Application of bacillus subtilis in prevention and treatment of verticillium wilt

Abstract

The invention belongs to the technical field of biological prevention and control of plant diseases, and provides application of bacillus subtilis in prevention and control of verticillium wilt. The preservation number of the bacillus subtilis SEB-34 is CGMCC (China General Microbiological Culture Collection Center) No. 26419. The SEB-34 strain and the microbial agent produced by the SEB-34 strain can be used for preventing and treating plant diseases caused by verticillium dahliae, and the strain can be colonized at plant roots and keep high abundance and has the effects of preventing diseases, promoting growth and increasing yield. In the microbial agent provided by the invention, thalli are in a semi-dormant state, so that the microbial agent has relatively strong stress resistance and is more stable to store, and the production and transportation costs are effectively reduced while the effect is ensured. The invention also provides beneficial microbial resources for green prevention and control of economic crop diseases, and has good application prospects and high application values.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control of plant diseases, and particularly relates to application of a strain of Bacillus subtilis in controlling crop Verticillium wilt. Background Art

[0002] The disclosure of this background information is intended to enhance understanding of the general background of the invention and should not necessarily be taken as an acknowledgment or any form of suggestion that this information constitutes the prior art already known to a person skilled in the art.

[0003] Verticillium dahliae Verticillium dahliae ) is a widely distributed fungus that can be spread through the soil. After infecting crops, it colonizes in the vascular bundles of crops and causes wilting symptoms. The disease is difficult to control. After the disease occurs, it can affect the production and quality of crops. In severe cases, the economic loss can reach more than 60%. The prevention and control of this disease is still mainly based on the selection of disease-resistant varieties and spraying fungicides.

[0004] Verticillium dahliae Verticillium dahliae ) has many hosts and can infect more than 660 plant species, including cash crops (such as cotton, eggplant, tomato, watermelon, etc.) and food crops (such as potatoes, etc.). Cotton is an important economic and oil crop in my country and is related to national security. Verticillium wilt is one of the important diseases that harm cotton. In my country, the disease is caused by Verticillium dahliae ( Verticillium dahliae ) is caused by cotton wilt, which occurs in the adult plant stage, affecting cotton yield and seriously threatening the quality of cotton and seed quality. The disease is widely distributed around the world. It occurs in the inland cotton areas of Northwest my country, the cotton areas in the Yellow River Basin, and the cotton areas in the Yangtze River Basin, and causes serious damage. At present, the prevention and control of cotton wilt mainly adopts disease-resistant varieties and pesticide control. For example, chemical seed treatment can be used before sowing or spraying and root irrigation can be used after emergence. However, chemical control has problems such as environmental pollution, easy to induce drug resistance, pesticide residues, and high cost. Although traditional chemical pesticides can effectively control the occurrence of Verticillium wilt, long-term use will lead to environmental pollution and the development of drug resistance. Therefore, it is of great practical significance to develop new green control methods to prevent and control cotton Verticillium wilt.

[0005] The prevention and control of crop diseases through beneficial microorganisms has attracted more and more attention from all parties. Rhizosphere antagonistic bacteria have strong adaptability to the soil environment. Using them as biological antagonists to prevent and control plant diseases has the advantages of strong target conversion, good prevention effect, long-lasting efficacy, and environmental friendliness. It is one of the main ways to greenly prevent and control plant diseases. Due to the co-evolutionary characteristics of biodiversity and organisms, it is necessary to screen more different types of microorganisms to deal with the different types and continuous evolution of pathogenic microorganisms. Screening biocontrol microorganisms that have inhibitory effects on pathogens is one of the effective methods for the prevention and control of pathogenic microorganisms. At present, there is still a lack of targeted and effective biological preparation products on the market, which cannot meet the biological control needs in production. It is still necessary to develop microbial control products suitable for the prevention and control of cotton wilt. Summary of the invention

[0006] In view of the problem that the prior art lacks microbial agents for preventing and treating Verticillium wilt, the present invention provides a strain of Bacillus subtilis ( Bacillus subtilis ) and the microbial preparations prepared therefrom can effectively antagonize Verticillium dahliae ( Verticillium dahliae ), used to control Verticillium wilt in economic crops such as cotton, potatoes, and vegetables.

[0007] To achieve the above purpose, the present invention adopts the following technical solution.

[0008] A strain of Bacillus subtilis ( Bacillus subtilis ) Application of SEB-34 and its fermentation products and microbial agents prepared therefrom in preventing and controlling crop diseases; the crop diseases are caused by Verticillium dahliae ( Verticillium dahliae ), the deposit number of Bacillus subtilis SEB-34 is CGMCC No. 26419.

[0009] Preferably, the crop is selected from eggplant, pepper, tomato, tobacco, potato, melon, watermelon, cucumber and cotton.

[0010] The active ingredient of the microbial agent is at least one of Bacillus subtilis SEB-34 cells, spores and fermentation products; the fermentation product is the cell-free fermentation liquid of Bacillus subtilis SEB-34, the dried product of the cell-free fermentation liquid or the concentrated liquid. The microbial preparation also includes other inert ingredients, such as absorbents, stabilizers and surfactants.

[0011] The microbial agent is a liquid preparation or a solid preparation. Preferably, the amount of Bacillus subtilis SEB-34 in the liquid preparation is not less than 1×10 8 cfu / mL; the number of Bacillus subtilis SEB-34 in the solid preparation is not less than 1×10 9 cfu / g, preferably (5-10)×10 9 cfu / g.

[0012] The preparation method of the microbial agent comprises the following steps: The seed liquid of Bacillus subtilis SEB-34 is cultured in a fermentation medium to obtain a fermentation liquid; the fermentation liquid is separated into solid and liquid to obtain a fermentation product; and at least one of the bacterial body, spores and fermentation product of SEB-34 is selected to obtain a microbial agent.

[0013] The fermentation medium comprises the following components in percentage by weight: 1% bran, 1% corn flour, 0.5% sodium chloride, 0.1% potassium dihydrogen phosphate, 0.05% manganese sulfate, and the remainder is water.

[0014] Specifically, the above preparation method comprises the following steps: (1) Bacillus subtilis SEB-34 strain was activated on LB plate medium, and a single colony was picked and cultured on LB slant medium at 25°C-30°C to obtain an activated strain; (2) Inoculate the activated strain into LB liquid culture medium and culture with stirring at 35°C for 24 hours to obtain seed solution; (3) Inoculate the seed liquid into the fermentation medium at a volume ratio of 1:(25-50), and ferment and culture at 35°C and a shaking speed of 150 rpm to obtain a fermentation liquid; (4) After solid-liquid separation of the fermentation liquid, bacteria, spores and cell-free fermentation liquid can be obtained; (5) concentrating or drying the cell-free fermentation broth to obtain a dry product or concentrated solution of the SEB-34 cell-free fermentation broth; (6) Select at least one of the cells, spores and fermentation products of SEB-34 and mix them to obtain a microbial agent.

[0015] In the above step (1), the composition and content of the LB plate medium and the LB slant medium are: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder.

[0016] In the above step (2), the composition and content of the LB liquid culture medium are: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0017] During the preparation of the LB plate medium, LB slant medium and LB liquid medium, NaOH was used to adjust the pH value to 7.0 after the solute was dissolved, and other operations and sterilization were prepared according to conventional methods.

[0018] In the above step (3), the end point of the fermentation culture is when the mature spores in the fermentation broth account for 90% of the total number of spores and bacterial cells.

[0019] The present invention also provides the above-mentioned Bacillus subtilis ( Bacillus subtilis ) Application of SEB-34, its fermentation products and microbial agents prepared therefrom in promoting crop growth.

[0020] The present invention has the following advantages: The Bacillus subtilis CGMCC No.26419 provided by the present invention can be colonized and maintain a high abundance through seed treatment before sowing or root drip irrigation after emergence, has disease prevention, growth promotion and yield increase effects, can effectively reduce the occurrence of diseases caused by Verticillium dahliae, and can effectively reduce the use of chemical fungicides. The microbial agent can be directly applied to crop seeds or in the soil around the rhizosphere, has high safety, and has no adverse effects on plant growth and development. In the microbial agent prepared by the fermentation liquid of the strain, the bacterial body is in a semi-dormant state, and the spores have strong stress resistance, more stable storage, and reduced production and transportation costs. The present invention provides beneficial microbial resources for the green prevention and control of economic crop diseases, and has good application prospects and high application value.

[0021] Biological deposit information Bacillus subtilis ( Bacillus subtilis ) SEB-34, deposited on January 6, 2023 in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, with the deposit number: CGMCC No. 26419. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a strain quantity distribution diagram that is effective for identifying pathogenic bacteria; Figure 2 is the antagonistic effect of SEB-34 against three identified pathogenic bacteria, among which A is Fusarium graminearum, B is Verticillium dahliae, and C is Helicoverpa serrata; Figure 3 This is the colony morphology of SEB-34 on LB plate; Figure 4 is the phylogenetic tree of SEB-34 constructed based on 16s rRNA sequence; Figure 5 SEB-34 is based on ikB Phylogenetic tree constructed from sequences; Figure 6 The SEB-34 microbial agent shows the incidence of cotton Verticillium wilt in potted plants (A) and disease index (B). Figure 7 The effect of SEB-34 microbial agent on cotton growth, where A is the effect on seedling emergence, B is the effect on plant height, and C is the effect on fresh weight; Figure 8The field control effect of SEB-34 microbial agent on cotton Verticillium wilt in two years and three fields; Fig. 9 This is the effect of SEB-34 microbial agent on cotton yield in three places over two years. DETAILED DESCRIPTION

[0023] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0024] Example 1 Isolation and identification of target strains 1. Isolation and screening of target bacteria In August 2022, healthy soybean stalks were collected in Linqing City, Shandong Province, and Bacillus strains were isolated and preserved ( Bacillus sp. ) 233 strains.

[0025] The specific separation and purification process is as follows: wash the surface soil of the collected samples with clean water, peel them, disinfect them with 75% alcohol for 60 s, disinfect them with 1.05% sodium hypochlorite for 10 min, and wash them with sterile water three times. To detect whether the surface sterilization is thorough, take the final rinse liquid of each sample in 10 mL LB medium, and culture at 37°C for 3 days without microbial growth. The surface disinfection is considered to be thorough. Cut the sample into pieces with sterile scissors, add 10 mL sterile water to grind it thoroughly, let it stand for 10 min, then absorb 1 mL of supernatant, and then dilute it 10 times four times, and take 100 μL of the dilution to spread on the LB plate. Culture it in the dark at 37°C for 2 days, pick out the different bacterial colonies that have grown and transfer them to a new LB plate for streaking and purification in time.

[0026] The purified strains were selected from the maize stalk rot pathogen Fusarium graminearum ( Fusarium moniliforme ), Verticillium dahliae, the pathogen of Verticillium wilt Verticillium dahliae ) and Helicoverpa spp., the pathogen of corn leaf blight ( Bipolaris maydis The plate confrontation method was used to screen the target strains of Nisikado et Miyake Shoemaker. It was found that many strains had antibacterial effects on a single target pathogen (Table 1). Five strains had antibacterial effects on three pathogens at the same time, and the inhibition rate was higher than 50% ( Figure 1 ), respectively SEB-34, SEB-45, SEB-69, SEB-147, SEB-195. The inhibition rates of the five strains on different selected pathogens are shown in Table 2. Among them, SEB-34 has the best comprehensive inhibition effect ( Figure 2 ).

[0027] Table 1 Statistical table of the antibacterial activity of the screened strains against a single identified pathogen Table 2 Statistical table of inhibition rate of screened strains against three identified pathogens Depend on Figure 1 As can be seen from the data in Table 1-2, not all Bacillus strains have antagonistic effects on the three pathogens.

[0028] 2. Identification of target strains SEB-34 colonies on LB plates are milky white, opaque, irregular, and have uneven edges ( Figure 3 ).

[0029] The DNA of cultured SEB-34 was extracted by CTAB method. The DNA was used as a template to amplify the 16S rDNA gene of the strain with universal primers F27: GGTTACCTTGTTACGACTT and R1492: AGAGTTTGATCCTGGCTCAG. The PCR product was then sequenced to obtain a gene sequence fragment with a length of 1499 bp, as shown in SEQ ID NO: 1. Finally, the sequencing data was subjected to BLAST on NCBI, and the phylogenetic tree was constructed using MEFA7.0 software ( Figure 4 ), analysis showed that SEB-34 and Bacillus subtilis (Accession number: AB325584) are in the same branch and have the closest relationship.

[0030] The gyrB gene was further used to further identify SEB-34. The gyrB gene of the strain was amplified by PCR using gyrB-F: GGATAACGCGATTGACGAAG; gyrB-R: GCCGTGARCAAARTCRAA as upstream and downstream primers, and then sequenced to obtain a gene sequence fragment with a length of 671 bp, the sequence of which is shown in SEQ ID NO: 2. Finally, the sequencing data was subjected to BLAST on NCBI, and the phylogenetic tree was constructed using MEFA7.0 software ( Figure 5 ), analysis showed that SEB-34 and Bacillus subtilis (Accession number: EU711067) are in the same branch and have the closest relationship.

[0031] Through morphological observation and 16S rDNA and gyrB gene sequence analysis, strain SEB-34 was finally identified as Bacillus subtilis ( Bacillus subtilis ); deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on January 6, 2023, with the deposit number: CGMCC No. 26419.

[0032] Example 2 Preparation of Bacillus subtilis SEB-34 microbial agent Prepare LB solid medium according to the following formula and method: Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, water 1000 mL, fully dissolve the above ingredients in water, then use 5 mol / L NaOH to adjust the pH value to 7.0, add agar powder 15 g, and sterilize by high-pressure steam.

[0033] Prepare LB liquid medium according to the following formula and method: Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, water 1000 mL, fully dissolve the above ingredients in water, then use 5 mol / L NaOH to adjust the pH value to 7.0, and sterilize by high-pressure steam after packaging.

[0034] Prepare the fermentation medium according to the following formula and method: Bran 1%, corn flour 1%, sodium chloride 0.5%, potassium dihydrogen phosphate 0.1%, manganese sulfate 0.05%, the rest is water; Mix bran, corn flour, sodium chloride, potassium dihydrogen phosphate and manganese sulfate, add water and stir evenly, then use 5 mol / LNaOH to adjust the pH value to 7.0, sterilize with high-pressure steam and set aside.

[0035] (1) Activate the cryopreserved SEB-34 strain on LB plate medium, pick a single colony on LB slant medium, and culture it at 30°C for 24 h to obtain the activated strain; (2) Use a sterile inoculation loop to scrape the activated strain and inoculate it into 100 mL of LB liquid culture medium. Incubate at 35°C and 150 rpm for 24 h to obtain seed solution. (3) The seed liquid was inoculated into the fermentation medium at a volume ratio of 1:50, and the fermentation was carried out at 35°C and a shaking speed of 150 rpm. The number of spores in the fermentation liquid was detected. When the mature spores in the fermentation liquid accounted for 90% of the total number of spores and bacteria, the fermentation was stopped to obtain the fermentation liquid; the fermentation liquid can be directly used as a liquid preparation, and the number of SEB-34 in the preparation is 10 9 cfu / mL.

[0036] The fermentation liquid is filtered and sterilized to obtain a sterile fermentation liquid, thereby obtaining a liquid microbial agent preparation 1; The obtained filter residue contains spores and bacteria, which are counted and adsorbed by peat and vermiculite, and then dried at low temperature to obtain a solid preparation. The number of SEB-34 in the preparation is 10 8 cfu / g; In order to maintain the activity of SEB-34, the spores and bacteria in the filter residue were counted, adsorbed by peat and vermiculite, and then mixed with the sterile fermentation liquid again to obtain liquid microbial agent preparation 2.

[0037] Example 3 Antibacterial effect of Bacillus subtilis SEB-34 fermentation broth The Oxford cup method was used to determine the control effect of SEB-34 fermentation broth on Verticillium dahliae V991. The specific steps are as follows: Pick a bacterial block from the edge of the activated pathogenic bacteria colony, inoculate it into a triangular flask containing 200 mL of PDB, and culture it on a shaker at 25°C and 150 rpm for 7 days. Then filter the hyphae with sterile gauze to obtain a spore suspension, and adjust the spore suspension to 1×10 7 cfu / mL for future use.

[0038] The fermentation broth of Bacillus subtilis SEB-34 was prepared according to the method in Example 2 to obtain liquid microbial agent preparation 1, and then sterile water was added to adjust the spore concentration to 10 6 cfu / mL, 10 7 cfu / mL, 10 8 cfu / mL, and then filtered and sterilized to obtain sterile fermentation broths of corresponding low, medium and high concentrations for later use.

[0039] Spread 200 μL of pathogenic bacteria spore suspension (1×10 7 cfu / mL), air-dried, and then placed in a sterile Oxford cup. 200 μL of SEB-34 sterile fermentation liquid was added to the Oxford cup and cultured in the dark at 25°C for 3 d. The size of the inhibition zone was observed and determined.

[0040] The results showed that the three concentrations of fermentation broth had a significant inhibitory effect on Verticillium dahliae. The diameters of the inhibition zones of high, medium and low concentration treatments were 2.43 cm, 2.37 cm and 1.92 cm, respectively.

[0041] Example 4 Potted control effect of Bacillus subtilis SEB-34 on cotton Verticillium wilt Preparation of conidia of Verticillium dahliae V991 PDA liquid medium was used. The activated Verticillium dahliae was inoculated into a 250 mL sterile Erlenmeyer flask containing 100 mL PDA liquid medium and cultured in a shaking incubator at 25 °C and 200 rpm for 10 days. The mycelium was removed by filtration with sterile filter paper, and the conidia suspension was collected and its concentration was adjusted to 1 × 10 using a hemocytometer. 8 CFU / mL.

[0042] SEB-34 microbial agent 1 was adjusted to a concentration of 1×10 6cfu / mL to obtain SEB-34 bacterial suspension.

[0043] Hebei cotton 11 was planted in vermiculite and transplanted into liquid culture medium after emergence. The nutrient solution was Hoagland nutrient solution. 18 seedlings were used as one replicate in each basin (25 cm × 32 cm × 10 cm). Each treatment was repeated 3 times. When the first true leaf appeared, cotton plants were removed from the treatment group and placed in SEB-34 suspension (concentration 1×10 6 cfu / mL) for 40 min, and then put it back into the nutrient solution. The control group used LB medium instead of SEB-34 bacterial suspension. After 4 days, the plants in the treatment group and the control group were taken out and inoculated with Verticillium dahliae V991 (1×10 7 cfu / mL) for 40 min, and then put it back into the water basin. The cotton seedlings were cultured in a greenhouse with an ambient temperature of 20℃-30℃ and good light.

[0044] Fifteen days after treatment, investigate the disease status of cotton and calculate the disease rate and disease index. The classification standards for Verticillium wilt seedling stage are as follows: Level 0, the percentage of leaf disease area is 0; Level 1, 0<the diseased area of ​​leaves ≤33%; Level 2, 33%<leaves diseased area ≤ 66%; Level 3: 66%<leaf diseased area<100%; Level 4: The diseased area of ​​leaves is 100%.

[0045] The disease rate, disease index and control effect are calculated according to the following formulas: Incidence rate (%) = (number of diseased plants / total number of plants) × 100; Disease index (%) = (∑ (number of diseased plants at each level × disease level) / (total number of plants × highest disease level)) × 100; Control effect (%) = (control disease rate - treatment disease rate) / control disease rate × 100.

[0046] The results are as follows Figure 6 As shown: After the cotton plants were treated with the bacterial suspension, the disease index of the treatment group (b) was 11.67, and the disease index of the control group (a) was 24.76. The disease index of the treatment group was significantly lower than that of the control group (P<0.05), and the prevention efficiency was 52.87%. The results showed that SEB-34 can significantly reduce the occurrence of cotton Verticillium wilt caused by Verticillium dahliae.

[0047] Example 5 Effects of Bacillus subtilis SEB-34 on cotton germination and plant growth SEB-34 microbial agent (fermentation broth) was prepared according to the method of Preparation 1 in Example 2, and the concentration of the fermentation broth was adjusted to 1×10 6 cfu / mL to obtain SEB-34 bacterial suspension.

[0048] Healthy cotton seeds were selected, soaked in the above-mentioned SEB-34 bacterial suspension for 2 h, and then air-dried in a cool place for later use. For the control, clean water was used instead of bacterial suspension to soak the seeds.

[0049] The seeds were sown in a culture box (19 cm × 13 cm × 12 cm), sterilized soil was used for the soil, and Hogland nutrient solution was used for the nutrient solution. Fifteen seeds were sown in each culture box as one treatment, and each treatment was repeated 3 times. After sowing, the seeds were cultured in a greenhouse with an ambient temperature of 20°C-30°C and good light. The emergence of cotton was investigated after 7 days, and the growth of cotton was investigated after 15 days.

[0050] The results are as follows Figure 7 As shown: after the cotton plants were treated with bacterial suspension, the germination rate of the treatment group was 97.78%, and the germination rate of the control group was 91.11%. The germination rate of the treatment group was higher than that of the control group, but the difference between the two was not significant (P<0.05); the average plant height of the treatment group was 7.09 cm, and the average plant height of the control group was 6.82 cm, and the plant height of the treatment group was significantly higher than that of the control group (P<0.05); the seedling weight of the treatment group was 0.52 g, and the seedling weight of the control group was 0.49 g, and the plant height of the treatment group was significantly higher than that of the control group (P<0.05). The above results show that SEB-34 treatment has a growth-promoting effect on cotton.

[0051] Application Example 1 Field Control Effect of Bacillus subtilis SEB-34 Microbial Preparation on Cotton Fusarium wilt From April to November 2023 and April to November 2024, field control efficacy tests were conducted in Juye, Linqing and Guangrao, and the cotton variety was Lumian 378. The test fields were selected in plots where cotton had been planted for many consecutive years and where Verticillium wilt was more serious. A randomized block distribution design was adopted with three replications, and each plot had an area of ​​33.3m 2 The planting density is 3500-4000 plants / mu, and there are protection rows between the plots.

[0052] The SEB-34 microbial agent (fermentation broth) was prepared according to the method of Preparation 1 in Example 2.

[0053] Select healthy cotton seeds when sowing, and use different concentrations of fungi before sowing (10 6 , 10 7 , 10 8cfu / mL) for 2 h, and then air-dried in a cool place overnight. For the blank control, water was used instead of fermentation liquid to soak the seeds. For the treatment, 80% ethoxylated 50 mg / plant was used for root irrigation during the budding period of cotton. Field management was carried out according to the field standard, with sufficient water supply during the growth period and timely prevention and control of weeds and pests.

[0054] In late August, the peak period of Verticillium wilt in cotton, 50 cotton plants were randomly selected from each treatment and the condition of Verticillium wilt in cotton was investigated according to the following standards: Level 0: healthy plants; Level 1: Less than 10% of the leaves of the diseased plant show symptoms of disease, and the leaves show light yellow irregular spots; Level 3: 11%-25% of the leaves of the diseased plants show symptoms of disease, and light yellow irregular spots appear between the main veins of the leaves; Level 5: 26%-50% of the leaves of the diseased plants show signs of disease, the color of the lesions mostly turns yellow and yellow-brown, and the leaf edges curl and wither; Level 7: More than 51% of the leaves of the diseased plants show symptoms of disease, most of the lesions are yellow-brown, the leaf edges curl and dry, and a few leaves fall off; Level 9: The leaves of the diseased plants fall off, leaving bare stems and the plants die, sometimes with symptoms of acute wilting and death.

[0055] The disease rate, disease index and control effect were calculated as described in Example 2.

[0056] In field trials at three different test sites in 2023 and 2024, compared with the control group, soaking cotton seeds in SEB-34 fermentation liquid of different concentrations significantly reduced the incidence of cotton Verticillium wilt, showing good prevention and control effects.

[0057] Effectiveness will be seen in 2023 Figure 8 , Juye SEB-34 high concentration 10 8The control effects of the treatments with cfu / mL seed soaking, root irrigation with 80% ethionin emulsifiable concentrate as the control agent, and the treatments with medium and low concentrations of SEB-34 fermented liquid seed soaking decreased in turn, which were 69.66%, 64.04%, 62.92% and 50.56%, respectively. There was no significant difference between the treatments with high concentration of SEB-34 and the treatments with the control agent (P<0.05), and they were significantly higher than the other treatments. There was no significant difference between the treatments with medium concentration of SEB-34 and the treatments with the control agent, and the treatments with low concentration of SEB-34 fermented liquid were significantly lower than the other three treatments. The high concentration treatment of SEB-34 in Linqing had the highest control effect, which was 72.11%, which was significantly higher than the other treatments. The control effects of the treatments with medium concentration of SEB-34, the treatments with the control agent, and the treatments with low concentration of SEB-34 decreased in turn, which were 60.58%, 58.66% and 56.73%, respectively. There was no significant difference in the control effects of the three treatments. The high-concentration treatment of Guangrao SEB-34 had the highest control efficacy of 74.11%, followed by the control treatment with a control efficacy of 71.76%. The difference between the two was not significant and was significantly higher than the other two treatments. The control efficacy of the medium and low concentration treatments of SEB-34 decreased successively, reaching 63.53% and 55.3%, respectively. The control efficacy of the two treatments was equivalent.

[0058] Effectiveness will be seen in 2024 Figure 8 The control efficacy of SEB-34 high concentration seed soaking treatment in Juye was the highest, which was 62.96%, significantly higher than the other treatments. The control efficacy of 80% ethoxylated emulsifiable concentrate root irrigation treatment, SEB-34 medium and low concentration seed soaking treatments decreased in turn, which were 48.15%, 46.29% and 40.74%, respectively. Among them, the control efficacy was significantly different from that of SEB-34 low concentration treatment, and there was no significant difference between SEB-34 medium concentration treatment and control treatment and SEB-34 low concentration treatment; the control efficacy of SEB-34 high, medium and low concentration treatments in Linqing decreased in turn, which were 66.07%, 60.71% and 58.93%, and there was no significant difference among the three. The control efficacy was the lowest at 53.57%, which was significantly lower than that of SEB-34 high concentration treatment, but there was no significant difference with the other two treatments. The high and medium concentration treatments of SEB-34 in Guangrao had the highest efficacy, which were 75.0% and 69.74% respectively, with no significant difference between the two. The control agent and the low concentration treatment of SEB-34 had low efficacy, which were 65.79% and 63.16% respectively, with no significant difference between the two and the medium concentration treatment of SEB-34, and were significantly lower than the high concentration treatment of SEB-34.

[0059] The 2023 production results are shown in Fig. 9 , Juye SEB-34 high concentration 10 8The yield of the cfu / mL treatment was the highest, which was 333.61 kg, significantly higher than the other three treatments and the ck control. The yields of the control treatment, medium and low concentrations of SEB-34 treatments decreased in turn, which were 317.56 kg, 312.54 kg and 307.06 kg. There was no significant difference in the yields of the three treatments and they were all significantly higher than the ck control yield of 284.51 kg. The high and medium concentrations of SEB-34 in Linqing had the highest yields, which were 309.97 kg and 303.4 kg, respectively. The yields of the control treatment and the low concentration of SEB-34 treatment decreased in turn, which were 296.03 kg and 292.33 kg, respectively. The two treatments were significantly lower than the high concentration of SEB-34, but there was no significant difference in yield with the medium and low concentrations. The yield of the ck treatment was the lowest, which was 279.88 kg, significantly lower than the other treatments. The yield of Guangrao SEB-34 high concentration treatment was the highest, which was 241.39 kg. The yields of SEB-34 medium, low concentration treatments and control agent treatment decreased in turn, which were 234.64 kg, 225.252 kg and 211.08 kg, respectively. There was no significant difference among the three treatments. The yield of ck treatment was the lowest, which was 201.76 kg, which was significantly lower than the high and medium concentration treatments of SEB-34 fermentation broth, but the difference with the other two treatments was not significant.

[0060] The 2024 production results are shown in Fig. 9 The yields of Juye SEB-34 high, medium, low concentration treatments and the control treatment decreased in turn, which were 335.24 kg, 318.97 kg, 318.42 kg and 317.05 kg, respectively. There was no significant difference among the four treatments. The yield of ck treatment was the lowest, which was 300.21 kg, significantly lower than the high concentration treatment of SEB-34, but not significantly different from the other three treatments. The high-concentration treatment of SEB-34 in Linqing had the highest yield of 312.78 kg, which was significantly higher than the other treatments, followed by the medium-concentration treatment of SEB-34, the control agent treatment and the low-concentration treatment of SEB-34 fermentation broth, with yields of 298.9 kg, 287.94 kg and 286.08 kg, respectively. There was no significant difference between the three treatments, and all of them were higher than the yield of 266.96 kg of the ck treatment; the high-concentration treatment of SEB-34 fermentation broth in Guangrao had the highest yield of 302.32 kg, which was significantly higher than the yield of the ck treatment but not significantly different from the yields of the other treatments. The yields of the control agent treatment, the medium- and low-concentration treatments of SEB-34 and the ck treatment decreased in turn, which were 289.87 kg, 285.02 kg, 277.98 kg and 263.9 kg, respectively. There was no significant difference among the four treatments.

[0061] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. Bacillus subtilis ( Bacillus subtilis ) Application of SEB-34 in preventing and controlling crop diseases and promoting crop growth, characterized in that: The deposit number of the Bacillus subtilis SEB-34 is CGMCC No. 26419; the crop disease is caused by Verticillium dahliae ( Verticillium dahliae )cause.

2. The use according to claim 1, characterized in that: The application also includes the fermentation product of Bacillus subtilis SEB-34 and the microbial agent prepared by Bacillus subtilis SEB-34 for preventing and controlling crop diseases and promoting crop growth.

3. The use according to claim 2, characterized in that: The fermentation product is a cell-free fermentation liquid of Bacillus subtilis SEB-34, a dried product of the cell-free fermentation liquid or a concentrated liquid; the active ingredient of the microbial agent is at least one of the bacterial body, spores and fermentation product of Bacillus subtilis SEB-34; The crops are selected from eggplant, pepper, tomato, tobacco, potato, melon, watermelon, cucumber and cotton.

4. The use according to claim 2, characterized in that: The microbial agent is a liquid preparation or a solid preparation; the microbial preparation also includes an inert component.

5. The use according to claim 4, characterized in that: The amount of Bacillus subtilis SEB-34 in the liquid preparation is not less than 1×10 8 cfu / mL; the number of Bacillus subtilis SEB-34 in the solid preparation is not less than 1×10 9 cfu / g.

6. The use according to claim 4, characterized in that: The inert component is selected from at least one of an absorbent, a stabilizer and a surfactant; The amount of Bacillus subtilis SEB-34 in the solid preparation is (5-10)×10 9 cfu / g.

7. The use according to claim 2, characterized in that: The preparation method of the microbial agent comprises the following steps: Cultivating the seed liquid of Bacillus subtilis SEB-34 in a fermentation medium to obtain a fermentation liquid; obtaining a fermentation product after solid-liquid separation of the fermentation liquid; and selecting at least one of the bacterial body, spores and fermentation product of SEB-34 to obtain a microbial agent; The fermentation medium comprises the following components in percentage by weight: 1% bran, 1% corn flour, 0.5% sodium chloride, 0.1% potassium dihydrogen phosphate, 0.05% manganese sulfate, and the remainder is water.

8. The use according to claim 2, characterized in that: The preparation method of the microbial agent comprises the following steps: (1) Bacillus subtilis SEB-34 strain was activated on LB plate medium, and a single colony was picked and cultured on LB slant medium at 25°C-30°C to obtain an activated strain; (2) Inoculate the activated strain into LB liquid culture medium and culture with stirring at 35°C for 24 hours to obtain seed solution; (3) Inoculate the seed liquid into the fermentation medium at a volume ratio of 1:(25-50), and ferment and culture at 35°C and a shaking speed of 150 rpm to obtain a fermentation liquid; (4) After solid-liquid separation of the fermentation liquid, bacteria, spores and cell-free fermentation liquid can be obtained; (5) concentrating or drying the cell-free fermentation broth to obtain a dry product or concentrated solution of the SEB-34 cell-free fermentation broth; (6) Select at least one of the cells, spores and fermentation products of SEB-34 to obtain a microbial agent.

9. The use according to claim 8, characterized in that: In step (1), the composition and content of the LB plate medium and the LB slant medium are: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder; In step (2), the composition and content of the LB liquid culture medium are: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride; The pH of the LB plate culture medium, LB slant culture medium and LB liquid culture medium is 7.0; In step (3), the end point of the fermentation culture is when the mature spores in the fermentation broth account for 90% of the total number of spores and bacterial cells.

Images