Molecular marker of gene associated with sorghum anthracnose resistance, primer and application thereof

Abstract

The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to a molecular marker of a gene remarkably associated with sorghum anthracnose resistance characters, a primer and application. In order to develop more resistant NLR genes and solve the problem of rapid screening of molecular markers closely linked with anthracnose resistance of sorghum anthracnose-resistant materials, the invention provides a SbAr1 gene significantly associated with the sorghum anthracnose resistance character, and a molecular marker, a primer and application of the gene. The obtained molecular marker SAR993 related to anthracnose resistance can be used for detecting the anthracnose resistance of sorghum so as to quickly distinguish anthracnose-tolerant and anthracnose-susceptible varieties or strains in the seedling stage, the detection is convenient and quick, the result is stable, the molecular marker has the characteristics of accurately and quickly screening anthracnose-resistant single plants, the labor cost is greatly reduced, and the economic benefit is increased. The breeding period is shortened, the sorghum variety breeding process is accelerated, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and specifically relates to a molecular marker, a primer and an application of a gene significantly associated with a sorghum anthracnose resistance trait. Background Art

[0002] Sorghum (Sorghum bicolor (L.) Moench, 2n = 2x = 20) is the world's fifth largest cereal crop after corn, rice, wheat and barley. It is drought-resistant and alkali-resistant and is widely grown worldwide for brewing, silage, food and energy processing. Sorghum anthracnose is a common disease in sorghum-producing areas around the world and is also one of the mainstream leaf diseases in sorghum-producing areas in southwest China. Sorghum anthracnose occurs throughout the entire growth period of sorghum, harming sorghum leaves, ear necks, cobs, branches and stems, causing sorghum nutrient loss and internal metabolic disorders, affecting sorghum leaf photosynthesis, stem material transport and grain nutrient storage, causing serious economic losses to the industry.

[0003] Mining sorghum anthracnose-resistant gene resources and breeding disease-resistant varieties are effective and economical ways to enhance sorghum's anthracnose defense capabilities. The gene NLR (nucleotide-binding leucine-rich repeat, NLR) involved in sorghum anthracnose defense encodes nucleotide binding domains and leucine-rich repeat sequence proteins, which help sorghum resist the invasion of anthracnose pathogens. NLR gene structural variation is an important reason for the difference in resistance among sorghum varieties. However, there are only a handful of sorghum anthracnose-resistant NLR genes with broad-spectrum major effects, and there is a lack of related molecular markers to assist breeding. Therefore, identifying resistant resource materials, mining resistant NLR genes and developing functional molecular markers are of great practical significance for the accurate screening and breeding of sorghum anthracnose-resistant varieties. Summary of the invention

[0004] In order to develop more resistance NLR (nucleotide binding domain and leucine-rich repeat sequence) genes and solve the problem of rapid screening of sorghum anthracnose-resistant materials and molecular markers closely linked to anthracnose resistance, the present invention provides a SbAr1 gene significantly associated with the sorghum anthracnose resistance trait, as well as molecular markers, primers and applications of the gene. The molecular marker SAR993 associated with anthracnose resistance obtained by the present invention can be used for the detection of sorghum anthracnose resistance, so as to quickly distinguish varieties or strains that are resistant to anthracnose and susceptible to anthracnose at the seedling stage. The detection is convenient and fast, the results are stable, and it has the characteristics of accurate and rapid screening of anthracnose-resistant and susceptible individual plants, which greatly reduces labor costs, shortens breeding years, accelerates the selection process of sorghum varieties, and improves breeding efficiency.

[0005] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0006] In a first aspect, the present invention provides a molecular marker SAR993 of the SbAr1 gene associated with sorghum anthracnose resistance, the nucleotide sequence of which is shown as SEQ ID No.1 or SEQ ID No.2.

[0007] SEQ ID NO.1:

[0008] TAGAATCACACAAGGTGGTATAAATATTATAGTGCTATTGTGTCACTTGAAATATCTGGATGTCAGGACTTACT G GTCAACAATCTATTCACTTCCGAGTGACATTGGAAAACTGCATGGCTTGCAAATTTTGAACATAGGGTATACTTATATTACAACTCTGCCAACACAAATCACTAAACTTGAAGATCTCCGTGCCATTCGCTGTGATAGGAATTTCCCTAACTACTTGGATCCAGATGAACCAGTGCATTGTTTGTTTGCCACA TTGCGCCTGCCAATCCTATTAGCTGATTCAAA AAGCCGTGACAGAGCAATTGGTGATCTACA CATGGGCTGCTCTAGTGGTTGGTCCAGAACTAGCAGAAATG

[0009] SEQ ID NO.2:

[0010] TAGAATCACACAAGGTGGTATAAATATTATAGTGCTATTGTGTCACTTGAAATATCTGGATGTCAGGACTTACTAGTCAACAATCTATTCACTTCCGAGTGACATTGGAAAACTGCATGGCTTGCAAATTTTGAACATGGGGTACACTTATATT ACAACTCTGCCAACACAAATCACTAAACTTGAAGATCTCCGTGTCATTCGCTGTGATAGGAATGTCCCTAACTACTTGGATCCAGATGAACCAGTGCATTGTTTGTTTGCCACACATGGGCTGCTCTAGTGGTTGGTCCAGAACTAGCAGAAATG

[0011] The nucleotide sequence of the SbAr1 gene associated with sorghum anthracnose resistance is shown in SEQ ID No.5.

[0012] SEQ ID No.5:

[0013]

[0014] In a second aspect, the present invention provides primers for detecting molecular marker SAR993, which include a forward primer SAR993-F having a nucleotide sequence as shown in SEQ ID No.3 and a reverse primer SAR993-R having a nucleotide sequence as shown in SEQ ID No.4.

[0015] SEQ ID NO.3:

[0016] SAR993-F: 5'-TAGAATCACACAAGGTGG-3'

[0017] SEQ ID NO.4:

[0018] SAR993-R: 5'-CATTTCTGCTAGTTCTGGAC-3'

[0019] In a third aspect, the present invention provides the use of the molecular marker SAR993 or the primer of the molecular marker SAR993 in at least one of the following:

[0020] (1) Application in identifying sorghum anthracnose resistance traits;

[0021] (2) Application in screening sorghum varieties resistant to anthracnose;

[0022] (3) Application in sorghum assisted breeding;

[0023] (4) Application in the preparation and detection of products for sorghum anthracnose resistance.

[0024] Among them, the above application includes a method for identifying sorghum anthracnose resistance, which is to use the above two primers to perform PCR amplification on sorghum leaf DNA to obtain an amplification product; if the amplification product is a single band of a 371bp nucleotide fragment, the sorghum material to be tested is resistant to sorghum anthracnose; if the amplification product is a single band of 309bp, the sorghum material to be tested is susceptible to sorghum anthracnose; if double bands of 371bp and 309bp are amplified at the same time, the sorghum material to be tested is a heterozygote.

[0025] Among them, in the application of the above-mentioned preparation and detection of sorghum anthracnose resistance products, the products include kits, reagents or chips.

[0026] Preferably, the kit further comprises PCR reaction system reagents.

[0027] In a fourth aspect, the present invention provides a method for identifying sorghum anthracnose resistance, which comprises using the above-mentioned two primers to perform PCR amplification on sorghum leaf DNA to obtain an amplification product; if the amplification product is a single band of a 371bp nucleotide fragment, the sorghum material to be tested is resistant to sorghum anthracnose; if the amplification product is a single band of 309bp, the sorghum material to be tested is susceptible to sorghum anthracnose; if double bands of 371bp and 309bp are amplified at the same time, the sorghum material to be tested is a heterozygote.

[0028] Among them, in the above method, the amplification reaction system is: 1 μL of DNA template, 0.5 μL of upstream and downstream primers (10 μM / μL), 2 μL of 10×Easy Taq Buffer, 0.5 μL of dNTPs, 0.5 μL of Easy Taq Enzyme, and 15 μL of ddH2O.

[0029] Among them, in the above method, the amplification reaction procedure is: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, 34 cycles, final extension at 72°C for 5 minutes, and storage at 4°C.

[0030] Beneficial effects: The present invention conducts GWAS analysis on anthracnose resistance of sorghum populations, discovers the gene SbAr1 significantly associated with anthracnose resistance of sorghum, and designs SbAr1 gene molecular markers and primer pairs significantly associated with anthracnose resistance of sorghum by comparing the SbAr1 gene coding sequences of sorghum resistant varieties and susceptible varieties. The molecular markers and primer pairs can be used to quickly identify and screen anthracnose-resistant and anthracnose-susceptible sorghum materials in the sorghum breeding process, perform molecular marker-assisted selection, improve breeding efficiency, and accelerate the breeding process.

[0031] Moreover, the molecular markers disclosed in the present invention can also quickly distinguish sorghum varieties or strains that are resistant to anthracnose and those that are susceptible to anthracnose at the seedling stage, greatly reducing labor costs. The molecular markers of the present invention only use PCR amplification and gel electrophoresis detection, and do not require special SNP typing instruments or sequencing, which is conducive to promotion in most laboratories and sorghum breeding units. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the Manhattan plot of the genome-wide association analysis (GWAS) of anthracnose resistance in sorghum resource populations in Example 1;

[0033] Figure 2 The diagram for identification of anthracnose resistance of sorghum materials BTx623 and GJH1 in Example 1 (left), and the diagram for transcriptome analysis of three NLR genes at 0h and 24h after spraying sorghum anthracnose spore suspension on BTx623 and GJH1 (right);

[0034] Figure 3 This is a comparison diagram of the SbAr1 BTx623 and SbAr1 GJH1 proteins in Example 2;

[0035] Figure 4 Schematic diagram of the structure and molecular labeling of SbAr1 in Example 2;

[0036] Figure 5 The polyacrylamide gel electrophoresis diagram of the application of anthracnose molecular markers in 20 sorghum materials in Example 3 (left); and the anthracnose resistance identification diagram (right). DETAILED DESCRIPTION

[0037] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0038] Unless otherwise defined herein, the meanings of all technical and scientific terms used herein are intended to be the same as those commonly understood by those skilled in the art. The terms "include," "comprises," "has," "contains," or "involves," and other variations thereof herein, are inclusive or open-ended and do not exclude other unlisted elements or method steps. It should be understood by those skilled in the art that the above terms, such as "includes," encompass the meaning of "consisting of."

[0039] In the present invention, "a", "an", "at least one" and "one or more" are used interchangeably. When the lower limit and upper limit of a numerical range are disclosed, any value and any included range falling within the range are specifically disclosed. In particular, each range of values ​​disclosed herein (in the form of "about a to b", or equivalently, "approximately a to b", or equivalently, "about ab") should be understood to represent each value and range encompassed in the broader range.

[0040] Unless otherwise specified, the genome-wide association (GWAS) analysis described in the present invention is a method for identifying the association between genetic regions (genomes) and traits / diseases. This method detects hundreds or tens of millions of genetic variations in the genomes of various organisms to find those variant sites that are significantly associated with specific phenotypes or diseases.

[0041] Unless otherwise specified, the NLR genes (leucine-rich repeat-containing nucleotide binding site receptor) genes described in the present invention are the largest disease resistance gene family in plants.

[0042] The present invention finds a 148kb interval related to sorghum anthracnose resistance through GWAS analysis, and the interval includes three NLR genes related to sorghum pathogen immune defense. Through transcriptome analysis, it is determined that only the gene SbAr1 (Sobic.005G047700) in the interval has a high expression level in both anthracnose-resistant varieties (BTx623) and anthracnose-susceptible varieties (GJH1); by comparing the SbAr1 gene coding sequences of the disease-resistant varieties and the disease-susceptible varieties, it is found that there are sequence differences in the coding region between the disease-resistant varieties and the disease-susceptible varieties, and a base mutation from G to A in the SbAr1 coding region of the disease-susceptible variety causes the protein coding to terminate prematurely, resulting in the NLR protein lacking an LRR domain for identifying pathogen invasion; by comparing the SbAr1 gene sequences of the disease-resistant varieties and the disease-susceptible varieties, a deletion mutation of 62bp exists at 194bp downstream of the termination mutation of the disease-susceptible material, and is closely linked to the termination mutation.

[0043] Based on this, in one embodiment of the present invention, a molecular marker closely linked to sorghum anthracnose resistance is provided. The nucleotide sequence of the molecular marker in anthracnose-tolerant sorghum varieties is shown in SEQ ID No.1. In anthracnose-susceptible sorghum varieties, the nucleotide sequence of the molecular marker has a G / A mutation, which is closely linked to a 62bp deletion mutation at 194bp downstream, and its nucleotide sequence is shown in SEQ ID No.2, resulting in DNA amplification polymorphism. The base mutation site of the functional molecular marker is located in the coding region of the sorghum SbAr1 gene, 2156bp downstream of the start codon ATG. The molecular marker can be typed in a conventional laboratory and can be widely promoted to breeding units.

[0044] In another embodiment of the present invention, a specific primer is designed to identify the anthracnose resistance trait using the above molecular markers, which includes a forward primer SAR993-F having a nucleotide sequence as shown in SEQ ID No.3 and a reverse primer SAR993-R having a nucleotide sequence as shown in SEQ ID No.4.

[0045] Furthermore, in a specific embodiment of the present invention, a method for identifying or detecting sorghum anthracnose resistance using the above-mentioned molecular markers and primers is provided, which comprises using the above-mentioned two primers to perform PCR amplification on sorghum leaf DNA to obtain an amplification product; if the amplification product is a single band of a 371bp nucleotide fragment, the sorghum material to be tested is resistant to sorghum anthracnose; if the amplification product is a single band of 309bp, the sorghum material to be tested is susceptible to sorghum anthracnose; if double bands of 371bp and 309bp are amplified at the same time, the sorghum material to be tested is a heterozygote.

[0046] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0047] Example 1: Determination of the sorghum anthracnose resistance-associated gene SbAr1

[0048] 350 sorghum resource materials (Table 1, all commercially available) were cultivated in the greenhouse, cultured at 28°C for 16 h during the day and 22°C for 8 h at night, and the fourth leaf of sorghum was inoculated with anthrax strains in vitro by puncturing. Select sorghum plants with strong fourth leaves, cut leaves with a length of 6 cm from the tip to the vein, puncture two wounds of the same size at equal distances on the veins, and drip spore suspension (5×10 5 Spores / mL), placed in 6-BA (1 mg / L) moisturizing conditions for 7 days, and then the size of the lesions was measured to evaluate anthrax resistance. The SNPs detected by the resequencing data were subjected to genome-wide association study (GWAS) analysis with the anthrax resistance of the population, such as Figure 1 As shown, a 148kb interval was detected on chromosome 5 that was significantly associated with anthracnose resistance. The interval contained a total of three nucleotide binding and leucine-rich repeat receptor (NLR) genes, namely Sobic.005G047700, Sobic.005G047800, and Sobic.005G048400.

[0049] Through the transcriptome data of the resistant material BTx623 and the susceptible material GJH1, it was found that among the three NLR genes significantly associated with anthracnose resistance, only Sobic.005G047700 had a high expression level. In addition, whether it was the resistant material BTx623 or the susceptible material GJH1, spraying anthracnose spore suspension (5×10 5 spores / mL) after 24 hours, the expression levels increased significantly. Figure 2 Therefore, Sobic.005G047700 was determined to be a sorghum anthracnose resistance-associated gene and was named SbAr1. Its nucleotide sequence is shown in SEQ ID No.5, and its CDS coding sequence is shown in SEQ ID No.6.

[0050] SEQ ID No.6: CDS coding sequence of SbAr1 gene

[0051]

[0052] Example 2: Development of molecular markers

[0053] By comparing the coding sequences of the SbAr1 gene between the resistant variety BTx623 and the susceptible variety GJH1, Figure 3 As shown, it was found that there were sequence differences in the coding region between the resistant varieties and the susceptible varieties. A base mutation from G to A in the coding region of SbAr1 in the susceptible variety caused the protein coding to terminate prematurely, resulting in the NLR protein lacking the leucine-rich repeat sequence (LRR) domain that recognizes pathogen invasion;

[0054] By comparing the SbAr1 gene sequences of the resistant variety BTx623 and the susceptible variety GJH1, a 62 bp deletion mutation was found 194 bp downstream of the stop mutation G / A, which was closely linked to the stop mutation, such as Figure 4 Therefore, a molecular marker SAR993 with a size of 371 bp was developed by spanning the termination mutation and the deletion mutation, and its nucleotide sequence is shown in SEQ ID NO.1.

[0055] Example 3: Method for Rapidly Identifying Anthracnose Resistance in Sorghum Using Molecular Marker SAR993

[0056] (1) Method for extracting genomic DNA from sorghum leaves

[0057] The CTAB method was used to extract DNA from sorghum leaves. The specific operation was as follows: first, 0.1 g of healthy sorghum leaves were taken into a 2 mL centrifuge tube, quickly frozen in liquid nitrogen, and then ground into powder. 600 μL of 2% CTAB extract (20 g / L CTAB (hexadecyltrimethylammonium bromide), 1.4 mmol / L NaCl, 20 mmol / L EDTA, 100 mmol / L Tris-HCl (pH = 8.0)) was added, mixed, and placed in a 65°C constant temperature box for 1 hour, and shaken and mixed once every 10 minutes; then 600 μL of chloroform: isoamyl alcohol extract (V 氯仿 :V 异戊醇 =24:1) and then stand for 10 minutes, then transfer 400μL of the supernatant to a 1.5mL centrifuge tube by centrifugation; then add an equal volume of ice ethanol and gently mix the supernatant, refrigerate at -20℃ for 1 hour, centrifuge, discard the supernatant and keep the DNA precipitate at the bottom of the tube, wash twice with 75% alcohol; after the DNA is dried, dissolve it in 50μL of ddH2O. After measuring the concentration of DNA, store it at -20℃ for later use.

[0058] (2) Amplification of molecular marker primer SAR993 in sorghum DNA

[0059] The molecular marker primer pair is: forward primer SEQ ID NO.3 and reverse primer SEQ ID NO.4; the reaction system is: DNA template 1 μL, upstream and downstream primers 0.5 μL each (10 μM / μL), 10×Easy Taq Buffer 2 μL, dNTPs 0.5 μL, Easy Taq Enzyme 0.5 μL, ddH2O 15 μL; the reaction procedure is: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 34 cycles, 72°C final extension for 5 min, and storage at 4°C.

[0060] (3) Polyacrylamide gel electrophoresis detection

[0061] The PCR products were detected by electrophoresis using 2% polyacrylamide gel electrophoresis, with 7 μL of PCR product spotted in each well, the electrophoresis voltage was 220 V, the current was 120 mA, and the duration was 30 min;

[0062] (4) Genotyping statistics

[0063] The electrophoresis results were photographed under ultraviolet light. If the electrophoresis band contained only a 371bp DNA fragment, it indicated that the leaves of the material were resistant to anthracnose, marked as R, and its sequence was SEQ ID NO.1; if the electrophoresis band contained only a 309bp DNA fragment, it indicated that the leaves of the material were susceptible to anthracnose, marked as S, and its sequence was SEQ ID NO.2.

[0064] (5) Feasibility verification

[0065] To verify the feasibility and accuracy of this marker, this method was used to identify 20 sorghum materials. All sample materials were stored in the State Key Laboratory of Sichuan Agricultural University. The correspondence degree of individual plants was high (Table 2 and Figure 5 ), where lane 1 is DNA Marker 2000Plus, lane 2 is the disease-resistant material BTx623, lane 3 is the disease-susceptible material GJH1, and lanes 4 to 13 are single plant materials.

[0066] It should be noted that the specific features, structures, materials or characteristics described in this specification may be combined in any one or more embodiments in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments and features of the different embodiments described in this specification without contradicting each other.

[0067] Table 1 Sorghum resource materials

[0068]

[0069]

[0070]

[0071]

[0072] Table 2 Phenotypic marker verification

[0073]

[0074]

Claims

1. A molecular marker for the SbAr1 gene associated with sorghum anthracnose resistance, characterized in that: The nucleotide sequence is shown as SEQ ID No.1 or SEQ ID No.

2.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the SbAr1 gene associated with sorghum anthracnose resistance is shown in SEQ ID No.

5.

3. A primer for detecting the molecular marker according to claim 1, characterized in that: It comprises a forward primer with a nucleotide sequence as shown in SEQ ID No.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID No.

4.

4. Use of the molecular marker according to claim 1 or the primer of the molecular marker according to claim 3 in at least one of the following: (1) Application in identifying sorghum anthracnose resistance traits; (2) Application in screening sorghum varieties resistant to anthracnose; (3) Application in assisted breeding of sorghum; (4) Application in the preparation and detection of products for sorghum anthracnose resistance.

5. The use according to claim 4, characterized in that: The invention comprises a method for identifying sorghum anthracnose resistance, which comprises the following steps: using the two primers described in claim 3 to perform PCR amplification on sorghum leaf DNA to obtain an amplified product; if the amplified product is a single band of a 371 bp nucleotide fragment, the sorghum material to be tested is resistant to sorghum anthracnose; if the amplified product is a single band of 309 bp, the sorghum material to be tested is susceptible to sorghum anthracnose; if double bands of 371 bp and 309 bp are amplified simultaneously, the sorghum material to be tested is a heterozygote.

6. The use according to claim 4, characterized in that: In the application of preparing a product for detecting sorghum anthracnose resistance, the product includes a kit, a reagent or a chip.

7. A method for identifying sorghum anthracnose resistance, characterized in that: The method comprises the following steps of: using the two primers described in claim 3 to perform PCR amplification on sorghum leaf DNA to obtain an amplified product; if the amplified product is a single band of a 371 bp nucleotide fragment, the sorghum material to be tested is resistant to sorghum anthracnose; if the amplified product is a single band of 309 bp, the sorghum material to be tested is susceptible to sorghum anthracnose; if double bands of 371 bp and 309 bp are amplified simultaneously, the sorghum material to be tested is a heterozygote.

Images