Molecular marker for identifying and distinguishing litchis, longans and lychee pumila and application of molecular marker

Abstract

The invention provides a molecular marker for identifying and distinguishing litchis, longans and lobelia pumila. The molecular marker is composed of three DNA (deoxyribonucleic acid) sequences containing indel. The invention also provides a method for identifying and distinguishing lychee, longan and dragon litchi by using the molecular marker, total DNA (deoxyribonucleic acid) of a sample is extracted, then high-throughput sequencing is performed, sequencing reads are compared to the molecular marker, and if the molecular marker can be completely covered, the species of the sample to be detected is judged to be the corresponding species.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to molecular markers for identifying and distinguishing litchi, longan and longan lychee, and applications thereof. Background Art

[0002] Litchi (Litchi chinensis), longan (Dimocarpus longan) and dragon lychee (Dimocarpus confinis) are all fruits belonging to the Sapindaceae family. They are related in plant taxonomy and have a long history of cultivation in China and Southeast Asia. Both lychee and longan are evergreen trees and belong to the same family, but lychee and longan are different species. Litchi and longan are both in the Sapindaceae family, but belong to the genus Litchi and Dimocarpus confinis respectively. Therefore, it is difficult to tell the difference between the two from the tree, appearance, number of flowers, and even when the fruit is immature. Only when the fruits of the two are ripe can the difference between the two fruits be distinguished by the appearance of the fruit. Dragon lychee and longan belong to the same genus, also in the Sapindaceae family, and the appearance of the tree is similar to that of lychee and longan. The earliest document that recorded the dragon lychee was Fan Dacheng's Guihai Yuhengzhi (1162 AD): "The dragon lychee has a shell like a lychee, and the flesh tastes like a longan. The wood is like two fruits, hence the name. It can be steamed and eaten, but not eaten raw, as it can cause epilepsy or ghosts. It blooms small white flowers in March, at the same time as lychees." Song Zhou Qufei's Lingwai Daida (1174-1177) also said: "There is a kind of dragon lychee in Jingjiang (now Guilin), the skin is like a lychee, the flesh is like a longan, and its leaves and taste have the characteristics of both fruits. The skin is green when it is ripe, and then turns yellow. It can be steamed and eaten like a ripe chestnut, but it cannot be eaten raw, as it can cause epilepsy. Eating too much can cause phlegm, at the same time as lychees." Ancient books clearly record that the dragon lychee can "cause epilepsy or ghosts", so it is commonly known as the "crazy fruit"! Crazy fruit, also known as dragon lychee, is scientifically known as Xiao Shaozi, and is poisonous, with the kernel being the most toxic, and is similar to longan.

[0003] Since litchi, longan and longan are widely grown in the wild and cultivated, and the phenotypes of different plants are similar in the seedling stage and even in the seedling stage, it is difficult to distinguish them. Currently, there is no molecular marker for accurate identification and differentiation of litchi, longan and longan. Summary of the invention

[0004] The present invention mainly aims at the above technical problems. We use a method based on the second generation sequencing to obtain specific fragments in the genomes of litchi, longan and longli. After analysis, the fragments are not highly homologous to the genomes of any existing plants, and are suitable as reference sequences for the identification of litchi, longan and longli. Further, a reliable method for identifying and distinguishing litchi, longan and longli was designed using sequencing data. The technical solution adopted by the present invention is: On the one hand, the method provides a molecular marker for identifying or assisting in the identification and differentiation of litchi, longan and / or longan, wherein the sequence of the molecular marker comprises sequences as described in SEQ ID NO.1, SEQ ID NO.2 and / or SEQ ID NO.3, wherein SEQ ID NO.1 is a molecular marker for identifying litchi, SEQ ID NO.2 is a molecular marker for identifying longan, and SEQ ID NO.3 is a molecular marker for identifying longan.

[0005] On the other hand, another object of the present invention is to provide the use of the above-mentioned molecular markers in the identification and differentiation or auxiliary identification and differentiation of litchi, longan and / or longan.

[0006] In another aspect, the present invention provides a method for identifying or assisting in identifying litchi, longan and / or longan, characterized in that it comprises the following steps: 1) Collect the green tissue of the plant to be tested as the sample to be tested; 2) Extract the total DNA of the sample to be tested; 3) Performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Align the sequencing reads to SEQ ID NO. 1~SEQ ID NO. 3, and assemble the reads of each sample alignment into contigs separately; 5) Perform sequence comparison between the assembled contigs and the molecular markers, and determine the species of the sample to be tested based on the comparison results; if it is consistent with the SEQ ID NO. 1 sequence, the species of the sample to be tested is judged to be litchi, if it is consistent with the SEQ ID NO. 2 sequence, the species of the sample to be tested is judged to be longan, and if it is consistent with the SEQ ID NO. 3 sequence, the species of the sample to be tested is judged to be longan.

[0007] In another aspect, the present invention provides a method for identifying or assisting in identifying litchi, longan and / or longan, characterized in that it comprises the following steps: 1) Collect the green tissue of the plant to be tested as the sample to be tested; 2) Extract the total DNA of the sample to be tested; 3) Perform high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) aligning the above sequencing reads to the molecular markers of claim 1; 5) Determine whether the sample contains litchi, longan or longan according to the coverage of sequencing reads on DNA molecular markers; if SEQ ID NO. 1 can be completely covered and a consistent sequence that is completely consistent with SEQ ID NO. 1 can be generated, it is determined that the species of the sample to be tested includes litchi; if SEQ ID NO. 2 can be completely covered and a consistent sequence that is completely consistent with SEQID NO. 2 can be generated, it is determined that the species of the sample to be tested includes longan; if SEQID NO. 3 can be completely covered and a consistent sequence that is completely consistent with SEQ ID NO. 3 can be generated, it is determined that the species of the sample to be tested includes longan.

[0008] In one embodiment, if the above-mentioned sequencing samples are independent samples, the species of the samples can be directly determined in step 5); if the above-mentioned samples are mixed samples, the samples identified in step 5) are grouped and multiple rounds of identification are performed until the species of the individual samples are identified.

[0009] In one embodiment, the high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

[0010] In one embodiment, in step 3), any one of Geneious, Bowtie, Tophat, bwa or HISAT software is used to align reads.

[0011] In one embodiment, SEQ ID NO. 1 to SEQ ID NO. 3 are used alone.

[0012] In one embodiment, SEQ ID NO. 1 to SEQ ID NO. 3 are used in combination.

[0013] The beneficial effects of the present invention are: First, the present invention provides for the first time a specific fragment in the genome of litchi, longan and longli. After analysis, it is found that the fragment has no high homology with the genome of any other existing plants and is suitable as a reference sequence for identification of litchi, longan and longli.

[0014] Second, the present invention can extract total DNA from mixed samples, such as directly collecting green tissues, obtain DNA information of the samples through high-throughput sequencing, and identify whether the samples contain litchi, longan and / or longan by comparing with reference sequences.

[0015] Third, high-throughput sequencing is used directly, without the need for primer design, thus avoiding the difficulty of primer design, and making the operation easy and sensitive.

[0016] Fourthly, the present invention also provides three specific markers, which can be used alone or in combination according to the purpose of identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The present invention is described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0018] Figure 1 It is the result of multiple sequence alignment of SEQ ID NO. 1~3.

[0019] Figure 2 This is the comparison result of SEQ ID NO.1 in the nr / nt library of NCBI.

[0020] Figure 3 This is the comparison result of SEQ ID NO. 2 in the nr / nt library of NCBI.

[0021] Figure 4 This is the comparison result of SEQ ID NO.3 in the nr / nt library of NCBI.

[0022] Figure 5 It is the result of multiple sequence alignment of the sequencing assembly sequence of 5 independent individuals of each plant and SEQ ID NO. 1~3 Figure 6 These are the mapping results of the sequencing reads containing litchi to SEQ ID NOs. 1 to 3, where A is the mapping of SEQ ID NO. 1, B is the mapping of SEQ ID NO. 2, and C is the mapping result of SEQ ID NO. 3.

[0023] Figure 7 These are the mapping results of the sequencing reads containing longan to SEQ ID NOs. 1 to 3, where A is the mapping of SEQ ID NO. 1, B is the mapping of SEQ ID NO. 2, and C is the mapping result of SEQ ID NO. 3. Figure 8 These are the mapping results of the sequencing reads containing Longli to SEQ ID NOs. 1 to 3, where A is the mapping of SEQ ID NO. 1, B is the mapping of SEQ ID NO. 2, and C is the mapping result of SEQ ID NO. 3. DETAILED DESCRIPTION

[0024] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by ordinary technicians in the technical field to which this application belongs.

[0026] Example 1 Development of molecular markers for identifying litchi, longan and longan The present invention uses the second generation sequencing, assembly and comparative analysis to determine the molecular marker standard detection sequence that can identify and distinguish litchi, longan and longan. The specific sequences are SEQ ID NO.1 (litchi), SEQ ID NO.2 (longan), SEQ ID NO.3 (longan), and the three sequences are compared ( Figure 1 ) showed that the length difference between each sequence was at least 20 bp, the shortest was 212 bp for Longli, followed by 357 bp for Litchi, and the longest was 383 bp for Longan.

[0027] 5'-ATTCGGAATGCAAAGCGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATCCTATTGGACGCAATTTATTTGTATTCCCATTCTATATAGAATATAATTTCCTATGATCTAACATGATATTATTAGATTAATAAATTATTAATTTAATAATTTTCA AATAAAAAGTAAAATTATTTATACTTCTATCTTATTTGTTTTATGTATACTTCTATCTTATTTATTTATTTTATTAATAGTCAATATTAAATTAAGTACTATAAAGATTAAGAGTGATCGAATTTTTATTTATATTTGTTCCTGAAGTAGAAAACGTTCCATTTGTTCCTGAATCCC-3'(SEQ IDNO.1); 5'-ATTCGGAATGCAAAGCGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATCCTATTGGACGCAATTTATTTGTATTCCCATTCTATATAGAATATATAGAATATAATTTTCTTATGATCTAACATGATATTATTAGATTAATAAATTATTAATTTAATAATTTTCAAATA AAAAAGAAAATTATTTATACTTCTATCTTATTTAGACTTATATCTTATTTGTTTTATGTATACTTCTATCTTATTTATTTATTTTATTAATAGTCAATATTAAATTAAGTACTATAAAGATTAAGAGTGATCGAATTTTTATTTATATTTGTTCCTGAAGTAGAAAACGTTCCATTTGTTCCTGAATCCC-3'(SEQ ID NO.2); 5'-ATTCGGAATGCAAAGCGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATCCTATTGGACGCAATTTATTTGTATTCCCATTCTATATAGAATATATAGAATATAATTTTCTTAAAAGATTAAGAGTGATCGAATTTTTATTTATATTTGTTCCTGAAGTAGAAAACGTTCCATTTGTTCCTGAATCCC-3' (SEQ ID NO. 3); Example 2 Sequence comparison of molecular markers of litchi, longan and longli with related species In order to determine whether the molecular markers of the present invention are species specific, the molecular markers of the present invention were compared using the blast program of Geneious Prime, selecting the nr / nt library, not limiting the species, and keeping the other parameters as default. Figure 2~Figure 4 As shown, it was found that the closely related species of the molecular markers of the present invention in the nr / nt library of NCBI were all plants of the Sapindaceae family. Figure 2 The molecular markers of litchi showed that the species had 100% sequence identity with the known litchi. Figure 3 The molecular markers of longan showed that the species had 100% sequence identity with the known longan. Figure 4The molecular marker of Longli has the highest similarity with Acertataricum, which belongs to the Sapindaceae family, but the coverage of the two is only 98.58%, and the consistency is only 85.1%, indicating that the molecular marker of Longli is a new sequence for this species. It can be seen that the molecular marker of the present invention has extremely strong specificity.

[0028] Example 3 Identification method of litchi, longan and longan 1) Collect green tissues of the plants to be tested as samples to be tested; 2) Extract the total DNA of the sample to be tested; 3) Performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) Align the sequencing reads to SEQ ID NO. 1~SEQ ID NO. 3, and assemble the reads of each sample alignment into contigs separately; 5) Perform sequence comparison between the assembled contigs and the molecular markers, and determine the species of the sample to be tested according to the comparison results; if it is consistent with the SEQ ID NO. 1 sequence, the species of the sample to be tested is judged to be litchi, if it is consistent with the SEQ ID NO. 2 sequence, the species of the sample to be tested is judged to be longan, and if it is consistent with the SEQ ID NO. 3 sequence, the species of the sample to be tested is judged to be longan.

[0029] Test results such as Figure 5 The sequences of 5 independent sequencing samples of each species are consistent with the molecular marker sequences of the corresponding species of the present invention.

[0030] Embodiment 4 Identification method 2 of litchi, longan and longan 1) Collect green tissues of the plants to be tested as samples to be tested; 2) Extract the total DNA of the sample to be tested; 3) Performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) Using Geneious software, the above sequencing reads were aligned to the DNA molecular markers described in the present application, allowing 1% mismatch or gap for each read, and other parameters were set to default; 5) judging whether the sample contains litchi, longan or longan according to the coverage of the sequencing reads on the DNA molecular markers; if SEQ ID NO. 1 can be completely covered and a consistent sequence completely consistent with SEQ ID NO. 1 can be generated, it is judged that the species of the sample to be tested includes litchi; if SEQ ID NO. 2 can be completely covered and a consistent sequence completely consistent with SEQ ID NO. 2 can be generated, it is judged that the species of the sample to be tested includes longan; if SEQ ID NO. 3 can be completely covered and a consistent sequence completely consistent with SEQ ID NO. 3 can be generated, it is judged that the species of the sample to be tested includes longan; 6) If the above sequencing samples are independent samples, the species of the samples can be directly determined in step 5); if the above samples are mixed samples, the samples identified in step 5) are grouped and multiple rounds of identification are performed until the species of the individual samples are identified.

[0031] Test results such as Figure 6~Figure 8 As shown, 6 is a sample containing litchi. The figure shows that the sequencing reads completely cover the reference sequence SEQ ID NO. 1 and generate a consistent sequence that is completely consistent with the molecular marker sequence, but cannot completely cover SEQ ID NO. 2 and SEQ ID NO. 3. Figure 7 For samples containing longan, the figure shows that the sequencing reads fully cover the reference sequence SEQ ID NO. 2 and generate a consensus sequence that is completely consistent with the molecular marker sequence, but cannot fully cover SEQ ID NO. 1 and SEQ ID NO. 3. Figure 8 This is a sample containing Longli. The figure shows that the sequencing reads fully cover the reference sequence SEQ ID NO. 3 and generate a consensus sequence that is completely consistent with the molecular marker sequence, but cannot fully cover SEQ ID NO. 1 and SEQ ID NO. 2.

[0032] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A molecular marker for identifying and distinguishing or assisting in identifying litchi, longan and / or longan, characterized in that: The sequence of the molecular marker comprises SEQ ID NO.1, SEQ ID NO.2 and / or SEQ ID NO.3, wherein SEQ ID NO.1 is a molecular marker for identifying litchi, SEQ ID NO.2 is a molecular marker for identifying longan, and SEQ ID NO.3 is a molecular marker for identifying longan.

2. A method for identifying and distinguishing or assisting in identifying litchi, longan and / or longan, characterized in that: The following steps are involved: 1) Collect the green tissue of the plant to be tested as the sample to be tested; 2) Extract the total DNA of the sample to be tested; 3) Performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Align the sequencing reads to SEQ ID NO. 1~SEQ ID NO. 3, and assemble the reads of each sample alignment into contigs separately; 5) Perform sequence comparison between the assembled contigs and the molecular markers, and determine the species of the sample to be tested according to the comparison results; if it is consistent with the SEQ ID NO. 1 sequence, the species of the sample to be tested is judged to be litchi, if it is consistent with the SEQ ID NO. 2 sequence, the species of the sample to be tested is judged to be longan, and if it is consistent with the SEQ ID NO. 3 sequence, the species of the sample to be tested is judged to be longan.

3. A method for identifying and distinguishing or assisting in identifying and distinguishing litchi, longan and / or longan, characterized in that The following steps are involved: 1) Collect the green tissue of the plant to be tested as the sample to be tested; 2) Extract the total DNA of the sample to be tested; 3) Perform high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) aligning the above sequencing reads to the molecular markers of claim 1; 5) Determine whether the sample contains litchi, longan or longan according to the coverage of the sequencing reads on the DNA molecular markers; if SEQ ID NO. 1 can be completely covered and a consistent sequence completely consistent with SEQ ID NO. 1 can be generated, it is determined that the species of the sample to be tested includes litchi; if SEQ ID NO. 2 can be completely covered and a consistent sequence completely consistent with SEQ ID NO. 2 can be generated, it is determined that the species of the sample to be tested includes longan; if SEQ ID NO. 3 can be completely covered and a consistent sequence completely consistent with SEQ ID NO. 3 can be generated, it is determined that the species of the sample to be tested includes longan.

4. The method according to claim 3, characterized in that If the above-mentioned sequencing samples are independent samples, the species of the samples can be directly determined in step 5); if the above-mentioned samples are mixed samples, the samples identified in step 5) are grouped and multiple rounds of identification are performed until the species of the individual samples are identified.

5. The method according to any one of claims 2 to 4, characterized in that: The high-throughput sequencing described in step 2) is second-generation sequencing or third-generation sequencing.

6. The method according to any one of claims 2 to 4, characterized in that: In step 3), use Geneious, Bowtie, Tophat, bwa or HISAT to align reads.

7. Use of the molecular marker according to claim 1 as a reference sequence in identifying or assisting in identifying litchi, longan and / or longan.

Images