Molecular marker closely linked with corn low phosphorus stress and application thereof

Abstract

The invention discloses a molecular marker closely linked with corn low phosphorus stress and application of the molecular marker, and belongs to the technical field of biology. The invention aims to solve the technical problem of how to detect the influence of low-phosphorus stress on corn so as to breed corn which is slightly influenced by low-phosphorus stress. The molecular marker closely linked with corn low-phosphorus stress is related to the number of grains in rows under different phosphorus contents, the molecular marker is related to low-phosphorus stress, and the sensitivity of homozygous corn with the molecular marker G to low-phosphorus stress is smaller than that of homozygous corn with the molecular marker A; the method can be used for screening corn genotypes with low-phosphorus resistance or genotypes with higher row grain number under a low-phosphorus condition, so that the corn breeding process is greatly accelerated.

Description

Technical Field

[0001] The invention belongs to the field of crop genetic breeding, and in particular relates to a molecular marker closely linked to corn low-phosphorus stress and an application thereof. Background Art

[0002] corn( Zea mays L.) is one of the three major cereal crops in the world. It is the main source of food, feed and bioenergy, and plays an important role in global food security. Phosphorus is one of the three essential nutrients for plant growth. It is not only a component of key cellular molecules such as ATP, nucleic acids and phospholipids, but also a key regulator in many metabolic processes, such as energy transfer, protein activation, and carbon and amino acid metabolism. Phosphorus deficiency is a typical abiotic stress. Low phosphorus stress not only limits plant growth, development and yield, but also affects crop quality and seed formation. A large amount of cultivated land shows a certain degree of phosphorus deficiency, but phosphorus fertilizers are expensive and come from limited and non-renewable phosphate rocks. In addition, excessive application of phosphorus fertilizers will cause a large amount of phosphorus to be deposited in rivers, causing many ecological and environmental problems. Therefore, improving the absorption and utilization of phosphorus by crops is the most reliable way to solve the above problems.

[0003] Genome-wide association studies (GWAS) are a method used to detect the association between genetic variation within the genome and phenotype. Researchers use SNP (single nucleotide polymorphism) chips for whole genome analysis and use statistical methods to find SNP sites with significant differences between two groups of individuals, thereby locating genes associated with the phenotype. In 2008, the first GWAS was conducted in maize. The authors used 8590 loci in 553 elite inbred lines to identify SNPs that significantly affect the oleic acid content of grains (BELÓ A, ZHENG P, LUCK S, et al. 2008. Whole genome scan detects an allelic variant of fad2 associated withincreased oleic acid levels in maize[J / OL]. Molecular genetics and genomics:MGG, 279(1): 1-10. https: / / doi.org / 10.1007 / s00438-007-0289-y.). With the release of the "B73" reference maize genome, GWAS has made significant progress and has become a common technique for revealing the genotype-phenotype relationship in maize. Compared with QTL positioning, the positioning accuracy of GWAS can reach the level of single genes. These candidate genes obtained through GWAS provide valuable resources for maize gene cloning and functional characterization.

[0004] Competitive allele-specific PCR (KASP) technology is an efficient and accurate genotyping method for detecting single nucleotide polymorphisms (SNPs) in DNA sequences. The principle is to use allele-specific PCR to design two probes with different fluorescent labels for the target SNP site, and determine the genotype through competitive binding and the strength of the fluorescent signal. KASP technology has the advantages of high throughput, low cost, and simple operation, and is widely used in molecular breeding, medical research, population genetics, food safety and other fields. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to detect the influence of low phosphorus stress on corn so as to breed corn with less influence of low phosphorus stress.

[0006] In order to solve the above technical problems, the present invention first provides the use of a substance for detecting a molecular marker of corn low-phosphorus stress in detecting or assisting in detecting corn low-phosphorus tolerance; The maize low-phosphorus stress molecular marker is a nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the maize genome, which is G or A.

[0007] In the above application, the substance for detecting the molecular marker of low phosphorus stress in corn may include primers named F1, F2 and R, wherein F1 is a single-stranded DNA containing positions 22-45 of SEQ ID No.1; The F2 is a single-stranded DNA containing positions 22-45 of SEQ ID No. 2; The R is a single-stranded DNA shown in SEQ ID No.3.

[0008] Specifically, the F1 may be a single-stranded DNA as shown in SEQ ID No.1; The F2 may be a single-stranded DNA as shown in SEQ ID No.2.

[0009] In the above application, the substance for detecting molecular markers of low phosphorus stress in corn also contains reagents other than KASP primers, such as FLU-ARMS for KASP 2× PCR Mix V4 (Guangzhou Good Biotechnology Co., Ltd.).

[0010] In the above application, the substance for detecting molecular markers of low-phosphorus stress in corn can be composed of the F1, the F2 and the R, or can be composed of the F1, the F2, the R and the reagents other than the KASP primer.

[0011] In the above application, the homozygous corn having a nucleotide G at 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the genome has a tolerance to low phosphorus that is greater than or has a candidate tolerance that is greater than the homozygous corn having a nucleotide A at 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the genome.

[0012] The present invention also provides a method for detecting or assisting in detecting corn low-phosphorus tolerance, the method comprising detecting the corn low-phosphorus stress molecular marker, and determining the corn low-phosphorus tolerance according to the following method: The homozygous maize with a G at the nucleotide 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) has a lower tolerance to low phosphorus than the homozygous maize with an A at the nucleotide 5241160 bp on chromosome 3 corresponding to the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

[0013] In the above method, the detection of the molecular marker of low-phosphorus stress in corn can be carried out using the substance for detecting the molecular marker of low-phosphorus stress in corn.

[0014] In the above, the low-phosphorus tolerance of corn can be reflected in the yield of corn (such as the number of kernels per row) under low phosphorus conditions.

[0015] The substance for detecting the molecular marker of corn low-phosphorus stress also belongs to the protection scope of the present invention.

[0016] The present invention also provides any of the following applications: X1) Application of the maize low phosphorus stress molecular marker in maize breeding; X2) Application of the maize low-phosphorus stress molecular marker in detecting or assisting in detecting maize low-phosphorus tolerance; X3) Application of the substance for detecting molecular markers of low phosphorus stress in corn in corn breeding; X4) Use of the substance for detecting molecular markers of low phosphorus stress in corn in the preparation of corn breeding products; X5) Use of the substance for detecting molecular markers of corn low-phosphorus stress in the preparation of products for detecting or assisting in detecting corn low-phosphorus tolerance; X6) Application of the method for detecting or assisting in detecting low-phosphorus tolerance in maize in maize breeding; X7) Detection of the substance in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) for use in breeding maize that is less susceptible to low phosphorus stress; X8) Application of detecting substances in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the preparation of products for breeding maize that is less susceptible to low phosphorus stress.

[0017] The present invention also provides a corn breeding method, which comprises: detecting a nucleotide at 5241160 bp on chromosome 3 of the corn Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the corn genome, and selecting homozygous corn whose nucleotide at 5241160 bp on chromosome 3 of the corn Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the corn genome is G as a parent for breeding.

[0018] In the present invention, the low phosphorus refers to a phosphorus content or an available phosphorus content in the soil that is lower than the phosphorus content or the available phosphorus content required for the normal growth of corn.

[0019] In the present invention, the corn can be any corn material in Table 2 or its progeny.

[0020] The corn low-phosphorus stress molecular marker of the present invention is a molecular marker related to low-phosphorus stress. The homozygous corn with the molecular marker G is less susceptible to low-phosphorus stress than the homozygous corn with the molecular marker A. The present invention can be used to screen corn genotypes with low-phosphorus tolerance or genotypes with a higher number of kernels per row under low-phosphorus conditions, thereby greatly accelerating the corn breeding process. The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the violin plot of KNPR_LPTI of two genotypes of corn materials. The phenotype difference of row kernel number between H001 and H002 is extremely significant (P-value<0.0001, ****).

[0022] Figure 2 This is the Manhattan plot of the genome-wide association analysis of maize KNPR_LPTI, where the horizontal axis represents the chromosome position of each SNP on chromosome 3; the vertical axis represents the negative logarithm of the P value of each SNP site under the MLM model with the base 10. The area above the dotted line in the figure is -log 10 Points with P-value>5.

[0023] Figure 3This is the QQ plot of the genome-wide association analysis of maize KNPR_LPTI. The horizontal axis represents the negative logarithm of the expected observed P value with a base of 10, assuming that the P value follows a uniform [0, 1] distribution; the vertical axis represents the negative logarithm of the actual observed P value with a base of 10. The results of the QQ plot show that the influence of inter-population differences on the experimental results has been eliminated through PCA analysis.

[0024] Figure 4 The results of KASP genotyping of 18 maize materials, where the horizontal axis represents the FAM fluorescence signal intensity; the vertical axis represents the HEX fluorescence signal intensity. "○" represents AA homozygotes showing FAM fluorescence, and "□" represents GG homozygotes showing HEX fluorescence. DETAILED DESCRIPTION

[0025] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are all repeated at least three times, and the results are averaged.

[0026] The following examples used SPSS11.5 statistical software to process the data, and used One-way ANOVA test, P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated an extremely significant difference, P < 0.001 (***) indicated an extremely significant difference, and P < 0.0001 (****) indicated an extremely significant difference.

[0027] The 252 maize inbred lines in the following examples were kindly donated by Professor Yang Xiaohong of China Agricultural University and are described in the literature (1. Yang N, Lu Y, Yang X, et al. Genome wide association studies using a new nonparametric model reveal the genetic architecture of 17 agronomic traits in an enlarged maize association panel. PLoS Genet. 2014;10(9):e1004573.Published 2014 Sep 11. doi:10.1371 / journal.pgen.1004573;2.Shete JM, Patel DB, Patel MP, et al. Study of heterosis in top cross derivatives of Maize(Zea mays L.)[J]. Agricultural Science Digest–A Research Journal, 2011, 31(1): 1-7;3.Xu G, Zhang X, Chen W, et al. Population genomics of Zea speciesidentifies selection signatures during maize domestication and adaptation[J].BMC plant biology, 2022, 22(1): 72.), which can be obtained from the applicant or from the China National GeneBank (https: / / db.cngb.org / brc / plant / ).

[0028] Example 1: Discovery and application of molecular markers for low phosphorus stress in maize 1. Phenotypic determination The experimental materials include 252 maize inbred lines, the main body of which is a subset of the 513 populations integrated by Professors Yan Jianbing and Yang Xiaohong. The inbred lines were planted at the Shangzhuang Experimental Station in Beijing in 2018 and 2021. The plots in 2018 were low-phosphorus plots (Olsen-P content (i.e., available phosphorus content in the soil) 2.10 mg / kg) and normal-phosphorus plots (Olsen-P content 4.50 mg / kg); the plots in 2021 were low-phosphorus plots (Olsen-P content 2.72 mg / kg) and normal-phosphorus plots (Olsen-P content 4.70 mg / kg). The number of kernels per row (Plant Height, PH) of maize at maturity in 2018 and 2021 was measured and averaged, and the BLUP value (Best Linear Unbiased Prediction, BLUP) value of the trait was used to construct the secondary index LPTI (Low-phosphate Tolerance Index): KNPR_LPTI=number of grains per row under low phosphorus stress / number of grains per row under normal phosphorus.

[0029] 2. Genome-wide association analysis 252 maize inbred line materials were sequenced, and the pLINK software was used to perform quality control on 980 K high-density SNP markers (MAF>5%; missing rate<20%), and PLINK was used to calculate the number of independent markers, window size, step size and r 2 The parameters were set to 50, 50, and 0.2, respectively, and 128,197 independent markers were obtained. These markers were then combined with the constructed LPTI for GWAS analysis using TASSEL software. A mixed linear model (MLM) was selected, and principal component analysis (PCA) was first performed. The clustering parameter was set to 3, and the group stratification was controlled through PCA analysis. The results were displayed as QQ plots ( Figure 3 ), and then calculate the kinship matrix to correct for the non-independence of the population. Then perform a genome-wide association analysis on all SNP markers and LPTI values ​​on chromosome 3, with a significance threshold of -log 10 P-value=5, the results are displayed as Manhattan plots ( Figure 2 ), the Manhattan plot shows that there is a significant SNP at 5241160 on chromosome 3 (the site is G or A), and the violin plot of the row grain number LPTI index is drawn using the "ggplot2" package of the R studio software (see the specific results for details). Figure 1 ), the results showed that the difference between the number of kernels per row of maize under low phosphorus conditions when the haplotype was H001 (i.e., the homozygous type of the SNP locus genotype was AA) and the haplotype H002 (i.e., the homozygous type of the SNP locus genotype was GG) was extremely significant (****, P-value<0.0001), that is, the maize with the H002 haplotype had a higher number of kernels per row under low phosphorus conditions (Table 1 and Table 2). The SNP at 5241160 on chromosome 3 was recorded as a molecular marker for low phosphorus stress in maize.

[0030] The maize low-phosphorus stress molecular marker is located at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020).

[0031] In Tables 1 and 2, KNPR_LPTI is the ratio of the average number of grains per row under low phosphorus stress in 2018 and 2021 to the average number of grains per row under normal phosphorus.

[0032] Table 1. Two haplotypes and their numbers and phenotypes in the GWAS population

[0033] Table 2. Genotype and phenotype of each material

[0034]

[0035]

[0036]

[0037]

[0038]

[0039] 3. Using molecular markers of low phosphorus stress in maize to detect the effect of low phosphorus conditions on the number of kernels per row in maize 1) Primer design Based on the maize reference genome Zm-B73-REFERENCE-NAM-5.0, 100 bp flanking sequences before and after the maize low phosphorus stress molecular marker were extracted and three primers were designed, of which the 5' ends of two specific forward primers were connected to FAM and HEX fluorescent linker sequences respectively, and one universal reverse primer. The primer sequences are as follows (5'-3'): Forward specific primer F1: GAAGGTGACCAAGTTCATGCT cacatgaagcaacatgggacctgA (SEQ IDNo.1); Forward specific primer F2: GAAGGTCGGAGTCAACGGATT cacatgaagcaacatgggacctgG (SEQ IDNo.2); Reverse universal primer R: GCTAACGCCCAGGCCCAGCAATCTCGGAT (SEQ ID No. 3).

[0040] The underlined parts of the forward specific primers F1 and F2 are fluorescent label sequences (ie, FAM and HEX), and the non-underlined parts specifically identify the maize low-phosphorus stress molecular marker and its upstream sequence in the maize genome.

[0041] PCR was performed on corn genomic DNA using two specific forward primers and a reverse universal primer R. If the PCR product of the corn to be tested only detected the fluorescent signal corresponding to the forward specific primer F1, i.e., FAM fluorescence, then the detection site was A, and the number of kernels in a row of this corn material was greatly affected by low-phosphorus conditions; if only the fluorescent signal corresponding to the forward specific primer F2, i.e., the HEX signal, was detected, then the detection site was G, and this corn material was less affected by low-phosphorus conditions.

[0042] 2) Detection of corn genotype and phenotype 18 maize materials were randomly selected from 252 maize inbred lines, and genomic DNA was extracted. The DNA template concentration was measured to be approximately 10 ng / µl, which can be used for subsequent analysis.

[0043] KASP experiment PCR reaction system: genomic DNA 4.5μl, forward specific primer F1 (10μM) 0.1μL, forward specific primer F2 (10μM) 0.1μL, reverse specific primer R (10μM) 0.3μL, FLU-ARMS for KASP 2×PCR Mix V4 (Guangzhou Good Biotechnology Co., Ltd.) 5μl.

[0044] PCR reaction conditions are as follows:

[0045] The KASP reaction product was read using a BIORAD CFX96 fluorescence quantitative PCR instrument, and the results of the fluorescence scan were converted into graphics using EXCEL.

[0046] The results of marker typing are as follows Figure 4 As shown, "○" represents AA homozygotes showing FAM fluorescence, and "□" represents GG homozygotes showing HEX fluorescence. The phenotypes and genotypes of each material in 2021 are shown in Table 3. The results showed that the average LPTI value of the GG genotype was 0.8695, and the average LPTI value of the AA genotype was 0.4919, which was significantly lower than that of the GG genotype. The GG genotype was less affected by low phosphorus stress, while the AA genotype was greatly affected by low phosphorus stress.

[0047] In Table 3, LPTI is the ratio of the number of grains per row under low phosphorus stress in 2021 to the number of grains per row under normal phosphorus.

[0048] Table 3. Genotypes of 18 maize materials and their kernel numbers per row under low-phosphorus and normal-phosphorus conditions

[0049]

[0050] The above results show that the maize low phosphorus stress molecular marker of the present invention is related to the number of kernels per row under low phosphorus conditions, and can detect the influence of the number of kernels per row on the maize under low phosphorus conditions. By detecting the SNP marker and selecting maize materials with the GG genotype for breeding, it is possible to quickly select maize with a higher number of kernels per row under low phosphorus conditions.

[0051] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of substances for detecting molecular markers of maize low-phosphorus stress in detecting or assisting in detecting maize low-phosphorus tolerance; The maize low-phosphorus stress molecular marker is a nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the maize genome, which is G or A.

2. The use according to claim 1, characterized in that: The substances for detecting the molecular marker of low phosphorus stress in corn include primers named F1, F2 and R, wherein F1 is a single-stranded DNA containing positions 22-45 of SEQ ID No.1; The F2 is a single-stranded DNA containing positions 22-45 of SEQ ID No. 2; The R is a single-stranded DNA shown in SEQ ID No.

3.

3. The use according to claim 2, characterized in that: The F1 is a single-stranded DNA shown in SEQ ID No.1; The F2 is a single-stranded DNA shown in SEQ ID No.

2.

4. The use according to any one of claims 1 to 3, characterized in that: The low-phosphorus tolerance of maize in which the nucleotide at the position of 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) is G is greater than or has a candidate greater tolerance to low phosphorus than that of maize in which the nucleotide at the position of 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) is A.

5. A method for detecting or assisting in detecting low-phosphorus tolerance in maize, the method comprising detecting the maize low-phosphorus stress molecular marker of claim 1, and determining the low-phosphorus tolerance in maize according to the following method: The low-phosphorus tolerance of maize in which the nucleotide at the position of 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) is G is greater than or has a candidate greater tolerance to low phosphorus than that of maize in which the nucleotide at the position of 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) is A.

6. The method according to claim 5, characterized in that: The detection of the molecular marker of low phosphorus stress in corn described in claim 1 is carried out using the substance for detecting the molecular marker of low phosphorus stress in corn described in any one of claims 1-3.

7. The use according to any one of claims 1 to 4, or the method according to claim 5 or 6, characterized in that: The corn low-phosphorus tolerance is reflected in the yield of corn under low-phosphorus conditions.

8. The substance for detecting molecular markers of low-phosphorus stress in corn according to any one of claims 1 to 3.

9. Any of the following applications: X1) Use of the molecular marker for low phosphorus stress in corn according to claim 1 in corn breeding; X2) Use of the corn low-phosphorus stress molecular marker of claim 1 in detecting or assisting in detecting corn low-phosphorus tolerance; X3) Use of the substance for detecting molecular markers of low phosphorus stress in corn according to any one of claims 1 to 3 in corn breeding; X4) Use of the substance for detecting molecular markers of low phosphorus stress in corn according to any one of claims 1 to 3 in the preparation of corn breeding products; X5) Use of the substance for detecting molecular markers of low-phosphorus stress in corn as claimed in any one of claims 1 to 3 in the preparation of a product for detecting or assisting in detecting low-phosphorus tolerance in corn; X6) Use of the method according to claim 5 or 6 in corn breeding; X7) Detection of the substance in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) for use in breeding maize that is less susceptible to low phosphorus stress; X8) Application of detecting substances in the maize genome corresponding to the nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the preparation of products for breeding maize that is less susceptible to low phosphorus stress.

10. A method for breeding corn, comprising: The nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the maize genome was detected, and the maize whose nucleotide at 5241160 bp on chromosome 3 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome (updated on March 21, 2020) in the maize genome was G was selected as the parent for breeding.

Images