Fluorescent quantitative PCR (Polymerase Chain Reaction) primer group for tiger-derived feline calicivirus and application

Abstract

The invention relates to a fluorescent quantitative PCR (Polymerase Chain Reaction) primer group for tiger-derived feline calicivirus and application, and relates to the technical field of biology. The sequence of the tiger-derived feline calicivirus is as shown in SEQ ID NO: 1; the fluorescent quantitative PCR primer group comprises an upstream primer, a downstream primer, an upstream primer, a downstream primer and a downstream primer, wherein the upstream primer is ATTGTCATGTAAGGGAGTC; and the downstream primer is TGGAAGCCAAAGCCGTA. The primer group can be used for effectively detecting the novel tiger-derived feline calicivirus strain LYH1224, has higher sensitivity compared with the traditional PCR (Polymerase Chain Reaction), and has higher specificity and cost performance compared with other nucleic acid detection methods such as LAMP (Loop-Mediated Isothermal Amplification) and RPA (Recombinase Polymerase Amplification).

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a fluorescent quantitative PCR primer set for tiger-origin feline calicivirus and an application thereof. Background Art

[0002] Feline Calicivirus (FCV) is a virus widely found in cats, which can cause a variety of diseases in cats, including feline rhinotracheitis and feline calicivirus disease. FCV belongs to a virus family in the order Picornavirales. The genome of the virus consists of a single-stranded positive-stranded non-segmented RNA molecule, which contains three main open reading frames (ORFs): the polyprotein encoded by ORF1 is cleaved into multiple non-structural proteins, including helicase, protease and polymerase; ORF2 is processed into leader of the capsid (LC) and mature capsid protein (VP1); ORF3 encodes a highly conserved small structural protein VP2 in the genome, which plays an important role in viral replication or assembly. In recent years, researchers have reported that in the negative strands of some positive-strand RNA viruses, such as coronaviruses, there are also some small ORFs that encode functional small viral proteins, but so far, no reports have been made in the Caliciviridae family. There are 11 genera in the Caliciviridae family that can infect a variety of vertebrates, of which seven genera mainly infect mammals, including Vesivirus, Sapovirus, Nebovirus, Norovirus, Lagovirus, Recovirus, and Valovirus; two genera mainly infect birds, including Bavovirus and Nacovirus; and two genera infect fish, namely Minovirus and Salovirus. FCV is one of the vesivirus genera.

[0003] In previous studies, a strain of tiger-derived FCV (TFCV) was discovered during macroviromics analysis of tissue samples from a tiger that had clinical symptoms before death. Virus isolation, electron microscopy observation, and PCR identification determined that this strain of calicivirus may be the main viral pathogen causing the tiger's death, and was named LYH1224. Testing showed that the new tiger-derived feline calicivirus was not highly similar to the currently known FCV strains, and their genetic relationship was relatively distant. The publicly available primer sets or detection methods for known FCV strains cannot effectively detect the new tiger-derived feline calicivirus strain, and there is a lack of rapid detection technology for the new strain, which cannot meet the needs of animal disease monitoring and prevention and control of the new FCV pathogen, and there is an even greater lack of development and application research of specific detection technology. Summary of the invention

[0004] In response to the above problems, the present invention provides a fluorescent PCR primer set for tiger-origin feline calicivirus, which can effectively detect the novel tiger-origin feline calicivirus strain LYH1224, and has higher sensitivity than traditional PCR, and has higher specificity and cost-effectiveness than other nucleic acid detection methods such as LAMP and RPA.

[0005] In order to achieve the above object, the present invention provides a fluorescent quantitative PCR primer set for tiger-derived feline calicivirus, the sequence of which is shown in SEQ ID NO: 1; the fluorescent quantitative PCR primer set comprises: Upstream primer: ATTGTCATCTATGTAAGGGAGTC (SEQ ID NO: 4); Downstream primer: TGGAAGCCAAAGCCGTA (SEQ ID NO: 5).

[0006] BLAST analysis of the novel tiger-origin feline calicivirus showed that the highest similarity between the whole genome of LYH1224 and the currently known FCV was only 85.14% ( Figure 1 ), the most similar known FCV strain is the FCV strain FB-NJ-13 isolated from cat nasopharyngeal swabs in 2013 ( Figure 1 1st row from top to bottom); genetic evolution analysis of the top 100 strains with the highest similarity to NCBI ( Figure 2 ), indicating that LYH1224 ( Figure 2 The strain (Query_1234111) in the PCR amplification test is genetically distant from the existing FCV and is located on the periphery of the evolutionary tree. The low similarity and distant genetic relationship result in the inability of the published primer sets or detection methods for known FCV strains to effectively detect the new tiger-derived feline calicivirus strain. In addition, the detection of the new tiger-derived feline calicivirus LYH1224 strain also needs to take into account the effective differentiation from other feline caliciviruses to avoid false positives. Therefore, through a large number of experiments, we found the target gene sequence region that is specific to the new tiger-derived feline calicivirus LYH1224 strain relative to other FCV genomes, and based on this, we further designed the above-mentioned fluorescent PCR primer set.

[0007] At the same time, considering the operational difficulty of sampling large cats such as tigers and the speed of disease progression after infection with feline calicivirus strains, although there are various methods for detecting FCV, including traditional virus isolation and culture, immunological detection and molecular biology methods, these methods have certain limitations in sensitivity, specificity and ease of operation. Therefore, based on qPCR technology, rapid and accurate quantitative analysis of FCV nucleic acid is achieved. The above-mentioned fluorescent PCR primer set, combined with the advantages of high sensitivity, high specificity, rapidity and automation of qPCR technology, achieves high sensitivity and specificity detection of the new tiger-derived feline calicivirus LYH1224 strain.

[0008] In one embodiment, the sequence of the amplified fragment of the fluorescent quantitative PCR primer set is shown in SEQ ID NO: 2.

[0009] The present invention also provides the use of the fluorescent quantitative PCR primer set in preparing a reagent and / or a kit for detecting tiger-derived feline calicivirus.

[0010] The present invention also provides a kit for detecting tiger-derived feline calicivirus, comprising the fluorescent quantitative PCR primer set.

[0011] In one embodiment, the kit includes a fluorescence quantitative PCR reaction system, and the fluorescence quantitative PCR reaction system includes the fluorescence quantitative PCR primer set.

[0012] In one embodiment, the working concentration of the fluorescent quantitative PCR primer set is 0.3-0.7 μM.

[0013] The present invention also provides a method for detecting tiger-derived feline calicivirus for non-diagnostic purposes, which comprises the following steps: extracting nucleic acid from a sample to be tested, reverse transcribing to obtain cDNA, and using the kit to perform fluorescent quantitative PCR reaction.

[0014] In one embodiment, the sequence of the tiger-derived feline calicivirus is shown as SEQ ID NO: 1.

[0015] In one embodiment, the conditions of the fluorescent quantitative PCR reaction are: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 60°C for 45 s, and 40 cycles.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The fluorescent quantitative PCR primer set and application for tiger-origin feline calicivirus of the present invention can effectively detect the novel tiger-origin feline calicivirus strain LYH1224, and has higher sensitivity than traditional PCR, and has higher specificity and cost-effectiveness than other nucleic acid detection methods such as LAMP and RPA. The fluorescent quantitative PCR primer set combined with the fluorescent quantitative PCR technology can meet the needs of disease monitoring and prevention and control of wild animals, especially large wild cats, fills the gap in the current fluorescent quantitative detection method for the clinical novel tiger-origin FCV (LYH1224 strain), has good application prospects, is not only innovative in technology, but also has important clinical and scientific research value in practical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the result of NCBI BLAST analysis of the complete sequence of LYH1224 strain; Figure 2 This is the result of NCBI BLAST evolutionary tree analysis of the complete sequence of LYH1224 strain; Figure 3 The amplification results of the four primer sets on the recombinant plasmid p-TFCVq in the embodiment are shown in FIG. M is a DNA Marker; Figure 4 This is the standard curve diagram of the optimal reaction conditions of TFCV absolute quantitative PCR in the embodiment, Note: Cq, i.e. Ct; Figure 5 This is a sensitivity test result diagram of TFCV absolute quantitative PCR in the embodiment, wherein: Figure 5 A in the figure is the result diagram of the fluorescence quantitative PCR sensitivity detection of the present invention; Figure 5 B is the result of the common PCR sensitivity test, where 1-10 means the concentration of the plasmid standard is 10 9 , 10 8 , ..., 10 0 , M is DNA Marker; Figure 6 1 is a graph showing the specific detection results of TFCV absolute quantitative PCR in the embodiment, wherein 1 is the tiger-derived feline calicivirus LYH1224 strain; 2-7 are feline calicivirus (FCV), feline panleukopenia virus (FPV), feline coronavirus (FCoV), feline herpes virus (FHV), feline astrovirus (FeAV), and feline crest virus (FKBV), respectively. DETAILED DESCRIPTION

[0018] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0020] Example 1. For the isolated new tiger-origin feline calicivirus strain LYH1224, macroviromics was first used to obtain the sequence of TFCV SEQ ID NO: 1. Homology analysis was performed using BLAST software to find the target gene sequence region specific to the new TFCV strain LYH1224 relative to other FCV genomes. Primer premier 5.0 software was used to design a fluorescent quantitative PCR primer set for specific detection of the LYH1224 strain. The sequence of TFCV, the sequence of the amplified fragment, and some of the designed PCR primer set sequences are shown below.

[0021] Sequence of the novel tiger-origin feline calicivirus (TFCV) strain LYH1224 SEQ ID NO: 1:

[0022] Table 1: Amplified fragment sequence, fluorescent quantitative PCR primer sequence, and product size of LYH1224 strain

[0023] 2. Screening of fluorescent quantitative PCR primer sets and reaction procedures.

[0024] Synthesize a plasmid containing the amplified fragment sequence, connect it to the pMD18-T vector and transform it into Escherichia coli Top10, pick the positive clone to extract the plasmid, and obtain the recombinant plasmid p-TFCVq standard; dilute the recombinant plasmid p-TFCVq 10 times to prepare a recombinant plasmid standard solution; use the plasmid standard solution as a template and specific primers to perform TB Green Premix Ex Taq II real-time fluorescence quantitative PCR to screen the fluorescence quantitative PCR primer set and reaction program. After screening and optimization, a set of primer combinations and reaction programs that can specifically and sensitively detect the new TFCV strain LYH1224 were finally obtained. The logarithmic value of the copy number concentration of the recombinant plasmid standard was used as the horizontal axis, and the Ct value was used as the vertical axis to obtain the linear regression equation. The specific screening process is as follows: The p-TFCVq recombinant plasmid DNA was amplified by PCR using four sets of primers: 4158S / 4270A, 4160S / 4270A, 5074S / 5269A, and 5074S / 5290A, and fragments with the same size as the target product were amplified ( Figure 3 ), indicating that the plasmid standard DNA can be specifically amplified by these four sets of primers.

[0025] The OD260 / A280 was determined to be between 1.8 and 2.0, which met the purity requirements. The plasmid concentration was 200 ng / μL, approximately 6.037 x 10 10 copies / μL, diluted to 10 with ddH2O 10 copies / mL, and then make 10-fold serial dilutions as plasmid standards for later use.

[0026] Using the p-TFCVq plasmid standard as a template, different primer final concentrations (0.4 μM, 0.5 μM) and different annealing times (30 s, 45 s) were set. The amplification efficiency and R 2 To determine the optimal reaction system and procedure for fluorescent quantitative PCR, the results are shown in the following table.

[0027] Table 2: Amplification efficiency and R of TFCV absolute quantitative PCR under different systems and procedures 2

[0028] Note: E%, indicates amplification efficiency; -, indicates not detected.

[0029] Thus, the optimal reaction system for TFCV absolute quantitative PCR was determined as follows: SYBR Mix 10 μL, ddH2O 7.0 μL, 4160S / 4270A primers at final concentrations of 0.5 μM, and template 2 μL. The optimal reaction conditions were: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing and extension for 45 s, and 40 cycles.

[0030] Under the above conditions, a 10-fold gradient (1×10 0 ~1×10 9 The p-TFCVq plasmid standard diluted with 100 copies / μL was used as the template, and the amplification efficiency of the 4160S / 4270A primer pair was 101.80%, R 2 is 0.996, and the standard equation is y=-3.280x-36.992, indicating that there is a good linear relationship between the Ct value and the logarithm of the concentration of each standard ( Figure 4 ).

[0031] 3. Sensitivity test.

[0032] Select 10-fold gradient (1×10 0 ~1×10 9 The p-TFCVq plasmid standard diluted with 100 copies / μL was used as a template for amplification using the optimized reaction system and conventional PCR, and the sensitivity of the two methods was compared.

[0033] The primer pair for conventional PCR was 4160S / 4270A, and the reaction program was 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 30 s, 5 cycles; 95°C for 30 s, 54°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min; and stored at 4°C.

[0034] The results are as follows Figure 5 As shown, the positive standard template concentration is 1×10 1 ~1×10 9 The fluorescence signal and obvious amplification curve can be detected when the number of copies / μL is less than 2×10 1 The number of copies / reaction is 1×10 in the standard plasmid. 5 ~1×10 9 Specific bands can be observed at 10 copies / μL, and the minimum detection limit is 10 5 Copies / reaction. This indicates that the established new TFCV absolute quantitative fluorescence PCR method has strong sensitivity.

[0035] 4. Specificity experiment

[0036] The optimized fluorescence quantitative PCR reaction system was used to detect the cDNA or DNA of the tiger-derived feline calicivirus LYH1224 strain, feline calicivirus (FCV), feline panleukopenia virus (FPV), feline coronavirus (FCoV), feline herpesvirus (FHV), feline astrovirus (FeAV), and feline crest virus (FKBV) stored in our laboratory as templates. The results were as follows Figure 6 As shown, only the tiger-origin feline calicivirus LYH1224 strain was detected, and there was no amplification curve for other viruses and the negative control, proving that the established TFCV absolute quantitative fluorescence PCR method has good specificity.

[0037] 5. Repeatability experiment.

[0038] Select the plasmid standard dilution gradient with a copy of 1×10 8 , 1×10 5 , 1×10 4 , 10 3 / μL four gradient plasmid standards were used as templates, each concentration was repeated 3 times as intra-group repeats, and the same concentration was repeated 3 times as inter-group repeats. The results are shown in the following table, showing that the coefficient of variation (CV) within and between groups was less than 2.5%, indicating that the method had good repeatability and stability.

[0039] Table 3: TFCV absolute quantitative PCR intra-group and inter-group repeatability test

[0040] 6. A method for detecting tiger-derived feline calicivirus.

[0041] The sequence of the tiger-derived feline calicivirus is shown in SEQ ID NO: 1, and the detection method comprises the following steps: The total nucleic acid of the large feline samples to be tested was extracted, and the cDNA of the samples to be tested was obtained by reverse transcription. The cDNA and plasmid standards were used as templates, and specific primers TFCV4160S and TFCV4270A were used. Real-time fluorescence quantitative PCR was performed with the optimal reaction system and optimal reaction conditions obtained by the above screening to achieve quantitative detection of the new tiger-origin FCV in the samples to be tested.

[0042] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0043] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A fluorescent quantitative PCR primer set for tiger-derived feline calicivirus, characterized in that: The sequence of the tiger-derived feline calicivirus is shown in SEQ ID NO: 1; The fluorescent quantitative PCR primer set includes: upstream primer: ATTGTCATCTATGTAAGGGAGTC (SEQ ID NO: 4); Downstream primer: TGGAAGCCAAAGCCGTA (SEQ ID NO: 5).

2. The fluorescent quantitative PCR primer set according to claim 1, characterized in that: The sequence of the amplified fragment of the fluorescent quantitative PCR primer set is shown in SEQ ID NO:

2.

3. Use of the fluorescent quantitative PCR primer set described in any one of claims 1-2 in preparing a kit for detecting tiger-derived feline calicivirus.

4. A kit for detecting tiger-derived feline calicivirus, characterized in that: The invention comprises the fluorescent quantitative PCR primer set according to any one of claims 1 to 2.

5. The kit according to claim 4, characterized in that The kit comprises a fluorescent quantitative PCR reaction system, and the fluorescent quantitative PCR reaction system comprises the fluorescent quantitative PCR primer set according to any one of claims 1 to 2.

6. The kit according to claim 5, characterized in that The working concentration of the fluorescent quantitative PCR primer set is 0.3-0.7 μM.

7. A method for detecting tiger-derived feline calicivirus for non-diagnostic purposes, characterized in that: The detection method comprises the following steps: extracting nucleic acid of a sample to be tested, reverse transcribing to obtain cDNA, and performing fluorescent quantitative PCR reaction using the kit described in any one of claims 4 to 6.

8. The detection method according to claim 7, wherein the sequence of the tiger-derived feline calicivirus is shown in SEQ ID NO:

1.

9. The detection method according to claim 7, characterized in that The conditions of the fluorescent quantitative PCR reaction were as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 60°C for 45 s, and 40 cycles.

Images