Molecular breeding method, molecular marker and primer for breeding variety with high gibberellic disease resistance

Abstract

The invention discloses a molecular breeding method, a molecular marker and a primer for breeding a variety with high gibberellic disease resistance. The molecular marker comprises a KASP marker of TaFhb-2DL with a flanking sequence as shown in SEQ ID NO.3. According to the invention, a physical interval of a gibberellic disease resistant site QFhb-2DL is reduced by utilizing a fine positioning group, candidate genes are analyzed and determined through genome information, genes most related to gibberellic disease resistance are screened out by utilizing phenotypes and genotypes of a natural group, and a new linkage marker KASP.TaFhb-2DL is developed, so that the utilization of the QFhb-2DL is more efficient. According to the invention, a disease-resistant genotype variety carrying a gibberellic disease-resistant gene TaFhb-2DL is taken as a parent, a variety carrying an Fhb1 gene is taken as a donor, and the TaFhb-2DL is effectively utilized in wheat gibberellic disease-resistant breeding at the middle and lower reaches of the Yangtze River, so that the gibberellic disease resistance can be improved to high resistance which exceeds that of Sumai No.3 by introducing a main-effect gibberellic disease-resistant gene Fhb1 on the basis. By utilizing the effective molecular marker, the polymerization of TaFhb-2DL and Fhb1 is realized, and the high-scab-resistance variety can be quickly and effectively bred.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat molecular breeding, and in particular, relates to a molecular breeding method, molecular markers and primers for breeding varieties with high resistance to scab. Background Art

[0002] Jiangsu Province is a high-incidence area of ​​wheat fusarium head blight in China, and resistance to fusarium head blight has always been an important goal of wheat breeding. From 2009 to 2020, only 28 wheat varieties approved by the state had medium resistance (MR) to fusarium head blight, of which 23 were from Jiangsu Province, China. As for China's (excluding Jiangsu Province) wheat fusarium head blight resistance breeding, since 2016, about 15 of China's approved varieties have medium resistance (MR) to fusarium head blight, and only one variety has high resistance (HR), and no significant breakthroughs have been made in fusarium head blight resistance breeding. The project applicant initially conducted a study on the fusarium head blight resistance genes ( Fhb1 , Fhb2 , Fhb4 , Fhb5 ) and fusarium scabiei phenotypes, and found that only 17.72% of the varieties carried Fhb1 , 6.01% of the varieties carry Fhb2 , 11.39% of the varieties carry Fhb4 , 14.56% of the varieties carry Fhb5 , and among these main varieties, only Sumai No. 3 has reached the R level of resistance to scab, indicating that the utilization rate of scab resistance genes in genetic improvement of scab resistance is not high. After 2018, molecular marker-assisted breeding for scab resistance has made a series of progress. Zhou Miaoping et al. (Creation and Screening of New Wheat Germplasm Resistant to Scab in Huanghuai Wheat Region, Journal of Wheat Crops, 2018) used Sumai No. 3 as the resistance source and Jimai 22 as the receptor, combined with Fhb1 Molecular assisted selection was used to create 18 wheat materials with moderate or above susceptibility to fusarium scab. Zhang Hongjun et al. (using Fhb1 Gene function marker selection to improve wheat varieties' resistance to Fusarium head blight in the Huanghuai winter wheat region, Acta Agronomica Sinica, 2018) selected Ningmai 9, Shengxuan 6, Sumai 3 and Ningmai 13 as Fhb1 The gene donor was hybridized and backcrossed with the highly susceptible wheat variety Zhoumai 16 dwarf wheat near-isogenic line, and combined with molecular marker-assisted selection, a carrier was obtained. Fhb1 The team led by Professor Ma Zhengqiang of Nanjing Agricultural University used the wheat line NMAS022 as the donor parent for resistance to fusarium scab and the modern wheat cultivar Bainong 4199 as the recipient parent. They used the molecular marker-assisted selection method to breed a polymorphic fusarium spore-forming backcross progeny with disease resistance genes and significantly improved fusarium spore-forming backcross progeny. Fhb1A new wheat variety Bainong 4299 with genes resistant to Fusarium head blight (Zhang et al., Pyramiding of Fusarium head blightresistance quantitative trait loci, Fhb1 , Fhb4 , and Fhb5 , in modern Chinese wheat cultivars, Frontiers in Plant Science, 2021; Zhang Yiduo et al., Gene aggregation breeding of new wheat line Bainong 4299 resistant to Fusarium head blight, Acta Agronomica Sinica, 2022). At the same time, Professor Ma Zhengqiang's team cooperated with Huai'an Academy of Agricultural Sciences to breed a new gene aggregation wheat line Fhb1 Nanhuai wheat 191 and Nanhuai wheat 193 with ergot resistance genes. Professor Yin Guihong's team from Henan Agricultural University used Fhb1 The resistance genes of Fusarium head blight were used to breed Yunong 901, Yunong 902, Yunong 903, Yunong 904 and Yunong 910 (Zhang et al., Molecular and phenotypic characterization of Chinese wheat ( Triticum aestivum ) cultivars for resistance to Fusarium head blight, Plant Breeding, 2023). However, the fusarium head blight resistance level of the above varieties (lines) has not yet reached or approached the level of Sumai No. 3, and the workload required for the selection of consistent genotypes and phenotypes during breeding selection is still huge, and the accuracy and efficiency have not yet been significantly improved.

[0003] In summary, the excellent germplasm resources and gene resources that have been used in wheat scab resistance breeding are still scarce, and the breeding results are not outstanding. Most breeding practices have shown that wheat scab resistance is a trait controlled by multi-gene aggregation, and it is impossible to achieve accurate and efficient breeding by molecular markers or phenotypic selection alone. Therefore, it is urgent to explore and utilize new resistance sources and disease resistance genes that can be used efficiently, innovate the technical route of scab resistance breeding, and promote the overall level of scab resistance breeding. Summary of the invention

[0004] In view of the problem that the above-mentioned excellent germplasm resources and gene resources that have been used for wheat ergot resistance breeding are still scarce and the breeding results are not outstanding, the present invention provides a molecular breeding method, molecular markers and primers for breeding varieties with high resistance to ergot. The high-yield wheat strains with high resistance to ergot bred by using the molecular markers of the present invention have stably reached the level of "high resistance" to ergot resistance, exceeding the level of Sumai No. 3.

[0005] In order to achieve the above object, the present invention provides a molecular marker linked to wheat scab resistance, which comprises a flanking sequence as shown in SEQ ID NO.3. TaFhb-2DL KASP markers of genes.

[0006] Furthermore, the molecular marker also includes Fhb1 Chain GSM tag.

[0007] The second aspect of the present invention provides primers used for the above-mentioned molecular markers, which include forward primers as shown in SEQ ID NO.4 and SEQ ID NO.5, and a reverse primer as shown in SEQ ID NO.6.

[0008] The third aspect of the present invention provides primers used in the above-mentioned molecular markers. TaFhb-2DL The primers used for the KASP marker of the gene include forward primers as shown in SEQ ID NO.4 and SEQ ID NO.5, and a reverse primer as shown in SEQ ID NO.6; Fhb1 The primers used for the linked GSM marker include the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.2.

[0009] A fourth aspect of the present invention provides a molecular breeding method for breeding varieties with high resistance to scab, which comprises the following steps: Step S1, using the method of single flower dripping and soil spreading of diseased wheat kernels to identify the selected wheat varieties for resistance to fusarium head blight, resistance to infection and yield, and screening out varieties with resistance to fusarium head blight and high yield potential; extracting DNA from seeds or seedling leaves of the above varieties, and using TaFhb-2DL Linked markers of genes clearly carry the scab resistance locus QFhb-2DL Varieties, additional testing Fhb1 Linked markers, clearly also carrying fusarium resistance genes Fhb1 The varieties were planted in an artificial climate chamber, hybridized and matched, and F 0 Generation hybrids; F 0 F 1 , F 1 Then cross it with Yangmai 14 to harvest BC 1 F 0 BC 1 F 1 seed; Step S2, planting BC 1 F 1 When the seedlings are young, take the leaves to extract DNA and use TaFhb-2DL Gene linkage marker detection, select BCs with positive homozygous at this locus 1 F 1 Single plant, harvest BC1 F 2 ; Step S3, select BC in planting 1 F 2 ,use Fhb1 Linked marker detection, select BCs with positive loci (heterozygous or homozygous) 1 F 2 Individual plants are screened for tillering, lodging resistance, growth period and disease resistance, and BC is selected for harvesting 1 F 3 seed; Step S4, planting BC 1 F 3 At the seedling stage, leaves of individual plants were randomly selected and mixed to extract DNA. Fhb1 Linked marker detection BC 1 F 3 The mixed samples of the plants and rows were further tested for genes of the plants with heterozygous results according to the individual plants to clarify the BC 1 F 3 The genotype of individual plants was screened for Fhb1 Homozygous positive and heterozygous positive plant rows; during the flowering period of wheat, BC 1 F 3 Inoculate the pathogen of Fusarium fusarium by dripping in a single flower. After 21 days of inoculation, investigate the disease status of the inoculated ears and retain the rows and plants with "high resistance" identification results. Then, according to the breeding goals, comprehensively investigate the comprehensive agronomic traits and disease resistance of each plant in the selected rows. After harvest, identify the grain weight and select BC with a grain weight level higher than the yield control. 1 F 4 Single plant; Step S5, planting BC 1 F 4 , planted into strains, continued to use single flower drip inoculation to identify the resistance to fusarium head blight, and screened out strains with a higher resistance level than Sumai No. 3; comprehensively investigated the comprehensive agronomic traits and disease resistance of the selected strains, and the selected strains were mixed harvested. After harvesting, the grain weight and yield were identified, and strains with yield levels higher than the yield control were selected; Step S6, select BC in planting 1 F 5 According to the breeding objectives, the comprehensive agronomic traits of the varieties in the plots are comprehensively examined, and the yield is identified after harvest. 1 F 5 When the yield of the variety is higher than that of the control variety by more than 5% for two consecutive years, and the resistance to fusarium head blight exceeds that of the highly resistant variety Sumai No. 3, it can be recommended to enter the yield multi-point identification test; in, TaFhb-2DL The gene linkage marker is the one described in the first aspect of the present invention TaFhb-2DLKASP markers of genes, Fhb1 The linkage marker is the one described in the first aspect of the present invention Fhb1 The primer set used for PCR is the primer set described in the third aspect of the present invention.

[0010] Specifically, in step S1, the anti-extension identification method is as follows: prepare a suspension of 4×10 spores of Gibberella 5 ~5×10 5 spores / mL, during the flowering period of wheat, the florets in the middle of the single ear of the marked individual plant were inoculated with the pathogen of Fusarium fusae by single flower dripping, and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were evenly sprayed for 10 minutes each time. The spraying was stopped immediately after the wheat bloomed for 20 days; 21 days after inoculation, the disease situation of the inoculated ears was investigated, and Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively; The method for identifying the resistance to infection is as follows: prepare a suspension of 2×10 spores of Gibberella 5 ~3×10 5 Spores / mL, spray the spores of Fusarium head blight on a fixed number of marked plants at the flowering stage of wheat, investigate the diseased ear rate and diseased spikelet rate of the plants sprayed with spores in this area 21 days later, and identify the resistance to Fusarium head blight infection, Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively; The yield identification method is: mainly identifying plant height, growth period, number of ears per plant, number of grains per ear, and 1000-grain weight, with Yangmai 25 as the control. After three years of identification of resistance to infection and spread of fusarium head blight, agronomic traits and yield identification, varieties with resistance to fusarium head blight and high yield potential were selected; The CTAB method was used to extract DNA from seeds or seedling leaves of the above varieties. TaFhb-2DL The linkage markers of the gene clearly show that Yangmai 11, Yangmai 14, Yangmai 17, Yangmai 18, Yangmai 39, Ningmai 13, Ningmai 26, Zhenmai 12, Zhenmai 5, Zhenmai 6, and Shengxuan 6 all carry the scab resistance locus. QFhb-2DL , and additional detection Fhb1 Linked markers confirm that Yangmai 18 and Ningmai 13 also carry the scab resistance gene Fhb1 Yangmai 14 and Ningmai 13 were selected as parents and planted in an artificial climate chamber for hybridization and harvesting. 0 F 1 , F 1 Then hybridized with Yangmai 14 to obtain BC 1 F 1 seed.

[0011] Specifically, in step S3, BC is planted 1 F 2The screening method for tillering ability, lodging resistance, growing period and disease resistance was as follows: disease resistance was based on Yangmai 25, and the plants with disease resistance worse than that of Yangmai 25 were eliminated; the tillering ability and growing period were judged with Yangmai 25 as the control, and the plants with less tillers per plant than Yangmai 25 and a growing period later than that of Yangmai 25 were eliminated; the screening for lodging resistance was based on plant height, stem elasticity and lodging resistance, and plants that were prone to lodging, had poor elasticity and were greater than 90 cm in height were eliminated.

[0012] Specifically, in steps S4 and S5, the method of drip-inoculating the fusarium pathogen on a single flower of a row during the flowering period is as follows: prepare a fusarium spore suspension of 4×10 5 ~5×10 5 spores / mL. In the field, during the flowering period of wheat, single flower drip inoculation was used. 20 ears were randomly selected from each row or strain, and inoculated at the opened floret in the middle of each ear, and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were sprayed evenly and fully for 10 minutes each time. The spraying was stopped immediately after the wheat bloomed for 20 days. 21 days after inoculation, the disease status of the inoculated ears was investigated, the number of diseased spikelets per ear and the total number of spikelets were counted, and the rows or individual plants with an average diseased spikelet rate ≤25% were retained. Sumai No. 3 and Annong 8455 were used as high-resistant and high-susceptibility controls, respectively, Yangmai 25 was used as a medium-resistant control, and Yangmai 13 was used as a medium-susceptibility control.

[0013] Specifically, in steps S4, S5 and S6, the method for comprehensively examining the comprehensive agronomic traits of the selected plant rows, plant lines and varieties is: plant height less than 90 cm, the number of ears per plant greater than or equal to 9, the number of spikelets greater than 20, and the number of grains per ear greater than or equal to 49 as excellent standards.

[0014] Preferably, in steps S4, S5 and S6, the yield control is Yangmai 25.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: 1. QFhb-2DL It is a fusarium scaber resistance locus discovered by the applicant from Yangmai No. 4, Yangmai No. 5, Yangmai 12 and Yangmai 16. The present invention uses fine positioning populations to further narrow the physical interval of the target locus, identify candidate genes, use natural populations to screen out genes most related to fusarium scaber resistance, and develop a new linkage marker KASP.TaFhb-2DL. The newly developed molecular marker can accelerate the identification of disease resistance loci QFhb-2DL Application in wheat disease resistance breeding, and can also be used for TaFhb- 2DL Cloning of genes.

[0016] 2. The breeding method of the present invention first selects the main effect loci of resistance to scab in natural populations through genotype detection.QFhb-2DL The disease-resistant genotype is used as the parent, and then the genotype test is used to select the Fhb1 Genetic varieties as donors, due to QFhb-2DL As a stable disease resistance locus, it can be effectively used in wheat scab resistance breeding in the middle and lower reaches of the Yangtze River. Fhb1 The average diseased spikelet rate can be reduced by 2.79% to 87.17%. The average diseased spikelet rate of fusarium head blight is 13.80%, which is significantly lower than that of Sumai No. 3 (15.77%), reaching high resistance. QFhb-2DL Background import Fhb1 It can greatly improve the resistance level of Fusarium head blight, exceeding the level of Sumai No. 3, and stably reach the "high resistance" level. TaFhb-2DL Genes and Fhb1 The polymerization is simple, fast and efficient, and can quickly and effectively breed varieties with high resistance to ergot. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 In Example 1 of the present invention Fhb1 Schematic diagram of the amplification results of the closely linked molecular markers in the parents and offspring, with the arrows pointing to the positive bands of the Fusarium resistance gene; Figure 2 Based on TaFhb-2DL Genotyping map of KASP markers developed based on differential SNPs in 243 wheat varieties; Figure 3 This is a flow chart of the breeding method in Example 3 of the present invention. DETAILED DESCRIPTION

[0017] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0018] Example 1 Marker-assisted selection of scab resistance genes Fhb1 Method development The genomic DNA of the candidate parent materials, individual plant leaves or mixed plant and row leaves involved in Example 3 was extracted by CTAB method, and a template solution with a DNA concentration of about 30 ng / μL was obtained by dilution to detect the wheat fusarium resistance gene. Fhb1 Linked GSM markers. Molecular marker detection of Fusarium head blight resistance genes Fhb1 The sequences of the specific primer sets for the linked GSM markers are shown in Table 1: Table 1 Fusarium scab resistance genes Fhb1 Linked marker primer sequence information

[0019] Detection of major genes resistant to Fusarium head blight by PCR amplification Fhb1 The corresponding linkage marker TaHRC-GSM is amplified by PCR. The PCR amplification system is 10 μL, including 1.0 μL of 30 ng / μL wheat genomic DNA, 1.0 μL of 10×PCR buffer, 0.2 μL of 10 Mm dNTP, and 10 Mm MgCl 2 1.0μL, 5U Taq polymerase 0.2μL, 5μM upstream primer 0.4μL, 5μM downstream primer 0.4μL and sterile deionized water 5.8μL; the PCR amplification program is: (1) 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 62℃ annealing for 20s, 68℃ extension for 2-3.5min; (2) 94℃ denaturation for 20s, 57℃ annealing for 20s, 72℃ extension for 1min, 32 cycles; (3) 72℃ extension for 5min; 4℃ storage.

[0020] TaHRC-GSM primers were used to detect the wheat materials involved in Example 3 in 1% agarose electrophoresis solution. The target genotype was the same as Ningmai 13 and was the selected material. Figure 1 for Fhb1 Schematic diagram of the amplification results of the closely linked molecular markers in the parents and offspring. The arrows point to the positive bands of the ergot resistance gene. The results show that BC 1 F 3 Middle part material carrying Fhb1 Positive homozygous genotype (red arrow), some materials carry Fhb1 Negative homozygous genotype.

[0021] Example 2 Establishing a molecular design breeding method system for wheat with high resistance to scab while analyzing the fixed scab resistance loci QFhb-2DL Background Fhb1 Effects of presence and absence of genes on the expansion of resistance to fusarium head blight QFhb-2DL The applicant discovered the fusarium head blight resistance locus from Yangmai No. 4, Yangmai No. 5, Yangmai 12 and Yangmai 16, and the contribution rate of fusarium head blight resistance reached 37.39%. QFhb-2DL Both sides are marked with F in Yangmai No. 5 / Yanzhan No. 1 10 Two remaining heterozygous lines, RHL-1 and RHL-2, were found in the RIL population. These two RHLs were used to derive fine mapping QFhb- 2DL The secondary isolation population of 5807 plants was constructed by using 30× resequencing of 56 wheat varieties and combining the wheat genome version 2.1v information. QFhb-2DLPolymorphic sites were mined in the interval and developed into new KASP markers. Six key recombinants in the secondary separation large population were screened. Combined with the phenotypic identification of Fusarium head blight for two years, the target interval was locked at 530.1kb, with a total of 19 candidate genes. The resequencing 30× data and the BSA-seq and 660 KSNP data of the resistant and susceptible mixed pool of the RIL population of Yangmai 5 / Yanzhan 1 were used again to mine the differences distributed in the promoters or within the genes of 19 genes. It was found that there were 3 genes with differences in promoters or coding regions between Yangmai 5 and Yanzhan 1, which were TaFhb-2DL.1 , TaFhb-2DL.2 and TaFhb-2DL Then, the three candidate genes were amplified and tested in Yangmai 5 and Yanzhan 1 respectively from the start codon to 3000bp forward (Table 2). The corresponding KASP markers were developed based on the sequences near the differential SNPs of the three genes and verified in 243 wheat varieties from the south and north of the Huai River. TaFhb-2DL and TaFhb-2DL.1 , TaFhb-2DL.2 Compared with the typing effect of the ergot resistance phenotype, KASP.TaFhb-2DL was the best (Table 3). Therefore, KASP.TaFhb-2DL was used to identify the ergot resistance gene. TaFhb-2DL breeding selection. TaFhb-2DL The main function is to transport oligopeptides, amino acids, glucosinolates, IAA, GA, ABA and other substrates. Its expression is upregulated under nitrogen deficiency, drought and salt stress conditions, indicating that it plays an important role in adverse stress response. There are no reports that it has an effect on resistance to Fusarium head blight. The flanking sequence of KASP.TaFhb-2DL, SEQ ID NO.3, is: TACATGTGGTCGGATAAAAATCGTCACCTCCACTGCACAAC[T / C]ATACCCTTTGCGTCAAATCGCGTCTATAGATTGTAACTCGAGCTGAAGGTAGATG.

[0022] Table 2 Genetic variation of three candidate genes among resistant and susceptible materials

[0023] Table 3 Typing results of linkage markers of three genes for Fusarium head blight resistance and sensitivity phenotype

[0024] Preparation of KASP labeled primer working solution: Take 30 μL (100 μM) of the upstream primer (nucleotide sequence as shown in SEQ ID NO.4) and 12 μL (100 μM) of the downstream primer (nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6), add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP labeled primer working solution for later use.

[0025] PCR amplification reaction system: 2.2 μL of wheat DNA template to be tested (about 30 ng / μL), 0.06 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and add sterile ultrapure water to 5 μL; PCR reaction procedure: (1) 95°C pre-denaturation for 10 min; (2) 95°C denaturation for 20 s, 61–55°C (0.6°C decrease per cycle) for 45 s, for a total of 10 cycles; (3) 95°C denaturation for 20 s, 55°C annealing for 45 s, for 34 cycles; stored at 20°C. A blank control (NTC) without template DNA was set up in the experiment, and one or more blank controls were set up for each plate.

[0026] Wheat seedlings were taken and the CTAB method was used to extract the genomic DNA of the wheat to be tested.

[0027] The genomic DNA of wheat to be tested was used as a template, and the above KASP primer set and PCR reagents were used for PCR amplification to obtain PCR amplification products. The PCR reaction was carried out on an ABI Veriti 384 PCR instrument (Thermo Fisher), and the PCR amplification products were scanned and read with an Omega F SNP typing detector (LGC Genomics Ltd, KBS-0024-002). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm and the emission wavelength was 556 nm, and the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm. Kluster CallerTM (KBioscience) was used for genotyping, and the genotype of KASP.TaFhb-2DL was determined based on the analysis results.

[0028] 243 wheat varieties from Huainan and Huaibei were amplified according to the above method, and the test results are as follows Figure 2As shown. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered at a position close to the X-axis in the fluorescence signal coordinate system of the typing results (blue), which is the same as Yangmai No. 4 (disease-resistant genotype), which proves that the genotype of these wheats at the 42nd base (SNP site) of the molecular marker KASP.TaFhb-2DL flanking nucleotide sequence (such as SEQ ID NO.3) is C; while the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered at a position close to the Y-axis in the coordinate system (red), which is different from the typing of Yangmai No. 4 (disease-susceptible genotype), which proves that the genotype of these wheats at the SNP site is T. The primer set of KASP.TaFhb-2DL is listed in Table 4. The detection results of KASP.TaFhb-2DL in 243 wheat varieties and the related ergot phenotypes are shown in Table 5.

[0029] Table 4 TaFhb-2DL KASP primer sequences

[0030] Note: The underlined part is the linker sequence, SEQ ID NO.4 and SEQ ID NO.5 are two competitive forward primers, and SEQ ID NO.6 is the reverse primer. Table 5 TaFhb-2DL Typing results of resistant and susceptible phenotypes to Fusarium head blight

[0031] Note: R represents the resistant genotype, S represents the susceptible genotype Extract DNA from seeds or seedling leaves using the CTAB method and select genes carrying resistance to Fusarium fusarium QFhb-2DL The parents of Yangmai 17 and Yangmai 18, and Yangmai 18 also carries the ergot resistance gene Fhb1 Yangmai 17 and Yangmai 18 were planted in an artificial climate chamber and hybridized after 3 months. 0 Generation hybrids; F 0 Generation of hybrids, harvest F 2 ; Planting F in greenhouse 2 When the seedlings are young, hang them, take leaves, extract DNA, and use Fhb1 Linked marker detection, select the F gene that is positive (heterozygous or homozygous) 2 , harvest self-bred F 3 ; Select F for greenhouse cultivation 3,use Fhb1 Linked marker detection, select the F gene that is positive (heterozygous or homozygous) 4 . Harvest selected F 4 Planting F in the field 4 , planted in rows, and at the seedling stage, randomly selected leaves of 10 plants in each row and mixed them to extract DNA. Fhb1 Linked marker detection, select the F gene that is positive (heterozygous or homozygous) 4 Individual plants, marked with tags. Harvest F 5 Individual seeds; planted in the fieldF 5 Each plant was planted in 5 rows. At the seedling stage, leaves of 10 plants in each row were randomly selected and mixed to extract DNA. Fhb1 Linked marker detection F 5 The mixed samples of the plants and rows were further tested for genes according to the individual plants to determine the F 5 Genotype of a single plant. Preparation of Gibberella spore suspension 4×10 5 ~5×10 5 Spores / mL, during the flowering period of wheat, 5 Single flower drip inoculation with Fusarium fusae pathogens was performed. 20 ears were inoculated per row of plants with homozygous genotypes, and 20 ears were inoculated per genotype for plants with inconsistent genotypes. The inoculation was carried out at the opened floret in the middle of each ear and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were evenly sprayed for 10 minutes each time. The spraying was stopped immediately after 20 days of flowering. 21 days after inoculation, the disease status of the inoculated ears was investigated, and the number of diseased spikelets per ear and the total number of spikelets were counted. The severity of Fusarium fusae was expressed by the average diseased spikelet rate (PSS), PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively. For F 5 The individual plant genotypes and the results of ergot resistance extension were comprehensively analyzed to clarify the effect of gene combination (Table 6). 5 Single plant, 176 F 5 Each plant carries TaFhb-2DL gene, of which 133 individuals carried homozygous positive Fhb1 Genotype, 20 heterozygous Fhb1 Genotype, 23 were homozygous negative Fhb1 Therefore, a study was conducted on QFhb-2DL Background Fhb1 The effect analysis (Table 7) was performed with Annong 8455 (with TaFhb-2DL Genes and Fhb1 Homozygous negative) was used as the susceptible control, Yangmai 158 (carrying TaFhb-2DL Gene homozygous positive andFhb1 Homozygous negative) as the control of medium resistance, Sumai 3 (carrying Fhb1 and TaFhb-2DL Gene homozygous positive) was used as high-antibody control.

[0032] Table 6 176 F 5 Single plant Fhb1 Genotype and average diseased spikelet rate

[0033] Table 7 QFhb-2DL Background Fhb1 Effect analysis

[0034] Note: Different capital letters after the average diseased spikelet rate indicate extremely significant differences ( p <0.01) From Table 6 and Table 7, we can see that TaFhb-2DL The resistance of single plants to fusarium spores reached the level of moderate resistance to moderate sensitivity, while the Fhb1 After treatment, the average diseased spikelet rate could be reduced by 2.79% to 87.17%, reaching a very significant level. Fhb1 (Positive)+ TaFhb- 2DL The spikelet rate of fusarium head blight in the positive plants was 13.80%, which was significantly lower than that of Sumai No. 3, reaching high resistance. TaFhb-2DL Background import Fhb1 It can greatly improve the resistance level to ergot disease, and the resistance level is higher than that of Sumai No. 3.

[0035] Example 3 Molecular breeding method for breeding varieties with high resistance to scab according to Figure 3 The process shown includes the following steps: 1) Step S1, parents: 390 wheat varieties from all over the country were selected as research objects, and single flower dripping and soil spreading of diseased wheat kernels were used to identify the resistance to extension and infection of Fusarium fusobacterium. 5 ~5×10 5spores / mL. During the flowering period of wheat, the middle florets of the single ear of the marked individual plant were inoculated with the fusarium pathogen by single flower dripping and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were evenly sprayed for 10 minutes each time. The spraying was stopped immediately after 20 days of wheat flowering. 21 days after inoculation, the disease situation of the inoculated ears was investigated, and the number of diseased spikelets per ear and the total number of spikelets were counted. The severity of fusarium spores was expressed as the average diseased spikelet rate (PSS), PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively; Anti-infection identification: Prepare fusarium spore suspension 2×10 5 ~3×10 5 Spores / mL, spray the spores of Fusarium head blight on a fixed number of marked plants during the flowering period of wheat, and investigate the diseased ear rate and diseased spikelet rate (PIS) of the plants sprayed with spores in this area 21 days later to identify the resistance to Fusarium head blight infection. Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively. At the same time, the yield of 390 varieties was identified in the yield identification nurseries in Yangzhou and Nanjing, mainly for plant height, growth period, number of ears per plant, number of grains per ear, and thousand-grain weight. With Yangmai 25 as the control, after three years of Fusarium head blight resistance and anti-expansion identification, agronomic traits and yield identification, the varieties Yangmai 11, Yangmai 14, Yangmai 17, Yangmai 18, Yangmai 39, Ningmai 13, Ningmai 26, Zhenmai 12, Zhenmai No. 5, Zhenmai No. 6, and Shengxuan No. 6 were screened out for resistance to Fusarium head blight and high yield potential. The CTAB method was used to extract DNA from seeds or seedling leaves of the above varieties, and it was confirmed that these 11 varieties all carried TaFhb-2DL Yangmai 18 and Ningmai 13 also carry genes for resistance to fusarium head blight Fhb1 Yangmai 14 and Ningmai 13 were selected as parents and planted in an artificial climate chamber for hybridization and harvesting. 0 Generation hybrids; F 0 Generation of hybrids, harvest F 1 Then it was hybridized with Yangmai 14 and BC was obtained. 1 F 1 seed; 2) Step S2, planting BC in the artificial climate chamber in Yangzhou 1 F 1 When the seedlings are young, hang them, take leaves, and extract DNA. In order to avoid natural outcrossing or rare natural mutations in wheat, use TaFhb-2DL Gene linkage marker detection, select the single plant with positive homozygous at this site, and harvest BC 1 F 2 ; 3) Step S3, select BC in Yangzhou greenhouse planting 1 F 2 ,use Fhb1Linked marker detection, select BCs with positive loci (heterozygous or homozygous) 1 F 2 Single plant, with Yangmai 25 as yield control, tillering, lodging resistance, growth period and disease resistance were screened, and BC was selected in the harvest. 1 F 3 seed; 4) Step S4, planting BC in the field in Yangzhou 1 F 3 Each plant was planted in 3 rows, with a row length of 2.0m and a row spacing of 0.23m, and 20 seeds per row. At the seedling stage, leaves of 10 plants in each row were randomly selected and mixed for DNA extraction. Fhb1 Linked marker detection BC 1 F 3 The mixed samples of the plants and rows were further tested for genes of the plants with heterozygous results according to the individual plants to clarify the BC 1 F 3 The genotypes of individual plants were screened out, and 13 strains carrying Fhb1 There were 1 homozygous positive and 1 heterozygous positive strain (Table 8). 5 ~5×10 5 Spores / mL, during the flowering period of wheat, BC 1 F 3 Single flower drip inoculation with Fusarium fusae pathogens was performed. 20 ears were inoculated per row of plants with homozygous genotypes, and 20 ears were inoculated per single plant with inconsistent genotypes in the rows. The inoculation was carried out at the opened floret in the middle of each ear and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were evenly sprayed for 10 minutes each time. The spraying was stopped immediately after the wheat bloomed for 20 days. 21 days after inoculation, the disease status of the inoculated ears was investigated, the number of diseased spikelets per ear and the total number of spikelets were counted, and the average diseased spikelet rate (PSS) was recorded, PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively, and Yangmai 25 was used as a medium resistance control. According to the identification of the rows, 12 rows and 1 row with the identification results of "high resistance" (average diseased spikelet rate ≤ 25%) were retained. Fhb1 The "highly resistant" plants in the heterozygous plant rows were selected. Then, according to the breeding objectives, the comprehensive agronomic traits and disease resistance of each plant in the selected plant rows were comprehensively examined. The plant height was less than 90 cm, and the yield factors included the number of spikelets per plant greater than or equal to 9, the number of spikelets greater than 20, and the number of grains per spike greater than or equal to 49. A total of 30 excellent plants were selected (Table 1). After harvest, the grain weight was identified, and BC with a grain weight level higher than that of the yield control Yangmai 25 was selected. 1 F 4 Single plant; Table 8 BC 1 F4 Carry Fhb1 Results of the selected plants in the positive rows

[0036] Note: PSS means the average diseased spikelet rate. The black and bold ones are the selected plants. The number of tillers refers to the number of tillers per plant.

[0037] 5) Step S5, planting BC in the field in Yangzhou 1 F 4 , planted into plant lines, 5 rows per plant line, row length 2.25m, row spacing 0.26m, 40 seeds per row, and continued to use single flower drip inoculation to identify the resistance to ergot disease. Sumai No. 3 and Annong 8455 were used as high-resistance and high-susceptibility controls, respectively, and Yangmai 25 was used as a medium-resistance control. Y569-4, Y569-5, Y619-2, Y619-4, Y627-2, Y627-3, Y1001-1, Y1001-3, Y1001-4 and Y1079-4 with higher resistance levels than Sumai No. 3 were screened out (Table 9). The comprehensive agronomic traits and disease resistance of the selected lines were comprehensively investigated. The grain weight and yield of the selected lines were identified after mixed harvesting. Yangmai 25 was used as the yield control for comparison. The grain weight of Yangmai 25 was 49 g and the average yield was 569.68 kg / mu. The yield levels of Y569-4 and Y619-2, which were higher than the control Yangmai 25, were 609.82 kg / mu and 623.52 kg / mu, respectively, which were 6.58% and 9.45% higher than that of Yangmai 25 (Table 9). Table 9 Test results of various strains with resistance levels close to Sumai No. 3

[0038] Note: PSS stands for the average diseased spikelet rate, and the black bold ones are the selected plants.

[0039] 6) Step S6, planting BC of Y569-4 and Y619-2 in the field 1 F 5 In the 2-cm plot, according to the breeding goal, the comprehensive agronomic traits of the plot varieties were comprehensively investigated, and the yield was identified after harvest. With Yangmai 25 as the yield control, the average yield of Yangmai 25 was 579.41 kg / mu, and the average yields of Y569-4 and Y619-2 were 617.91 kg / mu and 619.38 kg / mu, respectively, which were 6.64% and 6.90% higher than Yangmai 25. The results showed that the yields of Y569-4 and Y619-2 were higher than the control variety Yangmai 25 in the middle and lower reaches of the Yangtze River for two consecutive years, reaching more than 5%, and the resistance to fusarium head blight was significantly higher than that of the fusarium head blight-resistant variety Sumai No. 3, and it can be recommended to enter the multi-point yield identification test.

[0040] The high-yield wheat lines Y569-4 and Y619-2 bred by the method of the present invention carry the fusarium resistant gene TaFhb-2DL and Fusarium head blight resistance genes Fhb1 The resistance to ergot disease has stably reached the level of "high resistance", which is higher than the level of Sumai No. 3, and the yield is significantly higher than that of the control Yangmai 25, which can contribute to improving the quality, yield, efficiency and green high yield of wheat.

[0041] The above method of the present invention first selects the main effect loci of resistance to scab in natural populations through genotype detection. QFhb-2DL The disease-resistant genotype is used as the parent, and then the genotype test is used to select the Fhb1 Genetic varieties as donors, due to QFhb-2DL As a stable disease resistance locus, it can be effectively used in wheat breeding for resistance to Fusarium head blight in the middle and lower reaches of the Yangtze River. Fhb1 Gene, the embodiment proves that it can significantly improve the resistance level of Fusarium head blight, even exceeding the level of Sumai No. 3. TaFhb-2DL and Fhb1 The aggregation of fusarium head blight resistance and the precise identification of agronomic traits can quickly and effectively select varieties with high resistance to fusarium head blight. The donor gene source used comes from common wheat varieties, which is different from the resistance source with poor agronomic traits such as Sumai No. 3 and Wangshuibai, and can be quickly used in breeding. TaFhb-2DL and Fhb1 The resistance genotypes of the two can significantly improve the resistance to fusarium head blight. Therefore, the use of these two fusarium head blight resistance loci can effectively breed varieties with high resistance to fusarium head blight.

[0042] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0043] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0044] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A molecular marker linked to wheat resistance to scab, characterized in that: comprising a flanking sequence as shown in SEQ ID NO.3 TaFhb-2DL KASP markers of genes.

2. The molecular marker according to claim 1, characterized in that Also includes Fb1 Chain GSM tag.

3. The primer used for the molecular marker according to claim 1, characterized in that: It includes forward primers as shown in SEQ ID NO.4 and SEQ ID NO.5, and a reverse primer as shown in SEQ ID NO.

6.

4. The primer used for molecular marker according to claim 2, characterized in that: TaFhb-2DL The primers used for the KASP marker of the gene include forward primers as shown in SEQ ID NO.4 and SEQ ID NO.5, and a reverse primer as shown in SEQ ID NO.6; Fb1 The primers used for the linked GSM marker include the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.

2.

5. A molecular breeding method for breeding varieties with high resistance to scab, characterized in that: The following steps are involved: Step S1, using the method of single flower dripping and soil spreading of diseased wheat kernels to identify the selected wheat varieties for resistance to fusarium head blight, resistance to infection and yield, and screening out varieties with resistance to fusarium head blight and high yield potential; extracting DNA from seeds or seedling leaves of the above varieties, and using TaFhb-2DL Linked markers of genes clearly carry the scab resistance locus QFhb-2DL Varieties, additional testing Fb1 Linked markers, clearly also carrying fusarium resistance genes Fb1 The varieties were planted in an artificial climate chamber, hybridized and matched, and F0 hybrids were harvested; F0 hybrids were planted in an artificial climate chamber to obtain F1, and F1 was then hybridized with Yangmai 14 to obtain BC1F1 seeds; Step S2, planting BC1F1, and when the seedlings emerge, extracting DNA from leaves, using TaFhb-2DL Linkage marker detection of the gene, select BC1F1 plants that are homozygous for all positive loci, and harvest BC1F2; Step S3, select BC1F2 in planting, use Fb1 Linked marker detection, select BC1F2 plants with positive loci (heterozygous or homozygous), screen for tillering, lodging resistance, growth period and disease resistance, and harvest the selected BC1F3 seeds; Step S4, planting BC1F3, randomly selecting leaves of individual plants at the seedling stage, mixing them, extracting DNA, and using Fb1 The linked markers were tested for BC1F3 in mixed samples. For the mixed samples with heterozygous results, the genes were further tested on a single plant basis to determine the genotype of the BC1F3 single plant and screen out the carriers. Fb1 Homozygous positive and heterozygous positive plant rows; During the flowering period of wheat, BC1F3 was inoculated with fusarium scaber pathogens in single flowers at the blooming stage. After 21 days of inoculation, the disease situation of the inoculated ears was investigated, and the plant rows and individual plants with "high resistance" identification results were retained. Then, according to the breeding goals, the comprehensive agronomic traits and disease resistance of each individual plant in the selected plant rows were comprehensively investigated. After harvest, the grain weight was identified, and the BC1F4 individual plants with grain weight levels higher than the yield control were selected; Step S5, planting BC1F4, growing into strains, continuing to use single flower drip inoculation to identify the resistance to fusarium head blight, and screening strains with a resistance level higher than Sumai No. 3; comprehensively investigating the comprehensive agronomic traits and disease resistance of the selected strains, and mixing the selected strains, and identifying the grain weight and yield after harvesting, and selecting strains with yield levels higher than the yield control; Step S6, selecting BC1F5 in the planting plot, comprehensively examining the comprehensive agronomic traits of the plot strain according to the breeding goal, and conducting yield identification after harvest. If the yield of the selected BC1F5 is higher than that of the control variety by more than 5% for two consecutive years, and the scab resistance is higher than that of the scab-resistant variety Sumai No. 3, it can be recommended to enter the yield multi-point identification test; in, TaFhb-2DL The gene linkage marker is the one described in claim 1 TaFhb-2DL KASP markers of genes, Fb1 The linked marker is the one described in claim 2 Fb1 The primer set used is the primer set described in claim 4.

6. The breeding method according to claim 5, characterized in that In step S1, the anti-extension identification method is as follows: prepare a suspension of 4×10 spores of Gibberella 5 ~5×10 5 spores / mL, during the flowering period of wheat, the florets in the middle of the single ear of the marked individual plant were inoculated with the pathogen of Fusarium fusae by single flower dripping, and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were evenly sprayed for 10 minutes each time. The spraying was stopped immediately after the wheat bloomed for 20 days; 21 days after inoculation, the disease situation of the inoculated ears was investigated, and Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively; The method for identifying the resistance to infection is as follows: prepare a suspension of 2×10 spores of Gibberella 5 ~3×10 5 Spores / mL, spray the spores of Fusarium head blight on a fixed number of marked plants at the flowering stage of wheat, investigate the diseased ear rate and diseased spikelet rate of the plants sprayed with spores in this area 21 days later, and identify the resistance to Fusarium head blight infection, Sumai No. 3 and Annong 8455 were used as high resistance and high sensitivity controls, respectively; The yield identification method is: mainly identifying plant height, growth period, number of ears per plant, number of grains per ear, and 1000-grain weight, with Yangmai 25 as the control. After three years of identification of resistance to infection and spread of fusarium head blight, agronomic traits and yield identification, varieties with resistance to fusarium head blight and high yield potential were selected; The CTAB method was used to extract DNA from seeds or seedling leaves of the above varieties. TaFhb-2DL The linkage markers of the gene clearly show that Yangmai 11, Yangmai 14, Yangmai 17, Yangmai 18, Yangmai 39, Ningmai 13, Ningmai 26, Zhenmai 12, Zhenmai 5, Zhenmai 6, and Shengxuan 6 all carry the scab resistance locus. QFhb-2DL , and additional detection Fb1 Linked markers confirm that Yangmai 18 and Ningmai 13 also carry the scab resistance gene Fb1 Yangmai 14 and Ningmai 13 were selected as parents and planted in an artificial climate chamber for hybridization and matching. The F0 hybrid seeds were harvested to obtain F1, and the F1 was then hybridized with Yangmai 14 to harvest BC1F1 seeds.

7. The breeding method according to claim 5, characterized in that In step S3, the screening method for tillering, lodging resistance, growing period and disease resistance of the BC1F2 generation is as follows: disease resistance is based on Yangmai 25, and individual plants with disease resistance worse than that of Yangmai 25 are eliminated; the tillering quality and the length of the growing period are judged using Yangmai 25 as the control, and individual plants with less tillers per plant than Yangmai 25 and a growing period later than that of Yangmai 25 are eliminated; the screening for lodging resistance is based on examining the plant height, stem elasticity and lodging resistance, and individual plants that are prone to lodging, have poor elasticity and have a plant height greater than 90 cm are eliminated.

8. The breeding method according to claim 5, characterized in that In steps S4 and S5, the method of drip-inoculating the fusarium pathogen on a single flower of a row during the flowering period is as follows: 4×10 fusarium spore suspension is prepared. 5 ~5×10 5 spores / mL. In the field, during the flowering period of wheat, single flower drip inoculation was used. 20 ears were randomly selected from each row or strain, and inoculated at the opened floret in the middle of each ear, and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were sprayed evenly and fully for 10 minutes each time. The spraying was stopped immediately after the wheat bloomed for 20 days. 21 days after inoculation, the disease status of the inoculated ears was investigated, the number of diseased spikelets per ear and the total number of spikelets were counted, and the rows or individual plants with an average diseased spikelet rate ≤25% were retained. Sumai No. 3 and Annong 8455 were used as high-resistant and high-susceptibility controls, respectively, Yangmai 25 was used as a medium-resistant control, and Yangmai 13 was used as a medium-susceptibility control.

9. The breeding method according to claim 5, characterized in that: In steps S4, S5 and S6, the method for comprehensively examining the comprehensive agronomic traits of the selected plant rows, plant lines and varieties is: plant height less than 90 cm, the number of ears per plant greater than or equal to 9, the number of spikelets greater than 20, and the number of grains per ear greater than or equal to 49 are excellent standards.

10. The breeding method according to claim 5, characterized in that: In steps S4, S5 and S6, the yield control is Yangmai 25.

Images