Kit and method for rapidly detecting reeling flowers based on RPA-CRISPR / Cas

Abstract

The invention discloses a kit and a method for rapidly detecting reeling flowers based on RPA-CRISPR / Cas, the Cas protein is Cas12, and the kit comprises an RPA primer combination F2 / R3 and sgRNA3. The detection method provided by the invention utilizes the kit for detection, and comprises the following steps: S1, extracting DNA of a sample to be detected; s2, RPA amplification: preparing an RPA reaction system, and amplifying the extracted DNA of the to-be-detected sample through an RPA method to obtain an amplification product; and S3, CRISPR / Cas system reaction detection: taking the amplification product, adding a fluorescent report probe, Cas12 protein and sgRNA, carrying out CRISPR reaction detection, and reading a detection signal. The method disclosed by the invention can be used for quickly distinguishing the rosa roxburghii tratt and the related cross species on site, and effectively identifying adulterated or adulterated components of raw materials in rosa roxburghii tratt plant products.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection and identification, and in particular to a kit and method for rapid detection of silkworms based on RPA-CRISPR / Cas. Background Art

[0002] Rosa roxburghii Tratt., also known as roxburghii, is a perennial deciduous shrub of the genus Rosa in the Rosaceae family. It is mainly distributed in Yunnan, Guizhou, Sichuan and Hunan. The resources of roxburghii in Guizhou are the most abundant, with the highest annual output. It has become a key economic crop for both medicinal and edible purposes in Guizhou Province. Its fruit is rich in vitamins, amino acids, phenols, flavonoids and other nutrients and bioactive ingredients, especially vitamin C, vitamin P and superoxide dismutase, which are the highest among fruits and vegetables. It is known as the "King of Vitamin C, Three Kings Fruit". With the continuous deepening of the research on the botanical characteristics and related bioactive ingredients of roxburghii, there are many products using roxburghii as raw materials. As a dual-purpose medicinal and edible plant, it has been included in the "Quality Standards for Traditional Chinese Medicines and Ethnic Medicinal Materials in Guizhou Province" (2003 Edition) and the Ministry of Health's New Food Resource Varieties (Announcement No. 17, 2004). It is currently being vigorously developed as a key dual-purpose medicinal and edible plant resource. With the increasing demand year by year, the contradiction between supply and demand in the market has become increasingly severe.

[0003] In recent years, the identification technology of plant-derived ingredients is mostly limited to laboratory operations, relying on expensive instruments or requiring professionals to perform complex result analysis, which cannot meet the needs of accurate and rapid identification of plant-derived ingredients. As a new gene editing technology, the CRISPR system has been transformed into an ultra-sensitive nucleic acid detection tool because the Cas protein in the system has trans-cutting ability and highly specific sequence recognition ability. At present, the CRISPR system has been applied to virus and bacterial diagnosis and identification of pig-derived ingredients, but there are few reports on the identification of plant-derived ingredients.

[0004] The combination of RPA and CRISPR can greatly improve the specificity of detection by performing dual specific recognition of target genes. Both the RPA and CRISPR cutting systems are performed at 37°C. Human body temperature or USB-powered incubators, constant temperature heaters, etc. can provide the required temperature conditions without the need for complex temperature control equipment. Currently, there are few reports on the application of RPA-CRISPR in the identification of silk flowers. Summary of the invention

[0005] The object of the present invention is to provide a kit and method for rapid detection of silk flower based on RPA-CRISPR / Cas in response to the above problems.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a kit for rapid detection of silkworms based on RPA-CRISPR / Cas, wherein the Cas protein is Cas12, and the kit comprises RPA primers and sgRNA, wherein the RPA primers are primer combination F2 / R3, and the sequence is as follows:

[0008] F2: 5'-GCCACGACAATCGGTGGTTGTCAAACCTCG-3',

[0009] R3: 5'-GAAAGCATCGACGGATCGACACGTATTAT-3',

[0010] The sgRNA is sgRNA3, and its sequence is:

[0011] GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAACUUCAAGCGAAGUGGCACCUGUCGUGCGAUCGUGUUGA.

[0012] Preferably, the kit further comprises a fluorescent reporter probe, and preferably the sequence of the fluorescent reporter probe is: 5'-FAM-TTTTTTT-BHQ1-3'.

[0013] Preferably, the kit further comprises an RPA amplification reagent, and the RPA amplification reagent comprises: RPA enzyme and magnesium acetate.

[0014] Preferably, the kit further comprises a CRISPR / Cas detection reagent, wherein the CRISPR / Cas detection reagent comprises: a Cas12b protein, wherein the Cas12b protein is selected from AaCas12b, AacCas12b, and BrCas12b.

[0015] The second aspect of the present invention provides use of any of the above-mentioned kits in detecting silk flowers.

[0016] The third aspect of the present invention provides a method for rapid detection of silkworms based on RPA-CRISPR / Cas, which is performed using any of the above-mentioned kits, comprising the following steps:

[0017] S1. Extract DNA from the sample to be tested;

[0018] S2.RPA amplification: preparing an RPA reaction system, amplifying the DNA of the sample to be tested obtained by the above extraction by the RPA method, and obtaining an amplified product;

[0019] S3. CRISPR / Cas system reaction detection: Take the above amplified product, add fluorescent reporter probe, Cas12 protein and sgRNA, perform CRISPR reaction detection, read the detection signal, and obtain.

[0020] Preferably, in the detection method, the reaction system of RPA amplification includes buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the reaction conditions of RPA amplification are: 37-45°C for 10-30 minutes;

[0021] The reaction system of the CRISPR / Cas system reaction includes: 10×AaCas12b Buffer, AaCas12b, template, fluorescent reporter probe and sgRNA; the reaction conditions of the CRISPR / Cas system are: 37-45° C. for 5-30 min.

[0022] Preferably, the proportions of the components of the RPA amplification reaction system are prepared according to the following proportions: 30-36 μL of buffer, 3-5 μL of 350 mM magnesium acetate, 3-5 μL of 10 μM upstream primer, 3-5 μL of 10 μM downstream primer, 3-7 μL of DNA template, and RPA enzyme lyophilized powder;

[0023] The ratio of each component of the reaction system of the CRISPR / Cas system reaction is prepared according to the following ratio: RPA reaction product 0.8-1.2 μL, 10×AaCas12b Buffer 2-3 μL, 2.5 μM AaCas12b 1.5-2.5 μL, ssDNA fluorescent reporter probe 0.4-0.6 μL and 100 ng / μL sgRNA 0.8-1.2 μL, ddH2O is supplemented to 25 μL.

[0024] Further preferably, in the detection method, the ratio of each component of the RPA amplification reaction system is prepared according to the following ratio: 33 μL of buffer, 4 μL of 350 mM magnesium acetate, 4 μL of 10 μM upstream primer, 4 μL of 10 μM downstream primer, 5 μL of DNA template, and RPA enzyme lyophilized powder; the reaction conditions are incubation at 39° C. for 20 min;

[0025] The components of the reaction system of the CRISPR / Cas system reaction were prepared in the following proportions: 1 μL of RPA reaction product, 2.5 μL of 10×AaCas12b Buffer, 2 μL of 2.5 μM AaCas12b, 0.5 μL of ssDNA fluorescent reporter probe and 1 μL of 100 ng / μL sgRNA, and ddH2O was added to 25 μL; the reaction conditions were set to 43°C, 30 min in the qPCR instrument, and the FAM channel fluorescence signal was collected once per minute.

[0026] Preferably, the detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal.

[0027] The beneficial effects of the present invention are:

[0028] The present invention targets the silkworm flower and develops a silkworm flower rapid detection kit and detection method based on the recombinase polymerase amplification (RPA) technology combined with clustered regularly interspaced short palindromic repeats (Clustered regularly interspaced short palindromic repeats, CRISPR) and CRISPR associated protein systems (CRISPR associated enzyme systems, Cas protein) - CRISPR / Cas12. By designing the sgRNA (single-stranded guide RNA) sequence, the Cas12 bound thereto is guided to cut specific gene sites, thereby further increasing the specificity and sensitivity of the detection on the basis of RPA. The kit has extremely high detection sensitivity, can react under constant temperature conditions, and does not require complicated instruments and equipment.

[0029] The RPA-CRISPR joint detection of the specific method of silkworm flower species established by the present invention can realize the rapid on-site differentiation of silkworm flower and closely related cross species. It provides a theoretical basis and technical support for the effective identification of adulterated raw materials or mixed ingredients in roxburghii plant products, the quality inspection and evaluation of roxburghii products, and further enhances the comprehensive inspection and testing capabilities of roxburghii products, better serves industry supervision, and ensures the quality and safety of roxburghii products, which is of great significance for maintaining the normal production and operation order of the market and protecting the rights and interests of consumers. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The SNP site analysis and sgRNA primer design position are shown, where the black box is the SNP site and the green box is the sgRNA3 design position.

[0031] Figure 2 Results of sgRNA1 specificity detection: A. fluorescence growth curve, B. fluorescence growth rate.

[0032] Figure 3 Results of sgRNA2 specificity detection: A. fluorescence growth curve, B. fluorescence growth rate.

[0033] Figure 4 Results of specific detection of sgRNA3: A. fluorescence growth curve, B. fluorescence growth rate.

[0034] Figure 5 This is the fluorescence amplification curve of the RPA primer set (NTC is the negative control).

[0035] Figure 6 This is the specificity verification result of the RPA-CRISPR system of silk flower. In the figure, Sample 1, 2, and 3 are samples S1-3 in Table 1, and Sample 4-12 are samples S4-12 in Table 1 respectively.

[0036] Figure 7 The sensitivity test results of the RPA-CRISPR system of silkworm flower are shown in the figure. In the figure, 1E1 ng / μL, 1E0 ng / μL, 1E-1ng / μL, 1E-2ng / μL, 1E-3ng / μL, 1E-4ng / μL, and 1E-5ng / μL represent 10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 ng / μL of sample. DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0039] Example 1

[0040] 1. Experimental Materials and Main Reagents

[0041] 1. Experimental Materials

[0042] Table 1 shows the silkworm flowers and their closely related and easily confused species used in the experiment, all of which were collected by our laboratory. All samples were identified and confirmed by morphological and molecular identification methods before testing.

[0043] Table 1 Experimental materials

[0044] Sample No. Chinese name Latin name source S1 Silk Flower Rosaroxburghii Zhejiang S2 Silk Flower Rosaroxburghii Zhejiang S3 Silk Flower Rosaroxburghii Guizhou S4 Rosa laevigata Rosalaevigata Sichuan S5 Rosa laevigata Rosalaevigata Guangxi S6 Rosa laevigata Rosalaevigata Jiangxi S7 Rosa laevigata Rosalaevigata Hunan S8 Wild rose Rosamultiflora Beijing S9 Wild rose Rosamultiflora Zhejiang S10 Emei Rose Rosaomeiensis Gansu S11 Emei Rose Rosaomeiensis Shaanxi S12 Rosa rugosa Rosamaximowicziana Jiangxi

[0045] 2. Main reagents

[0046] The primers used for RPA amplification were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.;

[0047] All sgRNAs and CRISPR detection probes were synthesized by Beijing Xunshi Technology Co., Ltd.;

[0048] RPA amplification kit: SynSor DNA / RNA constant temperature rapid amplification reagent kit (catalog number: XS-R-101) from Beijing Xunshi Biotechnology Co., Ltd. (China) was used;

[0049] The CRISPR / Cas12b detection system uses SynSorAaCas 12b (C2c1) (Cat. No.: XS-R-002) nuclease and supporting reagents from Beijing Xunshi Biotechnology Co., Ltd. (China).

[0050] 2. SNP site analysis and sgRNA primer design

[0051] 1. DNA extraction

[0052] To extract DNA from the experimental materials in Table 1, 100 mg of silica gel dried plant leaves were placed in a 2 ml EP tube with 4 mm steel beads added in advance, and quickly placed in liquid nitrogen for 30 min. The EP tube was placed in a Geno / Grinder 2000 (SPEX SamplePrep) high-throughput grinder and ground for 3 min at 1000 rpm / min. The total DNA of the leaves was extracted using the Qiagen DNA extraction kit.

[0053] 2. Preparation of Nucleic Acid Sequences

[0054] The ITS2 sequence was obtained by amplifying the DNA of the silkworm flowers and their closely related and easily confused species in Table 1. The amplification primer sequences were ITS2F (SEQ ID NO. 1): 5'-ATGCGATACTTGGTGTGAAT-3'; ITS2R (SEQ ID NO. 2): 5'-GACGCTTCTCCAGACTACAAT-3'.

[0055] The partial sequence of ITS2 of the chloroplast of the silkworm obtained by amplification and sequencing (SEQ ID NO. 3) is as follows (the underlined bold bases in the sequence are SNP sites of the silkworm and other species):

[0056]

[0057] The partial sequence of chloroplast ITS2 (SEQ ID NO. 4) obtained by amplification and sequencing of samples S4-S7 in Table 1 is as follows:

[0058] CACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTGTTGATCGAGTGCTTTCTTAAATAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0059] The partial sequence (SEQ ID NO.5) of chloroplast ITS2 obtained by amplification and sequencing of sample S8-S9 wild rose in Table 1 is as follows:

[0060] CACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGGATGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTCTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0061] The partial sequence of chloroplast ITS2 obtained by amplification and sequencing of sample S10-S11 Emei rose in Table 1 (SEQ ID NO.6) is as follows:

[0062] CACGTCGTTGCCCCCCCCAATCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0063] The partial sequence of chloroplast ITS2 (SEQ ID NO.7) obtained by amplification and sequencing of sample S12 Rosa umbellata in Table 1 is as follows:

[0064] CACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGTCTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCGATCCGTCGATGCTTTCAACG.

[0065] 3. SNP site analysis and sgRNA primer design

[0066] The ITS2 sequences amplified from each species were compared and analyzed using BioEdit software, and the sequences of Rosa roxburghii (Genbank numbers FJ358704.1 and MH711604.1) were downloaded from Genbank for comparison to find out the sequence sites with stable differences, such as Figure 1 As shown, the ITS2 sequence of Rosa roxburghii (Genbank No. MH711604.1) has a T at position 634 while those of other species have a G, and an A at position 664 while those of other species have a G.

[0067] The targeting sequence containing the CRISPR-Cas12b recognition sequence (PAM) TTN was found. According to the PAM position, the sgRNA primers were designed in the SNP differential site region using the software CRISPR (http: / / crispor.tefor.net / ) and Bioedit (Table 2). The spacer sequence of the designed sgRNA was analyzed for coverage and specificity using NCBI BLAST. The comparison results showed that the designed sgRNA spacer sequence had 100% coverage within the detected species and good specificity.

[0068] Table 2 sgRNA sequence information

[0069]

[0070]

[0071] *Note: The underlined part of the sequence in Table 2 is the spacer region of sgRNA

[0072] 4. sgRNA specificity screening

[0073] (1) Template preparation

[0074] Using the diluted sample DNA in Table 1 as a template, perform PCR amplification with PCR primers ITS2F / ITS2R according to the recommended system in the Qingke reagent manual to obtain a high-concentration PCR product. The specific amplification system is shown in Table 3, and the corresponding PCR reaction program is shown in Table 4:

[0075] Table 3 PCR system

[0076] Components volume Final concentration 1.1×Gold Medal Mix (Green) 44μL 1× 10 μM upstream primer 2μL 0.4μM 10 μM downstream primer 2μL 0.4μM Template DNA (1ng / μL) 2μL 2ng Total volume 50uL /

[0077] Table 4 PCR reaction program

[0078]

[0079] (2) Screening of sgRNA

[0080] Use the PCR product prepared in (1) as a template for sgRNA screening. Use the system in Table 5 to configure the CRISPR reaction system.

[0081] Table 5 CRISPR system

[0082]

[0083]

[0084] The sequence of the ssDNA fluorescent reporter probe is: 5'-FAM-TTTTTTT-BHQ1-3'.

[0085] The qPCR instrument was set to 43°C for 30 min, and the FAM channel fluorescence signal was collected every minute. The specificity of sgRNA was initially verified based on the curve changes of the fluorescence signal.

[0086] The results showed that neither sgRNA1 nor sgRNA2 could achieve specific differentiation between Rosa roxburghii samples and closely related cross species ( Figure 2 , 3); while the specificity of sgRNA3 target was good, and only three samples of Rosa roxburghii had amplification curves ( Figure 4 ), no detection was found in other species, and sgRNA3 will be used to screen RPA primers in the future.

[0087] 3. RPA Primer Design

[0088] RPA primers were designed on both sides of the sgRNA3 with good screening effects. A total of 3 upstream primers and 3 downstream primers were designed. The primer sequences are shown in Table 6. Different combinations of RPA primers were screened. A two-step CRISPR reverse reaction was used. The first step was RPA amplification reaction. The reaction system was referred to the instructions of the kit. The specific ratio was: 33 μL buffer, 4 μL 350 mM magnesium acetate, 4 μL 10 μM upstream primer, 4 μL 10 μM downstream primer, 5 μL DNA template, and RPA enzyme lyophilized powder. The reaction conditions were incubation at 39 ° C for 20 min.

[0089] In the second step, the RPA amplification product was used as a template and mixed with the CRISPR reaction solution to perform a CRISPR reaction. The reaction system is shown in Table 5.

[0090] Table 6 RPA primer design

[0091] Primers Primer sequence (5'-3') SEQ ID NO RPA-F1 GTCACGCGGTTGGCATAAATACCAAGTC SEQ ID NO.11 RPA-F2 GCCACGACAATCGGTGGTTGTCAAACCTCG SEQ ID NO.12 RPA-F3 CCTCGGCGACCAACGCCACGACAATCGG SEQ ID NO.13 RPA-R1 CGACGGATCGACACGTATTATTTAAGAAAGCACTC SEQ ID NO.14 RPA-R2 CGACGGATCGACACGTATTATTTAAGAAA SEQ ID NO.15 RPA-R3 GAAAGCATCGACGGATCGACACGTATTAT SEQ ID NO.16

[0092] The results of primer screening are as follows Figure 5 As shown, among all RPA primer combinations F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2, F2 / R3, F3 / R1, F3 / R2, and F3 / R3, the fluorescence signal of F2 / R3 RPA primer increased the fastest. Finally, RPA-F2 and RPA-R3 were selected as upstream and downstream primers for subsequent experiments.

[0093] 4. Specificity detection of RPA-CRISPR system of silk flower

[0094] Using the 12 sample DNAs in Table 1 as templates, the RPA primers F2 / R3 determined by screening were used to perform RPA amplification on the DNA. The RPA reaction system and conditions were the same as the RPA reaction in the "III. RPA Primer Design" section. Take the RPA reaction product, select sgRNA3 for sgRNA, prepare the CRISPR system shown in Table 5, and place it in the qPCR instrument. Set the program in the qPCR instrument to 43°C, 30min, and collect the FAM channel fluorescence signal once per minute.

[0095] result( Figure 6 ) showed that only three samples of Rosa roxburghii had fluorescence, while the other samples had no fluorescence. This indicated that the detection method established in this experiment had good specificity and could effectively distinguish the target species.

[0096] 5. Sensitivity detection of the RPA-CRISPR system of silk flower

[0097] The extracted DNA of sample S1 was diluted to a concentration of 10 ng / uL, and then a 10-fold gradient dilution was performed. 1 , 10 0 , 10-1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 There are 6 concentrations in total, and the experiment was conducted according to the reaction system and method in the previous section "IV. Specific detection of RPA-CRISPR system of silk flower".

[0098] The results are as follows Figure 7 As shown: The detection sensitivity of the silk flower RPA-CRISPR system of the present invention is 1×10 -5 ng / μL (10fg / μL).

Claims

1. A kit for rapid detection of silkworms based on RPA-CRISPR / Cas, characterized in that: The Cas protein is Cas12, and the kit includes RPA primers and sgRNA. The RPA primers are primer combination F2 / R3, and the sequence is as follows: F2: 5'-GCCACGACAATCGGTGGTTGTCAAACCTCG-3', R3: 5'-GAAAGCATCGACGGATCGACACGTATTAT-3', The sgRNA is sgRNA3, and its sequence is: GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAACUUCAAGCGAAGUGGCACCUGUCGUGCGAUCGUGUUGA.

2. The kit according to claim 1, characterized in that: The kit further comprises a fluorescent reporter probe, and preferably the sequence of the fluorescent reporter probe is: 5'-FAM-TTTTTTT-BHQ1-3'.

3. The kit according to claim 1, characterized in that: The kit also includes an RPA amplification reagent, which includes: RPA enzyme and magnesium acetate.

4. The kit according to claim 1, characterized in that: The kit also includes a CRISPR / Cas detection reagent, which includes: Cas12b protein, The Cas12b protein is selected from AaCas12b, AacCas12b, and BrCas12b.

5. Use of the kit according to any one of claims 1 to 4 in detecting silk reeling flowers.

6. A method for rapid detection of silk reeling flowers based on RPA-CRISPR / Cas, characterized in that: Detection using the kit according to any one of claims 1 to 4 comprises the following steps: S1. Extract DNA from the sample to be tested; S2.RPA amplification: preparing an RPA reaction system, amplifying the DNA of the sample to be tested obtained by the above extraction by the RPA method, and obtaining an amplified product; S3. CRISPR / Cas system reaction detection: Take the above amplified product, add fluorescent reporter probe, Cas12 protein and sgRNA, perform CRISPR reaction detection, read the detection signal, and obtain.

7. The detection method according to claim 6, characterized in that: The reaction system of RPA amplification includes buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the reaction conditions of RPA amplification are: 37-45°C for 10-30 minutes; The reaction system of the CRISPR / Cas system reaction includes: 10×AaCas12b Buffer, AaCas12b, template, fluorescent reporter probe and sgRNA; the reaction conditions of the CRISPR / Cas system are: 37-45° C. for 5-30 min.

8. The detection method according to claim 7, characterized in that: The components of the RPA amplification reaction system are prepared in the following proportions: 30-36 μL of buffer, 3-5 μL of 350 mM magnesium acetate, 3-5 μL of 10 μM upstream primer, 3-5 μL of 10 μM downstream primer, 3-7 μL of DNA template, and RPA enzyme lyophilized powder; The ratio of each component of the reaction system of the CRISPR / Cas system reaction is prepared according to the following ratio: RPA reaction product 0.8-1.2 μL, 10×AaCas12b Buffer 2-3 μL, 2.5 μM AaCas12b 1.5-2.5 μL, ssDNA fluorescent reporter probe 0.4-0.6 μL and 100 ng / μL sgRNA 0.8-1.2 μL, ddH2O is supplemented to 25 μL.

9. The detection method according to claim 8, characterized in that: The components of the RPA amplification reaction system were prepared in the following proportions: 33 μL of buffer, 4 μL of 350 mM magnesium acetate, 4 μL of 10 μM upstream primer, 4 μL of 10 μM downstream primer, 5 μL of DNA template, and RPA enzyme lyophilized powder; the reaction conditions were incubation at 39° C. for 20 min; The components of the reaction system of the CRISPR / Cas system reaction were prepared in the following proportions: 1 μL of RPA reaction product, 2.5 μL of 10×AaCas12b Buffer, 2 μL of 2.5 μM AaCas12b, 0.5 μL of ssDNA fluorescent reporter probe and 1 μL of 100 ng / μL sgRNA, and ddH2O was added to 25 μL; the reaction conditions were set to 43°C, 30 min in the qPCR instrument, and the FAM channel fluorescence signal was collected once per minute.

10. The detection method according to claim 6 or 7, characterized in that: The detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal.

Images