Preparation method and application of fluorescence sensor based on 3D DNA walker and APE1 enzyme
By combining 3D DNA walkers and APE1 enzyme fluorescence sensors, the problems of insufficient sensitivity and long detection time in the prior art detection Pseudomonas aeruginosa were solved, and high sensitivity and rapid 16S rRNA detection were achieved.
Patent Information
- Application Number
- CN202411935341.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2025-05-09
AI Technical Summary
The prior art has problems such as insufficient sensitivity, long detection time and complex sample pretreatment in detecting Pseudomonas aeruginosa, making it difficult to achieve early and accurate detection.
Using a fluorescent sensor based on 3D DNA walker and APE1 enzyme, a fluorescence sensor was designed and modified magnetic beads were combined with APE1 enzyme for signal amplification, achieving high sensitivity and rapid detection of 16S rRNA of Pseudomonas aeruginosa.
Significantly improves the target amplification efficiency, achieves high sensitivity and rapid detection of 16S rRNA from Pseudomonas aeruginosa, providing a powerful tool for early and accurate detection.
Smart Images
Figure CN119955905A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biospecific detection, and in particular relates to a preparation method and application formula of a fluorescent sensor based on a 3D DNA walker and APE1 enzyme. Background Art
[0002] Pseudomonas aeruginosa (PA) is a rod-shaped, aerobic, uniflagellated opportunistic pathogen belonging to the Pseudomonadaceae family. It is a common environmental bacterium that can be rapidly spread through animal feces, food, and water. As one of the three major pathogens of opportunistic infections in humans, it was identified as an important pathogen by the World Health Organization in 2017, causing worrisome infections such as otitis media, pneumonia, keratitis, sepsis, and endocarditis. In addition, it is one of the most common pathogens causing nosocomial infections, mainly seen in patients with underlying lesions or immunocompromised patients, and is also the main cause of chronic infections in patients with cystic fibrosis and chronic obstructive pulmonary disease. It accounts for no less than 10% of all nosocomial infections worldwide, causing pneumonia, wound infections, urinary tract infections, and bacteremia in immunocompromised patients. Pseudomonas aeruginosa infection is considered one of the most common surgical site infections, which can lead to sepsis and death in severe cases. The inherent low sensitivity of Pseudomonas aeruginosa to antibiotics, as well as its ability to acquire resistance by acquiring mutations (especially during chronic infection) and acquiring resistance genes, make the treatment of infections caused by this bacterium more difficult. Rapid and sensitive detection of pathogens is an effective means to guide clinical anti-infective medication and standardize the use of antibiotics. Therefore, it is urgent to develop new methods to achieve specific, rapid and sensitive detection of Pseudomonas aeruginosa infection at an early stage.
[0003] Currently, conventional methods for detecting Pseudomonas aeruginosa include standard plate counts, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). Culture and plate count methods are currently considered reliable methods for detecting bacteria in food and drinking water, but their use is limited by the long time requirements (36-72 hours). Enzyme-linked immunosorbent assays (ELISA) are widely used due to their high sensitivity and low cost. However, their use is limited by their complex and time-consuming cleaning process and harsh detection conditions. Polymerase chain reaction (PCR) is the most accurate technology to date, but complex sample pretreatment - including DNA purification, PCR amplification, and gel electrophoresis - hinders the widespread application of this method. To address these challenges, various new rapid detection platforms based on antibody recognition methods have been developed, which allow real-time, online, and on-site detection. However, problems such as false positives due to potential cross-reactions, low sensitivity due to poor expression of surface antigens, and unstable antibodies limit their effectiveness. Therefore, nucleic acid sequence-based detection methods are gradually replacing antigen monitoring methods. For example, 16S rRNA is an excellent indicator for identifying the source of infection. The 16S rRNA gene encodes the DNA sequence of 16S rRNA and is present in all bacterial genomes. The gene consists of conserved regions and variable regions: the conserved regions reveal the phylogenetic relationships between different species, while the variable regions highlight the differences between species. This unique property makes 16S rRNA an ideal molecular marker for identifying microorganisms. In order to achieve high-performance detection of 16S rRNA and distinguish target bacteria from non-target bacteria, the development of biosensors that integrate multiple detection technologies has become popular. However, the low efficiency of signal amplification poses a major challenge to meeting the needs of practical applications. Therefore, it is crucial to design a more sensitive and efficient biosensor that uses multiple signal amplification strategies to detect PA.
[0004] DNA walkers have become very important in signal amplification due to their ability to accumulate signal during detection. Among them, 3D DNA walkers are particularly noteworthy because they achieve a high DNA loading density on three-dimensional materials. This allows the attachment of more walking arms, resulting in more significant signal accumulation during walking. They have been successfully used to detect microRNAs, bacteria, metal ions, and enzymes. However, a limitation of single DNA walkers is that their detection limits are often too high for microanalysis, which is particularly problematic in bacterial detection. To improve the readout signal, there is growing interest in cascade amplification strategies that combine DNA walkers with other signal amplification techniques, such as catalytic hairpin assembly (CHA), hybridization chain reaction (HCR), and entropy-driven catalysis (EDC). Nonetheless, these amplification methods often face time limitations. Human apurinic / apyrimidinic endonuclease 1 (APE1) is an enzyme involved in DNA base excision repair. APE1 can recognize and cut DNA at apurinic (AP) sites, functioning similarly to restriction nucleases. Rapid signal amplification can be facilitated by designing probes based on APE1 and molecular beacons. Therefore, using DNA walkers to convert targets into large output DNA products can serve as promoters for APE1-mediated signal amplification, and this cascade amplification strategy has the potential to significantly improve the efficiency of target amplification.
[0005] Based on the above technical background, the present invention proposes a dynamic fluorescence biosensor (MDWAE) that combines a magnetic 3D DNA walker with an APE1 enzyme for high-sensitivity and rapid detection of 16S rRNA of Pseudomonas aeruginosa, which provides a powerful tool for early and accurate detection of Pseudomonas aeruginosa, and is expected to be used for Pseudomonas aeruginosa detection in the fields of food, medical care, and safety. Summary of the invention
[0006] The purpose of the present invention is to provide a method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme and its application.
[0007] To achieve the above object, the present invention provides the following technical solutions: A method for preparing a fluorescent sensor based on a 3D DNA walker and an APE1 enzyme comprises the following steps: (1) Design of DNA probe: including a substrate strand Zn-S with an RNA site embedded in the hairpin structure, a walking strand Zn-E with enzyme activity, its partially complementary strand S1, and a DNA walker output strand T1. The two ends of the hairpin structure are modified with FAM fluorophores and BHQ1 quenchers to form AH-FAM. (2) Preparation of DNA-modified magnetic beads to obtain 3D DNA walkers (MDWs); (3) Trigger probe preparation: MDW, PA 16S rRNA, Zn 2+ , ddH2O into a centrifuge tube and react at 37°C for 30 min. After magnetic separation, the supernatant was collected to collect the contained trigger probes; (4) Preparation of fluorescent sensor: Add trigger probe, AH-FAM, APE1 enzyme, 10 × NEB buffer and Tri-HCl to ddH2O and mix thoroughly. Incubate the resulting solution at 37°C for 25 min and then transfer it to a microplate.
[0008] 2. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that the DNA sequences of Zn-S, Zn-E, S1, and T1 are respectively: Biotin-TTTTTTTTTTTTACTCACTAT / rA / GGAAGAGATGTTTTT; GTTAATACCTTGCTGTCATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT; Biotin-TTTTTTTTTTTTCTTCTTCTTAGGAAGAGATACAGCAAGGTATTAACTTACTGCCCTTCCTCC; GGAAGAGATGTTTTT.
[0009] As a preferred embodiment of the present invention, the AH-FAM is further modified with an apurine pyrimidine site AP to form a DNA fluorescent probe.
[0010] As a preferred embodiment of the present invention, the DNA sequences of the AH-FAM are: BHQ1-GAGAGTAAAAACA / idsp / CTCTTCCACTCTCA-FAM.
[0011] As a preferred embodiment of the present invention, the specific steps of step (2) include: ① Add an equal amount of biotin to the Zn-E solution to modify S1, heat treat it at 95°C for 5 minutes, and then gradually cool it to room temperature to obtain a Zn-E / S1 mixture.
[0012] ② Wash the streptavidin magnetic beads twice with 1× B&W buffer and then suspend them in 1× B&W buffer; ③ Then, biotin-modified substrate chain Zn-S and Zn-E / S1 in step ① were added to the mixed solution obtained in step ②, and the mixture was reacted in a rotator under ambient conditions for 60 minutes; ④ The MB-DNA complex in step ③ was washed successively with 1× B&W buffer and water to completely remove excess DNA, thereby obtaining MDW; ⑤The MDW obtained in step ④ was redispersed in the reaction buffer and stored in a 4°C refrigerator for later use.
[0013] As a preferred embodiment of the present invention, the 1× B&W buffer is composed of 2 mmol·L -1 Tris-HCl, 1 mol·L -1 NaCl, 0.5 mmol·L -1 The composition is composed of EDTA, and the volume ratio of Zn-S to S1 is 2:1.
[0014] As a preferred embodiment of the present invention, the PA 16S rRNA can be used to identify Pseudomonas aeruginosa, and its DNA sequence is: GGAGGAAGGGCAGTAAGTTAATACCTTGCTGT.
[0015] As a preferred embodiment of the present invention, the volume ratio of Zn-E to Zn-S is 1:5. 2+ The concentration was 800 μM.
[0016] As a preferred embodiment of the present invention, the volume ratio of the trigger probe, AH-FAM and APE1 enzyme is 8:10:1, wherein the concentration of APE1 enzyme is 1 U / mL.
[0017] The present invention also provides an application method of the fluorescent sensor based on the 3D DNA walker and the APE1 enzyme. The fluorescent sensor prepared by the present invention is used to transfer the fluorescent sensor to a microdish and perform fluorescence measurement using a fluorescence spectrum to record the fluorescence spectrum. The excitation wavelength is 488 nm, the emission wavelength is 505-600 nm, and the maximum fluorescence emission at 517 nm is used as an indicator for evaluating 16S rRNA detection.
[0018] In summary, the beneficial technical effects of the present invention are: The present invention utilizes a DNA walker that can accumulate signals and contribute to signal amplification during the detection process in combination with an APE1 enzyme. Since APE1 can recognize and cut DNA at an apurinic (AP) site, by designing a probe based on APE1 and a molecular beacon, rapid signal amplification can be promoted. The target is converted into a large amount of output DNA products by using the DNA walker, which can be used as a promoter for signal amplification mediated by the APE1 enzyme, thereby forming a dual-signal cascade amplification, thereby significantly improving the target amplification efficiency. Subsequently, the present invention combines a magnetic 3D DNA walker with an APE1 enzyme to form a dynamic fluorescent biosensor (MDWAE) for high-sensitivity and rapid detection of 16S rRNA of Pseudomonas aeruginosa, providing a powerful tool for early and accurate detection of Pseudomonas aeruginosa, and is expected to be used for Pseudomonas aeruginosa detection in the fields of food, medical treatment, and safety. The DNA walker is loaded on a three-dimensional material to achieve a high DNA loading density, thereby attaching more walking arms, further obtaining more significant signal accumulation during the walking process, and improving its sensitivity. Based on the dual-signal cascade amplification effect, the target 16S rRNA is added to the sensor to effectively improve its specificity. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification, but do not constitute a limitation of the present invention. In the accompanying drawings: Figure 1 This is a schematic diagram of the principle of using a fluorescent sensor based on a 3D DNA walker and APE1 enzyme for detecting 16SrRNA of Pseudomonas aeruginosa in this embodiment; Figure 2 This is a schematic diagram of the synthesis of DNA-modified magnetic beads based on the 3D DNA walker and the APE1 enzyme fluorescent sensor of this embodiment; Figure 3 It is a fluorescence spectrum diagram and a linear relationship diagram of the fluorescence sensor based on the 3D DNA walker and the APE1 enzyme used to verify the detection of Pseudomonas aeruginosa 16S rRNA in this embodiment; Figure 4 This is a bar graph of the example of the preparation of the fluorescent sensor based on the 3D DNA walker and APE1 enzyme in this example. DETAILED DESCRIPTION
[0020] The present invention is further described in detail below in conjunction with the accompanying drawings.
[0021] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0022] See also Figure 1 The present invention provides a technical solution: firstly, a fluorescent sensor is prepared: (1) Design of DNA probe: including a substrate strand Zn-S with an RNA site embedded in the hairpin structure, a walking strand Zn-E with enzyme activity, its partially complementary strand S1, and a DNA walker output strand T1. The two ends of the hairpin structure are modified with FAM fluorophores and BHQ1 quenchers to form AH-FAM. (2) Preparation of DNA-modified magnetic beads to obtain 3D DNA walkers (MDWs); (3) Trigger probe preparation: MDW, PA 16S rRNA, Zn 2+ , ddH2O into a centrifuge tube and react at 37°C for 30 min. After magnetic separation, the supernatant was collected to collect the contained trigger probes; (4) Preparation of fluorescent sensor: Add trigger probe, AH-FAM, APE1 enzyme, 10 × NEB buffer and Tri-HCl to ddH2O and mix thoroughly. Incubate the resulting solution at 37°C for 25 min and then transfer it to a microplate.
[0023] The DNA sequences of Zn-S, Zn-E, S1, and T1 are: Biotin-TTTTTTTTTTTTACTCACTAT / rA / GGAAGAGATGTTTTT; GTTAATACCTTGCTGTCATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT; Biotin-TTTTTTTTTTTTCTTCTTCTTAGGAAGAGATACAGCAAGGTATTAACTTACTGCCCTTCCTCC; GGAAGAGATGTTTTT.
[0024] The DNA sequences of AH-FAM are: BHQ1-GAGAGTAAAAACA / idsp / CTCTTCCACTCTCA-FAM; PA 16S rRNA can be used to identify Pseudomonas aeruginosa. Its DNA sequence is: GGAGGAAGGGCAGTAAGTTAATACCTTGCTGT In this embodiment, 1× B&W buffer is composed of 2 mmol·L -1 Tris-HCl, 1 mol·L -1 NaCl, 0.5mmol·L -1 The reaction buffer consisted of 50 mM Tris−HCl, 140 mM NaCl, 1 mM MgCl2, and its pH was 7.4.
[0025] The volume ratio of Zn-S to S1 is 2:1.
[0026] The volume ratio of Zn-E to Zn-S is 1:5. 2+ The concentration was 800 μM.
[0027] The volume ratio of the trigger probe, AH-FAM, and APE1 enzyme is 8:10:1, wherein the concentration of APE1 enzyme is 1 U / mL.
[0028] An equal amount of biotin was added to modify S1 using Zn-E (2 μM), annealed at 95°C for 5 min, and then gradually cooled to room temperature to obtain a 1 μM Zn-E / S1 hybrid. Then 150 μL of streptavidin magnetic beads (10 mg / mL) were added and resuspended in 300 μL of 1× B&W buffer (2 mM Tris-HCl, 1 mM NaCl, 0.5 mM EDTA, pH 7.5). Subsequently, 100 μL of biotin-modified Zn-S (2.5 μM) and 50 μL of Zn-E / S1 (1 μM) were added, mixed under normal conditions, reacted in a rotating device for 60 minutes, and the mixture was washed continuously with 1× B&W buffer and water to completely remove excess DNA. Finally, the obtained MDW (10 mg / mL) was dispersed in 150 μL of reaction buffer (pH 7.4) and stored in a refrigerator at 4°C for future use. Take 1μL MDW (10 mg / mL), 0.5μL PA 16S rRNA, 1μL Zn 2+(800μM) and 7.5μL ddH2O were placed in a centrifuge tube and reacted at 37°C for 30 min. After magnetic separation, the supernatant was collected to collect the trigger probe (T1). 8μL T1 with trigger probe, 10 μL HA-FAM (1 μM), 1 μL APE1 (1U / mL), 10 μL 10 × NEB buffer and 50μL Tri-Hcl (20mM) were added to 21 μL ddH2O and mixed thoroughly. The resulting solution was incubated at 37°C for 25 min to obtain the sensor to be verified.
[0029] Then, the synthesis of 16S rRNA is performed, wherein the 16S rRNA is synthesized by experiment, specifically comprising the following steps: S1. Bacterial culture: Cultured overnight in LB (Luria-Bertani) liquid medium with 1% inoculum. All bacteria were collected by centrifugation and diluted 10-fold with PBS to a series of different concentrations.
[0030] S2. Bacterial lysis: Pick a single colony of engineered bacteria, culture it to the stable period, take 3 mL of bacterial solution and centrifuge to obtain the bacteria in a 1.5 mL centrifuge tube; add 1 mL of Trizol solution to each tube, cover the tube tightly, shake vigorously for 15 s, and let it stand at room temperature for 5 min; add 0.2 mL of chloroform to each tube, cover it tightly, shake vigorously for 15 s, and let it stand at room temperature for 3 min; then centrifuge, the centrifugation parameters are 4℃, 12000 g, centrifuge for 10 min, carefully aspirate the upper aqueous phase, transfer it to another new 1.5 mL centrifuge tube, and measure its volume; add 1 times the volume of chloroform, cover it tightly, shake vigorously for 15 s, let it stand at room temperature for 3 min, and then centrifuge, the centrifugation parameters are 4℃, 12000 g, centrifuge for 10 min, carefully aspirate the upper aqueous phase, transfer it to another numbered new 1.5 mL centrifuge tube, add 0.5 mL of isopropanol to each tube, gently invert to mix, and let it stand at room temperature for 10 min; 4℃, 12000 g, centrifuge for 10 min, RNA precipitated to the bottom of the tube; carefully aspirated the supernatant, added 1 mL 75% ethanol (precooled), and gently inverted to wash the precipitate; centrifuged at 4°C, 7500 g for 5 min; carefully discarded the supernatant, microcentrifuged, aspirated the remaining ethanol, and dried at room temperature for 10 min to obtain total bacterial RNA; each tube was dissolved with 10 μL DEPC-treated double-distilled deionized water and stored at -80°C.
[0031] The above sensor and the products of 16S rRNA stepwise reaction were transferred to a microplate, and fluorescence was measured using fluorescence spectroscopy. The fluorescence spectrum was recorded with an excitation wavelength of 488 nm and an emission wavelength of 505-600 nm. The maximum fluorescence emission at 517 nm was used as an indicator for evaluating 16S rRNA detection. Figure 4 (A) shows the curve graph, Figure 3 In the figure, as the target increases, the fluorescence intensity increases, indicating that the present invention can be used for the quantitative determination of 16S rRNA in Pseudomonas aeruginosa.
[0032] The sensor of the present invention is used to measure the fluorescence of four different bacteria, including Salmonella typhi, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus. At the same time, the fluorescence of a mixture of species of bacteria with Pseudomonas aeruginosa added is measured. The measurement results are as follows: Figure 4 As shown in (C), the present invention is further specific for Pseudomonas aeruginosa.
[0034] Specifically, the same amount of Pseudomonas aeruginosa in milk and juice was analyzed by adding standard recovery method, and the following table 1 was obtained:
[0035] At the same time, based on the same content of Pseudomonas aeruginosa in milk and juice, five independent biosensors were tested under the same concentration target and the same conditions to verify the stability of the sensor, where the sensors were labeled 1-5, and the following results were obtained: Figure 4 The results shown in (D) show that the fluorescence intensities tend to be equal, thus verifying the stability of the sensor of the present invention.
[0036] In this embodiment, the following Examples 1-23 are proposed.
[0037] Example 1 The volume ratio of Zn-E to Zn-S was adjusted to 1:2; Zn-E (1 μM) was annealed at 95°C for 5 min and then gradually cooled to room temperature, and an equal amount of MB@Zn-S@S1 was added and incubated for 1 hour to generate MB@Zn-S@Zn-E / S1 for later use. Take 1 μL MB@Zn-S@Zn-E / S1, 0.5 μL PA 16S rRNA, 1 μL Zn 2+ (800μM) and 7.5μL ddH2O were placed in a centrifuge tube and reacted at 37°C for 30 min. After magnetic separation, the supernatant was collected to collect the trigger probe (T1). 8μL T1 with trigger probe, 10 μL HA-FAM (25 nM), 1 μL APE1 (0.6 U / mL), 10 μL 10 × NEB buffer and 50μL Tri-Hcl (10mM) were added to 21 μL ddH2O and mixed thoroughly. The resulting solution was incubated at 37°C for 25 min to obtain the sensor.
[0038] Embodiments 2-4 differ from Embodiment 1 in that the volume ratios of Zn-E to Zn-S are different, namely 1:5; 1:10; 1:20.
[0039] Embodiments 5-8 differ from Embodiment 1 in that Zn 2+ The concentrations are different, namely 100μM, 500μM, 1000μM, and 1500μM.
[0040] Examples 9-15 differ from Example 1 in that the reaction times of the DNA walkers are different, which are 0.05, 0.1, 0.2, 1, 1.5, 2, and 2.5, respectively.
[0041] Examples 16-19 differ from Example 1 in that the concentrations of AH-FAM are different, which are 50 nM, 75 nM, 100 nM, and 125 nM, respectively.
[0042] Examples 20-23 differ from Example 1 in that the APE1 enzyme concentrations are different, which are 1.0 U / mL, 1.2 U / mL, and 1.4 U / mL, respectively.
[0043] Further according to Figure 4 It can be obtained that when the volume ratio of Zn-E to Zn-S is 1:5, Zn 2+ The most preferred embodiment of the present invention is when the concentration is 800 μM, the DNA walker reaction time is 30 min, the AH-FAM concentration is 100 μM, and the APE1 enzyme concentration is 1.0 U / mL.
[0044] The working principle of the present invention is as follows: a DNA walker capable of accumulating signals and facilitating signal amplification during the detection process is combined with an APE1 enzyme. Since APE1 can recognize and cut DNA at apurinic (AP) sites, by designing a probe based on APE1 and a molecular beacon, rapid signal amplification can be promoted. The target is converted into a large amount of output DNA product by using a DNA walker, which can be used as a promoter for signal amplification mediated by the APE1 enzyme, thereby forming a dual-signal cascade amplification, thereby significantly improving the target amplification efficiency. Subsequently, the present invention combines a magnetic 3D DNA walker with an APE1 enzyme to form a dynamic fluorescent biosensor (MDWAE) for high-sensitivity and rapid detection of 16S rRNA of Pseudomonas aeruginosa, providing a powerful tool for early and accurate detection of Pseudomonas aeruginosa, and is expected to be used for Pseudomonas aeruginosa detection in the fields of food, medical treatment, and safety. At the same time, the DNA walker is loaded on a magnetic three-dimensional material to achieve a high DNA loading density, thereby attaching more walking arms, and obtaining more significant signal accumulation during the walking process.
[0045] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.
[0046] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A method for preparing a fluorescent sensor based on a 3D DNA walker and an APE1 enzyme, characterized in that: The specific steps include: (1) Design of DNA probe: including a substrate strand Zn-S with an RNA site embedded in the hairpin structure, a walking strand Zn-E with enzyme activity, its partially complementary strand S1, and a DNA walker output strand T1. The two ends of the hairpin structure are modified with FAM fluorophores and BHQ1 quenchers to form AH-FAM. (2) Preparation of DNA-modified magnetic beads to obtain 3D DNA walkers (MDWs); (3) Trigger probe preparation: MDW, PA 16S rRNA, Zn 2+ , ddH2O into a centrifuge tube and react at 37°C for 30 min. After magnetic separation, the supernatant was collected to collect the contained trigger probes; (4) Preparation of fluorescent sensor: Add trigger probe, AH-FAM, APE1 enzyme, 10 × NEB buffer and Tri-HCl to ddH2O and mix thoroughly. Incubate the resulting solution at 37°C for 25 min and then transfer it to a microplate.
2. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that: The DNA sequences of Zn-S, Zn-E, S1 and T1 are respectively: Biotin-TTTTTTTTTTACTCACTAT / rA / GGAAGAGATGTTTTT; GTTAATACCTTGCTGTCATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT; Biotin-TTTTTTTTTTTTCTTCTTCTTAGGAAGAGATACAGCAAGGTATTAACTTACTGCCCTTCCTCC; GGAAGAGATGTTTTT.
3. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that: The AH-FAM is also modified with an apurine pyrimidine site AP to form a DNA fluorescent probe.
4. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 3, characterized in that: The DNA sequences of the AH-FAM are: BHQ1-GAGAGTAAAAACA / idsp / CTCTTCCACTCTCA-FAM.
5. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that: The specific steps of step (2) include: ① Add an equal amount of biotin to the Zn-E solution to modify S1, heat treat at 95°C for 5 minutes, and then gradually cool to room temperature to obtain a Zn-E / S1 mixture; ② Wash the streptavidin magnetic beads twice with 1× B&W buffer and then suspend them in 1× B&W buffer; ③ Then, biotin-modified substrate chain Zn-S and Zn-E / S1 in step ① were added to the mixed solution obtained in step ②, and the mixture was reacted in a rotator under ambient conditions for 60 minutes; ④ The MB-DNA complex in step ③ was washed successively with 1× B&W buffer and water to completely remove excess DNA, thereby obtaining MDW; ⑤The MDW obtained in step ④ was redispersed in the reaction buffer and stored in a 4°C refrigerator for later use.
6. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 5, characterized in that: The 1× B&W buffer consists of 2 mmol·L -1 Tris-HCl, 1 mol·L -1 NaCl, 0.5 mmol·L -1 The composition is composed of EDTA, and the volume ratio of Zn-S to S1 is 2:
1.
7. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that: The PA 16S rRNA can be used to identify Pseudomonas aeruginosa, and its DNA sequence is: GGAGGAAGGGCAGTAAGTTAATACCTTGCTGT.
8. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that: The volume ratio of Zn-E to Zn-S is 1:
5. 2+ The concentration was 800 μM.
9. The method for preparing a fluorescent sensor based on a 3D DNA walker and APE1 enzyme according to claim 1, characterized in that: The volume ratio of the trigger probe, AH-FAM, and APE1 enzyme is 8:10:1, wherein the concentration of APE1 enzyme is 1 U / mL.
10. An application of a fluorescent sensor based on a 3D DNA walker and APE1 enzyme, using the fluorescent sensor prepared according to claim 1, characterized in that: The fluorescence sensor transferred to the microdish was measured using fluorescence spectroscopy and the fluorescence spectrum was recorded with an excitation wavelength of 488 nm and an emission wavelength of 505-600 nm. The maximum fluorescence emission at 517 nm was used as an indicator to evaluate 16S rRNA detection.