 5min, 4℃ storage. The target fragment after electrophoresis was recovered using a DNA gel recovery kit. The operating steps refer to its instructions. The recovered product was detected by 1% agarose gel electrophoresis ( Figure 4 A). Recover the target band by agarose gel electrophoresis to obtain the full length of the target gene. GhERF2 The specific primers for the gene silencing fragment (forward primer: CTCCAAGGCTTTGTTGAATTTTC; reverse primer: TAACACTTGATTGTCATGTGTACAC) were used to amplify the full-length target gene using a high-fidelity DNA polymerase. The product was then recovered and detected by 1% agarose gel electrophoresis ( Figure 4 B).

[0042] Double digestion with EcoRI and BamHI TRV2 vector, through homologous recombination GhERF2 The specific silencing fragment of the gene is connected to the enzyme-cut TRV2 On the carrier ( Figure 4 C) and subsequently transformed into Escherichia coli DH5α The positive strains were detected and sequenced, and the positive strains with consistent sequencing results were transformed into Agrobacterium GV3101.

[0043] Example 5 cotton GhERF2 Phenotypic analysis under mixed salt-alkali stress treatment after gene silencing.

[0044] Conversion GhERF2Gene silenced plants. The genetic standard line TM-1 of upland cotton was used as the experimental material, and the susceptible variety Hebei cotton 11 was used as the control material. After seed germination, the cotton seedlings were transferred to a hydroponic box containing 6L of improved Hoagland solution for growth. The seed germination conditions and the preparation method of Hoagland solution were the same as above, and the growth conditions were 28℃ / 16h / light, 25℃ / 8h / dark. When all the cotyledons of the plants were flattened, the injection was performed. The constructed TRV2 : GhERF2 Agrobacterium was activated to TRV2:00 As a negative control, TRV2:PDS As a positive control, the bacterial solution was injected from the back of the cotyledon using a 1 mL syringe to fill the entire cotyledon, and then placed in the dark for 24 hours before being transferred to normal growth conditions for cultivation.

[0045] VIGS-PDS Two weeks after Agrobacterium infection, the plants showed a more obvious albinism phenotype, which indicated that VIGS began to be effective ( Figure 5 A). Then, leaves were taken for qRT-PCR detection to determine the silencing efficiency. TRV : GhERF2 In plant roots GhERF2 The expression level of TRV : 00 The plant growth rate was reduced by 60%, which clearly showed GhERF2 Silence is effective Figure 5 C). After successful silencing, plants with basically the same growth were selected for combined salt-alkali stress treatment and used for the next step of the experiment.

[0046] After 48 hours of combined salt-alkali stress, both WT and TRV:GhERF2 still TRV:00 The leaves of the seedlings all showed varying degrees of wilting. TRV:GhERF2 The wilting state of cotton seedlings in the treatment group was more significant than that in the other treatment groups ( Figure 5 B), while WT and TRV:00 The wilting degree between the two groups was similar. The fresh weight and other biomass indicators of all treatment groups were tested.

[0047] Take about 0.01g of cotton leaves, cut them into thin strips, add 95% ethanol, place them in a 50℃ water bath in a dark place for 4-5h to fully dissolve the chlorophyll, then draw 200 μL of solution from it, measure its absorbance at 649 nm and 665 nm, and use 95% ethanol as a blank control for calibration, and calculate the chlorophyll content of the sample. Calculation formula: Content of Chlorophyll (mg / g)=0.003[(13.95A665-6.88A649)+(24.96A649-7.32A665)] / sample fresh weight The results showed that under saline-alkali stress, TRV:GhERF2 and TRV:00 There were significant differences in the fresh weight of the whole plant (*, *, and *** indicate significant differences at the 0.05, 0.01, and 0.001 levels, and these experiments were set up with at least three biological replicates), as shown in the following: TRV:GhERF2 The fresh weight of the plants after 48 hours of combined salt-alkali stress treatment was significantly lower than that of TRV:00 plants ( Figure 5 D). After testing the chlorophyll content, it was found that TRV:GhERF2 Plants compared to TRV:00 The chlorophyll content of the plants decreased significantly after saline-alkali stress treatment, but there was no significant difference between TRV:00 plants and WT ( Figure 5 E).

[0048] Since salt stress can cause oxidative stress and damage to plants, we further evaluated the resistance of TRV:GhERF2 plants to salt-alkali stress by using superoxide dismutase (SOD) and malondialdehyde (MDA) content, which are physiological indicators closely related to salt-alkali stress. Water treatment was used as a blank control.

[0049] The results showed that under saline-alkali stress, TRV:GhERF2 The SOD activity of the plants was significantly higher than that of the TRV:00 plants ( Figure 5 F). Relative to TRV : 00 Plants, TRV : GhERF2 The MDA content in the plants increased significantly ( Figure 5 G). These results further demonstrate that silencing GhERF2 It will reduce the ROS scavenging ability of cotton seedlings, aggravate the degree of oxidative stress of the plants when facing stress, and thus make cotton sensitive to saline-alkali stress.

[0050] 3,3-Diaminobenzidine (DAB) staining was used to detect hydrogen peroxide levels to further explore GhERF2 Effect of silencing on salt-alkali tolerance of cotton plants. Three plants with basically the same growth were randomly selected from each treatment group as biological replicates. DAB staining experiments used the DAB colorimetric kit (Solarbio, Beijing, China, DA1016) and prepared the working solution according to the instructions. Put the cotton leaves of the control group and the treatment group into a culture dish, add the working solution to ensure that the leaves are completely covered, and TRV : GhERF2 and TRV : 00 The plants were stained with the above DAB staining solution for 12 hours in the dark, the staining solution was poured out, 95% ethanol was added, and the leaves were boiled in a boiling water bath until they were decolorized, and then photographed and observed. The leaves of plants treated with salt, alkali, and saline-alkali were used as the experimental group, and the stained leaves of plants treated with the same amount of water were used as the control group. TRV : 00 Compared with plants, TRV : GhERF2 The level of hydrogen peroxide in the leaves of the plants increased significantly ( Figure 5 H). In plants, the ability to remove reactive oxygen species (ROS) is negatively correlated with the content of hydrogen peroxide. Therefore, our research results show that GhERF2 The ability of silenced plants to scavenge ROS was reduced.

[0051] Example 6 cotton GhERF2 Phenotypic analysis under salt and alkaline stress after gene silencing, including: (A) Phenotypic diagram of silenced plants and control plants treated with salt and soda for 24 hours, respectively. (B) Chlorophyll content of silenced plants and control plants treated with mixed salt and alkaline for 24 hours. (C) Fresh weight of whole plants of silenced plants and control plants treated with mixed salt and alkaline for 24 hours.

[0052] Use 200 mM NaCl and 150 mM NaHCO 3 、Na 2 CO 3 (molar ratio NaHCO 3 :Na 2 CO 3 =2:1) ​​for WT, TRV : 00 as well as TRV : GhERF2 The plants were treated to observe TRV : GhERF2 Phenotypic conditions of the plants.

[0053] The results are similar to those of the saline-alkali stress test. TRV : GhERF2 When the plants were exposed to salt stress or alkali stress alone, they showed TRV : 00 More severe wilting of plants ( Figure 6 A), and chlorophyll content ( Figure 6 B) and the whole plant fresh weight ( Figure 6 C) Relative to TRV : 00 The plants also showed varying degrees of decline.

[0054] The present invention successfully screened a key gene through transcriptome analysis GhERF2 . Analyzing cotton GhERF2 Gene sequence structure and expression pattern were found to be different after being exposed to salt-alkali stress. GhERF2 The expression level in the root was significantly upregulated, and its protein sequence was identified to contain similarities with other species. ERF2 Conserved motifs in genes that are close to each other are down-regulated or silenced in cotton GhERF2 Gene, significantly enhanced the sensitivity of upland cotton TM-1 to saline-alkali stress. GhERF2 Genetically modified cotton materials, introduce the target gene into the currently widely planted upland cotton promotion varieties, and create new high-quality upland cotton strains with high stress resistance. GhERF2 Genes are introduced into other plants to obtain new strains of transgenic plants with stress resistance.

[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A kind of cotton GhERF2 A gene characterized by The amino acid sequence encoded by it is shown in SEQ ID NO:

2.

2. The cotton according to claim 1 GhERF2 A gene characterized by Its nucleotide sequence is shown in SEQ ID NO:

1.

3. Cotton as claimed in claim 1 or 2 GhERF2 Application of genes in improving plant resistance to salt or alkaline stress.

4. The use according to claim 3, characterized in that: The plant is cotton.

5. The gene according to claim 1 or 2, characterized in that Combined with the transcriptome analysis of cotton roots under salinity-alkali stress, differentially expressed genes related to plant salt-alkali resistance were screened GhERF2.

6. The use according to claim 4, characterized in that: By overexpressing the GhERF2 Genes to improve cotton's resistance to combined saline-alkali stress.

7. The use according to claim 3, characterized in that: Containing the cotton GhERF2 A method for constructing a recombinant vector, expression cassette or recombinant bacteria of a gene.

Images