Construction method and application of multiple amplicon library

Abstract

The invention discloses a construction method and application of a multiple amplicon library. The method comprises the following steps: firstly, determining a target sequence to be detected, designing and synthesizing forward and reverse specific amplification primers of the target sequence, then respectively preparing multiple forward and reverse mixed primers, carrying out breaking, terminal repairing and adenine A adding on sample DNA, then carrying out linker connection, and finally, detecting the target sequence. The method comprises the following steps: amplifying a target fragment by using a biotin-modified universal amplification primer and a multiple forward mixed primer, purifying by using streptavidin magnetic beads, and amplifying by using a universal amplification primer and a multiple reverse mixed primer at the other end to form an amplicon library. The method is easy and convenient to operate, mutual interference among multiple primers can be effectively avoided, amplification errors or sequencing errors of amplicons are calibrated through UMI, the detection sensitivity of ultralow-frequency mutation is improved, the number of the multiple primers is not limited, and the method has great application advantages on enrichment of continuous target areas.

Description

Technical Field

[0001] The invention belongs to the technical field of high-throughput gene sequencing, and specifically relates to a construction method of a multiplex amplicon library and an application thereof. Background Art

[0002] High-throughput sequencing technology has occupied an increasing market share in the field of tumor, genetic disease and pathogenic microorganism detection due to its advantages in throughput, cost and efficiency. As the detection market continues to sink, targeted sequencing technology in high-throughput sequencing is highly welcomed by the detection market because of its deeper coverage, higher data accuracy and lower detection cost. The method of amplicon library construction in targeted sequencing is to use specific primers to amplify the target DNA region to form a highly enriched DNA library, introduce the adapter sequence required for sequencing on both sides of the DNA molecule, and then sequence the complete amplicon library. This method has the advantages of low cost, high sequencing depth and short cycle, so it is more suitable for clinical detection applications.

[0003] Compared with ordinary amplicon technology, multiplex amplicon technology has an increasingly high status due to its advantages such as low cost and wide coverage, but it also has certain technical difficulties. The most critical problem is that in multiplex amplification, as the number of target regions increases, the proportion of primers in the same reaction system also increases. When there are a high number of primers and ultra-high primer concentrations in the reaction system, the amplification background will increase, aggravating the non-specific amplification of the target region, interference between primers and primer dimers, resulting in the coexistence of non-specific fragments of various sizes. Conventional purification methods cannot remove non-specific sequences that are similar in size to the target fragments. Finally, after multiple rounds of amplification, a large number of non-target libraries are introduced, which not only increases the sequencing cost, but also interferes with the accurate interpretation of low-frequency mutations, and significantly increases the false positive rate. Therefore, it is necessary to design an effective multiplex amplicon library construction method, which can reduce the proportion of primers in the amplification system and the background of amplification substrates on the one hand, and accurately eliminate non-specific interference and primer dimer residues in the library pool on the other hand, so that the library rich in mutation information can be retained. In addition, it is combined with scientific bioinformatics process analysis to achieve accurate interpretation of low-frequency mutations.

[0004] In summary, there is an urgent need to provide a multiplex amplicon library construction method that can significantly reduce the non-specific fragments and primer dimers that appear in multiple amplification and has a simple operation process, so as to realize the detection of ultra-low frequency mutations. Summary of the invention

[0005] The object of the present invention is to provide a method for constructing a multiple amplicon library with simple operation and low cost and its application.

[0006] Based on the above purpose, the present invention adopts the following technical solutions:

[0007] A method for constructing a multiplex amplicon library comprises the following steps: (1) determining a target sequence to be detected and extracting genomic DNA of a sample to be detected; (2) synthesizing forward and reverse specific amplification primers of the target sequence, firstly designing corresponding specific primer sequences according to the site information and / or fusion position of the target genome through a multiplex primer design process, and adding a UMI sequence and a bridge sequence at the 5' end thereof to obtain forward and reverse specific amplification primer sequences;

[0008] (3) Mix the forward specific amplification primers obtained in step (2) and add a buffer solution to dilute them to obtain multiple forward mixed primers; mix the reverse specific amplification primers obtained in step (2) and add a buffer solution to dilute them to obtain multiple reverse mixed primers; the temperature difference of the melting temperature of the multiple forward specific primers is ≤5°C, and the temperature difference of the melting temperature of the multiple reverse specific primers is ≤5°C. The amplicon length interval of the multiple forward and reverse specific primers is 150-400bp, preferably 200-300bp; the interval of the primers in the same direction in the continuous region is 50-120bp, preferably 80-100bp.

[0009] (4) fragmenting the genomic DNA of the sample to be tested, and then performing end repair and adding adenine A;

[0010] (5) using a ligase to connect the fragmented, end-repaired and adenine A-added DNA fragment in step (4) to the anchor primer, the reaction time of the connection is 10 to 30 minutes, and DNA purification magnetic beads are added to purify the connection mixture to obtain a purified connection product;

[0011] (6) using the ligation product purified in step (5) as a template to perform a first round of multiplex PCR amplification, and then using streptavidin magnetic beads to purify the product to obtain a first round of amplification products, and then adding streptavidin magnetic beads to resuspend and mix, using streptavidin magnetic beads to retrieve the target fragment containing biotin in the first round of amplification products, and purifying non-specific products, free primers and various impurities at the same time, the streptavidin magnetic beads retrieval time is 15-30 minutes, and a highly enriched target area magnetic bead resuspended mixture is obtained;

[0012] (7) The second round of multiplex PCR amplification is performed using the magnetic bead resuspended mixture as a template, and the streptavidin magnetic beads are removed to finally obtain the second round of amplification products. The target fragments are then enriched by adding label primers and purified, quantified, and sequenced.

[0013] Furthermore, the first round amplification system used in the multiple amplification in step (6) is composed of the purified adapter ligation product, DNA amplification enzyme premix, universal primer, and multiple forward primer mixture. The molar ratio of the universal primer to the multiple forward primer mixture is (1-3):1, preferably 2:1.

[0014] Furthermore, the second round amplification system used in the multiple amplification in step (7) is composed of the magnetic bead resuspension mixture in step (6), the DNA amplification enzyme premix, the label primer, and the multiple reverse primer mixture. The molar ratio of the label primer to the multiple reverse primer mixture is (1-3):1, preferably 2:1.

[0015] Furthermore, the UMI sequence added by the forward specific amplification primer is at its 5' end, consisting of 6 to 12 random bases, and the bridge sequence is at the 5' end of the UMI sequence, which is a 16 to 35 bp sequence at the 3' end of the sequencing adapter sequence 1; the UMI sequence added by the reverse specific amplification primer is at its 5' end, consisting of 6 to 12 random bases, and the bridge sequence is at the 5' end of the UMI sequence, which is the full-length sequence of the sequencing adapter sequence 2, including the index sequence; the sequencing adapter sequence is a sequencing adapter sequence corresponding to the Illumina sequencing platform or the MGI sequencing platform.

[0016] Furthermore, in step (5), the anchor primers are linker sequences of unequal lengths, the complementary sequences of the linker sequences of unequal lengths are 16-24 bp, and the oligonucleotide sequence at the longest end is 24-32 bp.

[0017] Further, the tag primer is a linker sequence, the linker sequence is an unequal length structure, the 5' end of the long end of the unequal length linker sequence is a 24 bp sequence, the 5'-3' direction sequence is CTACAGTGCCGCAATAGATCCATC, the 5' end is biotin modified, and HPLC is selected for primer synthesis and purification;

[0018] Furthermore, the universal primer contains the full-length sequence of the sequencing adapter sequence 1 of the index sequence, and HPLC is selected as the primer synthesis and purification method.

[0019] Furthermore, the genomic DNA of the sample to be tested includes any one of gDNA or cfDNA.

[0020] A method for constructing a multiplex amplicon library is used to detect a multiplex primer combination for acute myeloid leukemia, wherein the nucleic acid sequences of the forward and reverse specific primers are shown in SEQ ID NO.1-SEQ ID NO.116, and the nucleic acid sequences of the tag primers are shown in SEQ ID NO.117-SEQ ID NO.128.

[0021] Application of any one of the above methods for constructing a multiplex amplicon library in the detection of gene mutations and fusions in acute myeloid leukemia.

[0022] The present invention uses a biotin-modified universal amplification primer and a single-end specific primer with a molecular tag UMI to amplify the target fragment, and uses streptavidin magnetic beads for purification, and then uses the other end universal amplification primer and the other end specific primer with a molecular tag UMI to further amplify the target fragment and form a library. The present invention uses an amplicon library construction method to detect gene variation, and uses UMI to calibrate amplification errors or sequencing errors for amplicons to improve the detection sensitivity for ultra-low frequency mutations. The method is simple to operate, low in cost, and suitable for a variety of amplicon library construction application scenarios. The multiple amplicon library construction method provided by the present invention uses UMI connectors to label the original molecules, which can effectively filter errors introduced by PCR and sequencing; the present invention uses forward specific mixed primers and reverse specific mixed primers for step-by-step amplification to reduce interference between specific primers, which can reduce the difficulty of primer design, and has good adaptability to super-multiple primer design and complex template regions, with wider adaptability and easier application;

[0023] The present invention adopts streptavidin magnetic beads for purification of specific products, which can greatly reduce the occurrence of non-specific fragments and primer dimers in the purified products, improve the enrichment effect of the target area, and effectively improve the detection rate of low-frequency detection; the multiple amplicon library construction method provided by the present invention can stably detect mutations as low as 0.05%, which greatly improves the sensitivity compared with the 0.5% to 1% sensitivity of conventional targeted capture sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The forward specific amplification primer and the reverse specific amplification primer sequences in Example 1 of the present invention;

[0025] Figure 2 This is a flow chart of constructing a Chinese library in Example 1 of the present invention;

[0026] Figure 3 is the gene sequence of the label primer in Example 1 of the present invention;

[0027] Figure 4 This is the quality inspection diagram of the amplicon library of Example 1 of the present invention;

[0028] Figure 5 is the read sequence map of the mutation site of sample 1;

[0029] Figure 6 is the read sequence map of the mutation site of sample 3;

[0030] Figure 7 This is the read sequence map of the fusion gene of sample 4;

[0031] Figure 8 This is the read sequence map of the mutation site of sample 8; DETAILED DESCRIPTION

[0032] Embodiment 1:

[0033] Experimental materials: Standard products were purchased from Jingliang, and the trade name is myeloid hematology tumor gDNA standard (catalog number: GW-OYC001);

[0034] The nucleic acid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the trade name is Blood Genomic DNA Extraction Kit (Cat. No. DP348);

[0035] Qubit quantitative reagent was purchased from Invitrogen under the trade name Qubit TM 1X dsDNA High Sensitivity (HS) Quantitation Kit (Cat. No. Q33230);

[0036] Universal primers, specific primers, tag primers, and unequal-length linker sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0037] Fragmentation and end repair plus A system reagents were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., with the trade name TIANSeq Rapid DNA Fragmentation / End Repair / dA Addition Module (Cat. No.: NG301);

[0038] Ligase system reagents were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., with the trade name TIANSeq Rapid Ligation Module (Cat. No.: NG303);

[0039] DNA purification magnetic beads were purchased from Beckman Coulter Co., Ltd., with the trade name BeckmanAMPure XPbeads (Cat. No. A63882);

[0040] Streptavidin magnetic beads were purchased from Invitrogen under the trade name Dynabeads TM M-270 Streptavidin (Cat. No. 65305);

[0041] Multiplex amplification enzyme premix was purchased from Thermo Fisher Scientific (China) Co., Ltd. under the trade name Platinum TMSuperFi II PCR Master Mix (Cat. No. 12368010);

[0042] The tag amplification premix was purchased from Shanghai Roche Pharmaceuticals Co., Ltd. under the trade name KAPA HiFi HotStartReadyMix High-Fidelity DNA Polymerase Premix (Cat. No. KK2602);

[0043] Experimental steps:

[0044] 1. Preparation of genomic DNA of samples to be tested

[0045] 1.1 Genomic DNA (gDNA) extraction

[0046] The gDNA of healthy human whole blood samples was extracted according to the instructions of the nucleic acid extraction kit, and the extracted gDNA of whole blood samples was quantified by Qubit4.0 fluorescence quantification instrument and subjected to NanoDrop purity quality control. After quality control, it was marked as GW-0 and stored at -20°C.

[0047] 1.2 Sample preparation to dilute gene mutation sites to target mutation frequency level

[0048] GW-0 was mixed with the myeloid hematologic malignancy gDNA standard GW-OYC001 purchased from Xiang Jingliang at a mass ratio of 9:1, and labeled as GW-1 (expected frequency 0.5%); GW-0 and GW-1 were then mixed at a mass ratio of 9:1, labeled as GW-2 (expected frequency 0.05%), and stored at -20°C.

[0049] 1.3 Determine the target sequence to be detected

[0050] The target sequence is a sequence corresponding to a gene mutation and fusion that is frequently reported in patients with acute myeloid leukemia, including a mutation site verified in a myeloid hematologic malignancy gDNA standard. The sample to be tested is a DNA sample in which the corresponding variant site is diluted to the target mutation frequency level in step 1.2.

[0051] 2. Synthesis of forward and reverse specific amplification primers

[0052] 2.1 Synthesis of forward specific amplification primers: According to the mutation and fusion information determined in step 1.3, a forward specific primer was designed through the multiple primer design process, and a UMI sequence and a bridge sequence were added to the 5' end of the primer. The bridge sequence was the 3' end 33 bp sequence of the sequencing adapter sequence 1 corresponding to the Illumina sequencing platform. The forward specific amplification primer sequence was synthesized and HPLC purification was selected for purification. Figure 1 ;

[0053] 2.2 Synthesis of reverse specific amplification primers: According to the mutation and fusion information determined in step 1.3, a reverse specific primer is designed through the multiple primer design process, and a UMI sequence and a bridge sequence are added to the 5' end. The bridge sequence is the full-length sequence of the sequencing adapter sequence 2 corresponding to the Illumina sequencing platform, including the index sequence. The primer synthesis purification method is HPLC purification. The reverse specific amplification primer sequence is shown in Figure 1 .

[0054] 3. Preparation of multiple forward and reverse mixed primers

[0055] 3.1 Preparation of multiple forward primer mixtures: After centrifuging the synthesized forward specific amplification primer powders at each site at 12000rpm for 10 minutes, slowly add 1×TE buffer solution along the tube wall according to the volume of the dilution solution marked on the tube wall to dilute it into 100μM forward specific primer dilution solution, place it on a vortex shaker to mix it thoroughly, and let it stand for use;

[0056] 3.2 Call the single-stranded DNA mode of NanoDrop, adjust the zero value to within ±0.3 with buffer, take 1.8ul of forward specific amplification primer dilution to measure the concentration, obtain the A260 value of each primer, obtain the nmol / OD value of each primer from the CoA report of the forward specific primer, calculate the precise molar concentration of the corresponding primer according to the formula (actual molar concentration (umol / L) = A260 value x (nmol / OD)), take the corresponding volume of primer and dilute it to 50uM with buffer, mix it in a 1:1 ratio, place it on a vortex shaker to mix thoroughly, mark it as multiple forward mixed primer master solution, and let it stand for use;

[0057] Dilute the multiple forward mixed primer master solution in the previous step to 10 μM with 1×TE buffer solution, mark it as multiple forward mixed primer working solution, and set it aside for later use;

[0058] 3.3 Preparation of multiple reverse mixed primers: After centrifuging the synthesized reverse specific amplification primer powders at each site at 12000rpm for 10 minutes, slowly add buffer solution along the tube wall according to the volume of the dilution solution marked on the tube wall to dilute into 100μM reverse mixed primer dilution solution, place on a vortex shaker to mix thoroughly, and let stand for use;

[0059] Call the NanoDrop single-stranded DNA mode, adjust the zero to within ±0.3 with buffer, take 1.8ul of reverse mixed primer dilution to measure the concentration, obtain the A260 value of each primer, obtain the nmol / OD value of each primer from the primer CoA report, calculate the precise molar concentration of the corresponding primer according to the formula (actual molar concentration (umol / L) = A260 value x (nmol / OD)), take the corresponding volume of primer and dilute it to 50uM with buffer, mix it in a 1:1 ratio, place it on a vortex shaker to mix it thoroughly, mark it as multiple reverse mixed primer master solution, and let it stand for use;

[0060] Dilute the multiple reverse mixed primer master solution in the previous step to 10 μM with 1×TE buffer solution, mark it as multiple reverse mixed primer working solution, and set it aside for later use;

[0061] 4. Perform end repair and add adenine A to the genome sequence of the sample to be tested

[0062] 4.1 Take 200 ng of GW-0, GW-1, and GW-2 respectively, add nuclease-free water to make up to 35 μL according to their respective volumes, and obtain DNA sample 1 (GW-0), DNA sample 2 (GW-1), and DNA sample 3 (GW-2).

[0063] Melt the reagents on ice according to Table 1 below and prepare the fragmentation and unmodified A enzymatic system, keep it on ice, mix it with DNA sample 1, DNA sample 2, and DNA sample 3 in a PCR tube to make a 50ul total system, vortex and mix, centrifuge briefly, and centrifuge the fragmentation (fragment length 300-400bp) and unmodified A reaction mixture to the bottom of the PCR tube;

[0064] Table 1

[0065] Enzymatic system reagents Volume(ul) DNA samples 35 Reaction buffer 5 Fragmentation and end-repair with enzyme A 10 Total volume 50

[0066] 5. Preparation of ligation products

[0067] 5.1 Place the PCR tube containing the centrifuged fragments and the final trimer plus A reaction mixture in step 4.1 into the preheated thermal amplification instrument, heat the thermal cover of the thermal amplification instrument to 70°C, run the program according to Table 2, and immediately proceed to the next step of adapter ligation reaction after the reaction is completed;

[0068] Table 2

[0069] temperature Duration 4℃ 1 minute 32℃ 10 minutes 65℃ 30 minutes 4℃ Keep

[0070] 5.2 Adapter ligation reaction: melt the reagents on ice and prepare the ligation reaction system according to Table 3 below, keep it on ice, mix the prepared ligation reaction system in the PCR tube with 50ul of fragmentation and final trimming plus A reaction mixture to make 100ul of adapter ligation system, vortex and mix, centrifuge instantaneously, and obtain the adapter ligation system of sample 1, sample 2, and sample 3;

[0071] Table 3

[0072] Adapter Ligation System Reagents Volume(ul) The mixed solution after fragmentation and final addition of A 50 Unequal length linker sequences 5 Ligase buffer 20 DNA ligase 10 Nuclease-free water 15 Total volume 100

[0073] Among them, the complementary sequence of the unequal length linker sequence in Table 3 above is 16-24 bp, and the oligonucleotide sequence at the longest end is 24-32 bp.

[0074] Place the PCR tube containing the adapter ligation system in the preheated amplification instrument, close the thermal cover of the amplification instrument, run the program according to Table 4, and immediately purify the adapter ligation product after the reaction is completed;

[0075] Table 4

[0076] temperature Duration 4℃ 1 minute 20℃ 15 minutes 4℃ Keep

[0077] 5.3 Purification of ligation product: Take out the DNA purification magnetic beads from the 4℃ refrigerator in advance and place them at 25℃ for 30 minutes; shake the purified magnetic beads until they are fully resuspended, take 80μL of DNA purification magnetic beads and add them to the above 0.2mL PCR tube containing the amplified adapter ligation product, then use a pipette to gently blow and repeatedly 10 times to mix it thoroughly, and incubate at 25℃ for 5 minutes; then put the PCR tube on the magnetic rack and let it stand for 3 minutes, move it to a centrifuge tube, wait for the solution to clarify, centrifuge and discard the supernatant, retaining the magnetic beads; keep the centrifuge tube on the magnetic rack, add 200μL of freshly prepared 80% ethanol, let it stand for 30 seconds, then discard the supernatant and keep the magnetic beads; repeat the above steps once, use a small gun tip to discard the remaining ethanol in the centrifuge tube as much as possible, place it on a magnetic rack and let it stand for 5-10 minutes until the magnetic beads are dry, add 22μL of nuclease-free water, vortex to mix, centrifuge briefly, and incubate at 25℃ for 5 minutes; place the centrifuge tube on the magnetic rack for 3 minutes to wait for the solution to clarify; carefully pipette 20μL of supernatant into a new PCR tube, discard the DNA purification magnetic beads, and obtain the purified DNA sample 1, DNA sample 2, and DNA sample 3 connector connection products.

[0078] 6. The first round of specific multiplex amplification:

[0079] 6.1 Melt the reagents on ice and prepare the first round of multiple amplification reaction system according to Table 5 below, keep it on ice, mix it with 20ul of purified adapter ligation product in a PCR tube to make 50ul of the first round amplification system, vortex and mix, and centrifuge it instantaneously;

[0080] Table 5

[0081] First round amplification system reagents Volume(ul) Purified adapter ligation product 20 DNA Amplification Enzyme Master Mix 25 Universal primer 2 Multiplex forward primer mix 3 Total volume 50

[0082] Place the PCR tube containing the first round amplification system in a preheated amplification instrument, set the thermal cover of the amplification instrument to 105°C, and run the program according to Table 6. Immediately after the reaction, use streptavidin magnetic beads to purify the product to obtain the first round amplification product;

[0083] Table 6

[0084]

[0085] 6.2 Wash the streptavidin magnetic beads again, dilute Binding and washing (B&W) Buffer (2X) to 1X (B&W) Buffer with ddH2O; take out the streptavidin magnetic beads from the 4℃ refrigerator in advance, put them at 25℃ for equilibration for 30 minutes, vortex and shake the M270 magnetic beads for more than 30 seconds to fully suspend them; take 100ul of streptavidin magnetic beads to a new 1.5ml centrifuge tube, add 100ul of 1X (B&W) Buffer, blow 10 times to resuspend and mix the M270 magnetic beads, place it on the magnetic rack for 1min, and discard the supernatant after the solution is clear; take out the centrifuge tube from the magnetic rack, add 100ul of 1X (B&W) Buffer to resuspend the M270 magnetic beads, and then place it on the magnetic rack for 1min. After the solution is clear, discard the supernatant, repeat the above steps, and wash 3 times in total.

[0086] 6.3 Add 200ul 2X (B&W) Buffer to the above tube to resuspend the washed streptavidin magnetic beads, use ddH2O to expand the volume of the first round of amplification product to 200ul, then add it to the streptavidin magnetic beads and mix well to obtain a total volume of 400ul streptavidin magnetic bead mixture, place the centrifuge tube containing the mixture in a constant temperature oscillator, gently rotate and incubate at room temperature for 30 minutes; after the incubation is completed, place it on a magnetic stand for 2-3 minutes, and discard the supernatant after the solution is clarified;

[0087] 6.4 Wash the streptavidin magnetic beads three times with 100ul 1X B&W Buffer, then resuspend and mix with 20ul ddH2O to obtain a highly enriched target region magnetic bead resuspended mixture;

[0088] 7. Second round of multiplex amplification

[0089] 7.1 Perform a second round of multiple specific amplification on the magnetic bead resuspended mixture in the previous step. On the one hand, use the tag primer to amplify the introduction of the sequencing adapter sequence and the library tag (index sequence), and on the other hand, use the reverse specific primer to enrich the target fragment. According to Table 7 below, melt the reagents on ice and prepare the second round of multiple amplification reaction system, keep it on ice, mix it with 20ul of the magnetic bead resuspended product in a PCR tube to form 50ul of the second round amplification system, vortex and oscillate to mix, and centrifuge it instantaneously;

[0090] Table 7

[0091] Second round amplification system reagents Volume(ul) Magnetic bead resuspension mixture 20 DNA Amplification Enzyme Master Mix 25 Index primer 2 Multiplex reverse primer mix working solution 3 Total volume 50

[0092] Wherein, the tag primer comprises the full-length sequence of the sequencing adapter sequence 1 of the index sequence, HPLC is selected as the primer synthesis and purification method, and the tag primer sequence is shown in the figure in the content of the present invention.

[0093] Place the PCR tube containing the second round amplification system in a preheated thermal cycler with the thermal cover at 105°C and run the program according to Table 8;

[0094] Table 8

[0095]

[0096] 7.2 Library purification: Take out the DNA purification magnetic beads from the 4℃ refrigerator in advance and place them at 25℃ for 30 minutes; shake the purified magnetic beads until they are fully resuspended, take 50μL and add it to the 0.2mL PCR tube of the second round amplification product, then use a pipette to gently blow and repeatedly 10 times to mix it thoroughly, incubate at 25℃ for 5 minutes, and then place it on the magnetic stand for 2-5 minutes. After the solution is clear, discard the supernatant, retain the magnetic beads, keep them on the magnetic stand, and add 200μ 1 L of newly prepared 80% ethanol, let it stand for 30 seconds, then discard the supernatant and keep the magnetic beads; repeat the above steps once; remove the residual ethanol as much as possible, place it on the magnetic stand and let it stand for 5 minutes until the magnetic beads are completely dry, then add 33μL of nuclease-free water, vortex to mix, centrifuge briefly, and incubate at 25℃ for 5 minutes; place it on the magnetic stand for 2-5 minutes to wait for the solution to clarify; carefully pipette 30μL of supernatant into a new 1.5mL centrifuge tube, discard the magnetic beads, and obtain the final capture library. The library was tested for library fragments using the Qsep 100 instrument, and the quality inspection results are as follows Figure 4 As shown by Figure 4 It can be seen that there is no primer dimer residue in the library, and the main peak of the library is 381 bp, ranging from 300-400 bp, which is consistent with the expected library fragment size.

[0097] 7.3 The above library was sequenced on the machine, and 2×150bp double-end sequencing was performed on the machine. The sequencing amount of each sample was 2Gb. The obtained double-end sequencing reads were first merged according to the overlap, and then compared with the reference genome position in the database. The number of supporting reads of the real mutation in the sequencing data was obtained by calibrating the sequencing error through UMI. The results are shown in Table 9;

[0098] Table 9

[0099]

[0100] As shown in Table 9, the multiple amplicon library construction process of the present invention can detect ultra-low frequency mutations, and all mutations as low as 0.05% frequency can be stably detected.

[0101] In the above, the preparation of unequal length linker sequences, universal primers and label primer reagents is to centrifuge the synthesized unequal length linker sequences, universal primers and label primer dry powders at 12000rpm for 10 minutes, then slowly add buffer solution along the tube wall according to the volume of diluent marked on the tube wall to dilute them into 100μM stock solution, place them on a vortex shaker to fully mix, call the single-stranded DNA mode of NanoDrop, adjust the zero to within ±0.3 with buffer, take 1.8ul of primers to measure the concentration, obtain the primer A260 value, obtain the primer nmol / OD value from the primer CoA report, calculate the precise molar concentration of the primer according to the formula (actual molar concentration (umol / L) = A260 value x (nmol / OD)), take the corresponding volume of primers and dilute them with buffer to a working solution concentration of 10uM, mark them as unequal length linker sequences, universal primers and label primers, respectively, and let them stand for use;

[0102] Synthesis of unequal length linker sequences: Design a sequence that does not form primer dimers with the specific primer and the tag primer. The 5'-3' sequence at the complementary end is CTAGGTAGTACGCAC, and the 5'-3' sequence at the longest end is CTACAGTGCCGCAATAGATCCATCATGCGTGT. HPLC is selected for primer synthesis and purification.

[0103] Universal primer synthesis: The 24 bp sequence at the 5' end of the long end of the unequal length linker sequence was used as the universal primer, the 5'-3' sequence was CTACAGTGCCGCAATAGATCCATC, the 5' end was modified with Biotin, and HPLC was selected for primer synthesis and purification;

[0104] Test Example 1:

[0105] The method of Example 1 was used to extract and test 10 clinical AML whole blood samples, all of which were from clinical cooperation units. The test results are shown in Table 10:

[0106] Table 10

[0107]

[0108] Among the above 10 samples, 4 mutations were detected, of which 3 were gene mutations and 1 was BCR-ABL fusion positive. The IGV software was used to view the sequence distribution of the site regions of the 4 mutation-positive samples, as shown below: Figures 5 to 8 As shown, the relevant variants all have corresponding read sequences that support the variants, which are true positives and are completely consistent with the clinical results.

[0109] The above is only the embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalence, replacement, improvement, etc. made within the spirit and principle of the present application should be included within the scope of the claims of the present application.

Claims

1. A method for constructing a multiplex amplicon library, characterized in that: The method consists of the following steps: (1) determining the target sequence to be detected and extracting the genomic DNA of the sample to be tested; (2) Synthesizing forward and reverse specific amplification primers of the target sequence, first designing the corresponding specific primer sequence according to the site information and / or fusion position of the target genome through a multiple primer design process, and adding a UMI sequence and a bridge sequence to the 5' end thereof to obtain the forward and reverse specific amplification primer sequence; (3) mixing the forward specific amplification primers obtained in step (2) and adding a buffer solution to dilute them to obtain a multiplex forward mixed primer, and mixing the reverse specific amplification primers obtained in step (2) and adding a buffer solution to dilute them to obtain a multiplex reverse mixed primer; (4) fragmenting the genomic DNA of the sample to be tested, and then performing end repair and adding adenine A; (5) using a ligase to connect the DNA fragments fragmented, end-repaired and adenine-A-added in step (4) to the anchor primer, adding DNA purification magnetic beads to purify the connection mixture to obtain a purified connection product; (6) using the ligation product purified in step (5) as a template to perform a first round of multiplex PCR amplification, and then using streptavidin magnetic beads to purify the product to obtain a first round of amplification products, and then adding streptavidin magnetic beads to resuspend and mix to obtain a highly enriched target region magnetic bead resuspended mixture; (7) The second round of multiplex PCR amplification is performed using the magnetic bead resuspended mixture as a template, and the streptavidin magnetic beads are removed to finally obtain the second round of amplification products. The target fragments are then enriched by adding label primers and purified, quantified, and sequenced.

2. The method for constructing a multiplex amplicon library according to claim 1, characterized in that: The first round amplification system used in the multiple amplification in step (6) is composed of the purified ligation product, DNA amplification enzyme premix, universal primers, and multiple forward primer mixture.

3. The method for constructing a multiplex amplicon library according to claim 1, characterized in that: The second round amplification system used in the multiple amplification in step (7) is composed of the magnetic bead resuspension mixture in step (6), DNA amplification enzyme premix, label primers, and multiple reverse primer mixture.

4. The method for constructing a multiplex amplicon library according to claim 1, characterized in that: The UMI sequence added by the forward specific amplification primer is at its 5' end, consisting of 6 to 12 random bases, and the bridge sequence is at the 5' end of the UMI sequence, which is a 16 to 35 bp sequence at the 3' end of the sequencing adapter sequence 1; the UMI sequence added by the reverse specific amplification primer is at its 5' end, consisting of 6 to 12 random bases, and the bridge sequence is at the 5' end of the UMI sequence, which is the full-length sequence of the sequencing adapter sequence 2, including the index sequence.

5. The method for constructing a multiplex amplicon library according to claim 1, characterized in that: In the step (5), the anchor primers are linker sequences of unequal lengths, the complementary sequences of the linker sequences of unequal lengths are 16-24 bp, and the oligonucleotide sequence at the longest end is 24-32 bp.

6. The method for constructing a multiplex amplicon library according to claim 2, characterized in that: The tag primer is a 24 bp sequence at the 5' end of the long end of the unequal length linker sequence, a 5'-3' sequence of CTACAGTGCCGCAATAGATCCATC, a 5' end is biotin modified, and HPLC is selected as the primer synthesis and purification method.

7. The method for constructing a multiplex amplicon library according to claim 3, characterized in that: The universal primer contains the full-length sequence of the sequencing adapter sequence 1 of the index sequence, and HPLC is selected as the primer synthesis and purification method.

8. The method for constructing a multiplex amplicon library according to claim 1, characterized in that: The genomic DNA of the sample to be tested includes any one of gDNA or cfDNA.

9. A multiple primer combination for detecting acute myeloid leukemia using the method for constructing a multiple amplicon library according to claim 1, characterized in that: The nucleic acid sequences of the forward and reverse specific primers are shown in SEQ ID NO.1-SEQ ID NO.116, and the nucleic acid sequences of the tag primers are shown in SEQ ID NO.117-SEQ ID NO.

128.

10. Use of the method for constructing a multiplex amplicon library according to any one of claims 1 to 8 in detecting gene mutations and fusions in acute myeloid leukemia.

Images