Protein capable of reducing corn plant height and leaf included angle

Abstract

The invention discloses a protein ipa1 with an amino acid sequence as shown in SEQ ID NO: 1, the expression of the protein ipa1 in corn can obviously reduce the plant height and leaf included angle of the corn, but does not influence the development of ears and grains, hundred-grain weight, ear-grain weight and other agronomic characters, and the protein ipa1 is of great significance to the creation of dwarf and compact plant type corn germplasm resources and the cultivation of new varieties.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and specifically relates to a protein ipa1 having an amino acid sequence as shown in SEQ ID NO: 1 and its application in reducing plant height and leaf angle and creating compact crop germplasm resources. Background Art

[0002] Corn is an important food, feed and industrial raw material. Since 2012, the total output and planting area of ​​corn have become the largest crop in my country. In 2024, my country's corn output has reached 290 million tons. Due to the increasing demand for corn, more than 20 million tons of corn will still need to be imported each year. my country's per capita arable land area is only one-third of the world average, so it is difficult to increase the corn planting area. Therefore, it is still necessary to support my country's stable supply of corn by increasing the yield per unit area of ​​corn. Studies have shown that the increase in yield is more due to the continuous increase in density tolerance and planting density, while the increase in corn yield per plant and hybrid vigor has not significantly increased the yield [1]. In the past few decades, the yield per plant of corn in the United States has not increased significantly, but the yield per mu has increased by more than 7 times, which is mainly due to the selection and promotion of dense planting tolerant varieties [2]. At present, the planting density of corn in my country is also gradually increasing. Improving the density tolerance and planting density of varieties has become an important goal and trend in modern corn breeding.

[0003] Reducing corn plant height and stem-leaf angle is the key to improving corn's tolerance to dense planting. Excessively high corn plant height increases the probability of lodging and bending, reducing corn yield by 33.8%-62.2% or even causing total crop failure, and seriously affects mechanized harvesting, increasing harvesting costs and time. It is also not conducive to ventilation and light transmission within the plant, and causes the canopy of the plant to absorb more red light in the environment, while far-red light reaches the middle and lower layers of the plant through refraction and radiation, thereby reducing the red light / far-red light ratio in the plant. This will lead to the plant's shade avoidance reaction, resulting in plant elongation, thinning of stems, reduction of vascular bundles, changes in the composition and content of cell wall lignin cellulose, and reduced mechanical strength of stems, which in turn aggravates the occurrence of lodging [3]. Moderate dwarfing and a smaller stem-leaf angle can reduce mutual shading between corn plants, improve the overall canopy structure in the field, enhance ventilation and light transmission between plants, and facilitate photosynthesis. At the same time, it also greatly increases the red light / far-red light ratio in the lower layer of the plant, reduces the shade avoidance reaction of dense planting, and thus improves the corn plant yield. Dwarfing and compacting plant types is crucial for breeding corn varieties to tolerate dense planting. Transforming corn varieties from flat to compact types can significantly improve their tolerance to dense planting, with a yield increase of up to 16.9%. Conversely, transforming compact corn varieties into flat types can reduce yields by up to 13.79% under dense planting conditions[4].

[0004] Maize plant height and leaf angle are complex quantitative traits regulated by multiple genes. Although some key genes for plant height and leaf angle have been cloned, most of these gene mutants often carry some adverse effects, such as changes in flower organ development, excessive reduction in plant height, smaller cobs, and smaller grains, which are not conducive to the formation of maize yield and are difficult to apply in maize breeding practice [5]. Br2 (Brachytic2) is the most studied and utilized gene in maize dwarf breeding and is also the first cloned maize dwarf gene. This gene encodes an auxin transporter protein P-glycoprotein (P-glycoprotein). Individual mutations in br2 lead to shortened internodes in maize plants, especially those below the cob, and a reduction in plant height of about 50%. The circumference of the stem increases significantly, which greatly enhances the strength of the stem. The plant type is sparse at the top and dense at the bottom, which helps ventilation and light transmission. The well-developed root system makes the plant extremely tolerant to water and fertilizer. It is recognized as a plant height improvement gene with considerable commercial value [6]. Researchers used the breeding method of "hybridizing tall and short plants and selecting short plants" to improve the unfavorable traits of br2, such as leaf overlap and low fruiting rate, and developed a dwarf corn hybrid Aidan 268. At a planting density of 4,500 plants per mu, the average yield per mu of this variety is 636 kg, and the yield per mu in high-yield research fields can reach 903 kg [7]. By selectively editing the fifth exon of Br2, seven alleles with continuous stem reduction effects were created, of which two alleles, M1 and M2, had no effect on yield [8]. These excellent allelic variations will help select dwarf corn varieties, but the plant height is still some distance away from the dwarf standard. It is still necessary to increase the identification of favorable alleles for dwarf corn, the development of dwarf molecular markers, and the creation of dwarf germplasm resources. Summary of the invention

[0005] In the study of breeding dense-tolerant corn varieties, we induced EMS mutagenesis on the hard-grain mutant fka1 (fln1m reported in the patent document with publication number CN116769817B) in the B73 background, and obtained a semi-dwarf mutant. The plant height of this mutant decreased by 20%-29%, and the ear position decreased significantly, but it did not affect the development of the ear and grains, and the 100-grain weight and ear weight did not change; the leaf angle of the leaves on the ear became significantly smaller, and the plant type was compact; but other agronomic traits such as flowering period and tassels did not change significantly. These phenotypes are very close to the ideal plant type, and we named this mutant ipa1 (ideal plant architecture). Through BSA sequencing and genotype linkage analysis, it was found that this mutant was caused by a non-synonymous mutation in the second exon of the Brachytic2 (Br2) gene, resulting in a change in an amino acid. At the same time, a molecular marker of the excellent variation was developed, and the gene was introduced into the B73 background, and the semi-dwarf, compact plant type with small leaf angle was stable, and the yield trait and other agronomic traits were not affected. Based on the research results, the present invention includes the following technical solutions.

[0006] The first aspect of the present invention provides a polypeptide, wherein the polypeptide is selected from the following group:

[0007] (a) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, which is a mutant of an auxin transporter protein P-glycoprotein (P-glycoprotein), namely, an auxin transporter protein ZmABCB15, and is named ipa1 (ideal plant architecture 1);

[0008] (b) a conservative variant polypeptide derived from (a) which is formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence SEQ ID NO:1 and has the function of the polypeptide of (a);

[0009] (c) a conservative variant polypeptide derived from (a) that has 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, and more preferably 99% or more homology with the polypeptide sequence defined in (a), and has the function of the polypeptide of (a); or

[0010] (d) A derivative polypeptide having a sequence containing the polypeptide sequence described in (a) or (b) or (c).

[0011] The above function refers to the function that, when expressed in corn, can reduce the plant height and leaf angle of corn.

[0012] The second aspect of the present invention provides a polynucleotide, wherein the polynucleotide is selected from the group consisting of:

[0013] (A) a polynucleotide encoding the polypeptide as described above;

[0014] (B) a polynucleotide encoding a polypeptide whose amino acid sequence is as shown in SEQ ID NO: 1;

[0015] (C) a polynucleotide whose nucleotide sequence is shown in SEQ ID NO: 2, which is a gene ipa1 encoding the polypeptide ipa1;

[0016] (D) a polynucleotide having a nucleotide sequence homology of ≥95%, preferably ≥96%, preferably ≥97%, preferably ≥98%, more preferably ≥99% to the nucleotide sequence of SEQ ID NO: 2;

[0017] (E) A nucleotide sequence complementary to the nucleotide sequence described in any one of (A) to (D).

[0018] The third aspect of the present invention provides a DNA molecule comprising the polynucleotide as described above, for example, an expression cassette / expression frame of the polypeptide ipa1.

[0019] In one embodiment, the above-mentioned DNA molecule comprises a gene ipa1 encoding the polypeptide ipa1 having a nucleotide sequence of SEQ ID NO: 2 and a promoter located upstream, such as a cauliflower mosaic virus (CAMV) 35S promoter, a corn ubiquitin promoter, i.e., an Ubi promoter, which is an expression cassette / expression frame of the gene ipa1 encoding the polypeptide ipa1.

[0020] The fourth aspect of the present invention provides a recombinant plasmid, characterized in that it contains the DNA molecule as described in claim 3 or 4, and the recombinant plasmid is an overexpression vector formed by cloning the DNA molecule as described above on a plasmid vector suitable for expression in Agrobacterium, and the plasmid vector is selected from a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. The plasmid vector is, for example, pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121 or pTF102, etc., a vector for plant transgenesis or a modified vector.

[0021] The fifth aspect of the present invention provides a microbial engineering bacterium, which is a transformant containing the recombinant plasmid as described above, and is used to mediate the transfer of the recombinant plasmid as described above into plants such as corn, rice or wheat, etc. Preferably, the microorganism is Agrobacterium such as Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101. For example, the recombinant plasmid is transferred into the Agrobacterium strain by freeze-thaw method to form a microbial engineering bacterium.

[0022] Preferably, the microbial host of the above-mentioned microbial engineering bacteria is Agrobacterium, such as Agrobacterium tumefaciens, Agrobacterium EHA105, and Agrobacterium GV3101.

[0023] The sixth aspect of the present invention provides an application of the polypeptide, polynucleotide, DNA molecule, recombinant plasmid or microbial engineering bacteria as described above in reducing the plant height and leaf angle of plants such as gramineous crops, in improving the agronomic traits of gramineous crops, or in cultivating new varieties of short-stemmed and compact plants.

[0024] The plant may be a gramineous crop selected from the group consisting of wheat, rice, corn, soybean, barley, oats, millet, rye and sorghum.

[0025] In a specific application embodiment, the polypeptide described above, such as polypeptide ipa1, is overexpressed in plants, such as gramineous crops, by the following method, thereby reducing the plant height and leaf angle of plants, such as gramineous crops, improving agronomic traits of gramineous crops, or cultivating new varieties of short-stemmed and compact plants:

[0026] A. cloning the polynucleotide described above, such as the gene ipa1 encoding the polypeptide ipa1, into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, i.e., an ipa1 overexpression vector, and transforming the plant by Agrobacterium-mediated method to obtain a transgenic plant overexpressing the polypeptide described above, such as the polypeptide ipa1; and / or

[0027] B. cloning the polynucleotide as described above, such as the gene ipa1 encoding the polypeptide ipa1, on a plant chromosome by gene editing technology to obtain a transgenic plant overexpressing the polypeptide as described in claim 1, such as the gene ipa1 encoding the polypeptide ipa1; and / or

[0028] C. Using gene editing technology, the gene Brachytic2 (Br2, whose nucleotide sequence is shown in SEQ ID NO: 4) with the gene number Zm00001d031871 in the corn genome is replaced with the polynucleotide as described above, such as the gene ipa1 encoding the polypeptide ipa1, such as the polynucleotide with the nucleotide sequence shown in SEQ ID NO: 2.

[0029] Optionally, the gene editing technology described in the above steps B and C can be selected from the following group: homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT.

[0030] The seventh aspect of the present invention provides a method for identifying the transgenic corn overexpressing the polypeptide ipa1 obtained in step C of claim 10, comprising the following steps:

[0031] Extract maize genomic DNA and perform PCR amplification using the following primer pairs:

[0032] Forward primer ipa1-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5),

[0033] Reverse primer ipa1-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6),

[0034] When the PCR product size is 171 bp and the amplified sequence is SEQ ID NO: 7, it indicates that the corn genome contains the gene ipa1 with the nucleotide sequence of SEQ ID NO: 2.

[0035] GGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGG A GGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCT (SEQ ID NO:7); and / or

[0036] Determining whether the protein expressed by the corn cell contains the polypeptide ipa1 having an amino acid sequence as shown in SEQ ID NO: 1,

[0037] When the test results indicate that the corn genome contains the gene ipa1 with the nucleotide sequence of SEQ ID NO:2, or the protein expressed by the corn cells contains the polypeptide ipa1 with the amino acid sequence shown in SEQ ID NO:1, it indicates that the transgenic corn overexpresses the protein ipa1, and the corn variety is used as a candidate for a dwarf, compact plant type variety.

[0038] The eighth aspect of the present invention provides a kit for implementing the identification method as described above, comprising the following PCR primers for amplifying the gene ipa1:

[0039] Forward primer ipa1-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5),

[0040] Reverse primer ipa1-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6).

[0041] The kit may further include a nucleic acid extraction system for extracting total RNA or DNA from corn plant tissues such as leaves or kernels, and / or a reverse transcription system for reverse transcription into cDNA.

[0042] Furthermore, the above-mentioned kit also includes an instruction manual, which records the operating steps for extracting plant RNA or DNA, the steps for detecting the nucleotide sequence of the gene ipa1 shown in SEQ ID NO: 2, and the identification criteria.

[0043] For example, the instructions may be written on bottles, test tubes and the like, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper with an operation demonstration video APP download window such as a QR code. The instructions may also be in multimedia form, such as a CD, U disk, network disk, etc.

[0044] In one embodiment, the above-mentioned PCR amplification is a PCR MIX method.

[0045] The present invention screened a superior variant ipa1 with dwarfing, small leaf angle and compact plants in a B73 background through EMS mutagenesis. The mutation site is also located in the Brachytic2 (Br2) gene, which once again confirms that the Br2 gene is a maize dwarfing sensitive gene, as reported in the literature [6]. The mutation is a non-synonymous mutation in the second exon of the Br2 gene, i.e., a C→A mutation at the 1347th base of the gene CDS, resulting in a G449D change in an amino acid residue in the encoded auxin transporter ZmABCB15. The plant height of the mutant decreased by 20%-29%, and the ear position decreased significantly, but it did not affect the development of the ear and grain, and the 100-grain weight and ear grain weight did not change. The superior variant ipa1 can be used to create dwarf and compact plant type germplasm resources and cultivate new varieties through the combination of molecular markers and modern breeding technology, thereby providing important gene resources for molecular breeding of dwarf corn. The application prospects are broad. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The comparative phenotypes of dwarf mutants screened by EMS mutagenesis in the background of fka1 (which is the hard-grain mutant fln1m reported in the patent document with publication number CN116769817B) are shown. Among them, a: fka1 mutant grains are hard-grained; b: after fka1 is introduced into Zhengdan 958 hybrid, dent can be converted into hard-grained; c: semi-dwarf plants are separated from the M1 ear row after fka1 mutagenesis.

[0047] Figure 2 The phenotypes of the dwarf mutant ipa1 in the fka1 background were compared in the field at the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. A: photos of wild-type and mutant plants; B: photos of wild-type and mutant stems; C: photos of wild-type and mutant stems below the ear; D: plant height; E: internode distance shown in Figure C; F: fresh weight of the aboveground part; G: fresh weight of the root; H: leaf angle shown in Figure A. t-test, **P < 0.01.

[0048] Figure 3 The phenotypes of the dwarf mutant ipa1 in the fka1 background in Sanya field are shown. Among them, a: plant height phenotype in the fka1 background; bc: plant height and ear height measurement results; de: ear and grain phenotype and 100-grain fresh weight. *P<0.05, **P<0.01, ***P<0.001.

[0049] Figure 4The gene localization and genotype analysis of the dwarf mutant ipa1 are shown. Among them, a: MutMap analysis of dwarf plants isolated from the F2 of fka1 and ipa1 showed an obvious peak on chromosome 1; b: A G to A mutation occurred in the second exon of the candidate gene Br2, resulting in an amino acid change; c: Linkage analysis of this site was performed on the plants in the F2 population, and the mutation of this site in B73 was AA, the genotype of the dwarf plants was homozygous aa, and the genotype of the plants with normal plant height was AA or Aa. The mutation of this site and the plant height phenotype were completely linked; d: The expression pattern of the Br2 gene in different tissues of corn was analyzed using the reported transcriptome data.

[0050] Figure 5 The phenotypic and genotypic analysis of the ipa1 locus introduced into the B73 background is shown. Among them, a: plant height phenotype in the B73 background; bd: plant height, leaf angle, and ear height of B73 and ipa1 type plants isolated from the F2 of B73 and ipa1; a G to A mutation occurred in the second exon of the candidate gene Br2, resulting in an amino acid change; e: linkage analysis of the mutation site in the individual plants of the F2 of B73 and ipa1, and the plant height phenotype was completely linked to the ipa1 locus. The genotype of the dwarf plant was homozygous aa, and the genotype of the plant with normal plant height was AA or Aa; fg: ear and grain phenotypes and 100-grain fresh weight of B73 and ipa1. *P<0.05, **P<0.01, ***P<0.001. DETAILED DESCRIPTION

[0051] Breeding new dwarf and semi-dwarf varieties that tolerate dense planting can effectively increase corn yield. However, most dwarf mutants currently have a serious impact on plant yield and other important traits, making them difficult to use in breeding. Therefore, it is particularly important to explore superior allelic variations that can lead to reasonable dwarfing of plant height, small leaf angles, and compact plants without affecting yield and other agronomic traits, in order to improve corn plant structure and dense planting, thereby increasing corn yield.

[0052] EMS (Ethylmethanesulfonate) is a commonly used chemical mutagen, a DNA ethylating agent that can induce a high-density series of allele point mutations. It has the advantages of high efficiency, low negative effects, and easy operation. It has been widely used in plant-related genetic research and mutagenesis breeding.

[0053] In the research on the development of densely planted corn varieties, our research group screened a mutant with a B73 background through EMS mutagenesis. Genetic analysis showed that the mutation occurred in the second exon of the gene with the gene number Zm00001d031871 (Brachytic2, Br2), which was a non-synonymous mutation in the second exon of the gene CDS 1347th base C→A mutation (nucleotide sequence changed from SEQ ID NO:4 to SEQ ID NO:2), resulting in a G449D change in an amino acid residue in the encoded auxin transporter ZmABCB15 (ABCB transporter family member) (amino acid sequence changed from SEQ ID NO:3 to SEQ ID NO:1). The mutant plant height decreased by 20%-29%, and the ear position decreased significantly, but it did not affect the development of ear and grain, and the 100-grain weight and ear weight did not change; the leaf angle of the leaves on the ear was significantly reduced, and the plant type was compact; but other agronomic traits such as flowering period and tassel did not change significantly. These phenotypes are very close to the ideal plant architecture, so the mutant was named ipa1 (ideal plant architecture).

[0054] Although the present invention tested the function of the mutant polypeptide ipa1 in reducing corn plant height and / or leaf angle in corn varieties such as fka1 and B73, those skilled in the art can expect that the polypeptide ipa1 can also be extended to other corn varieties, and even to other gramineous crops such as rice, corn, soybeans, millet, barley, oats, rye and sorghum, to cultivate new varieties resistant to dense planting.

[0055] In addition, those skilled in the art can expect that it is reasonable that some conservative variant polypeptides of polypeptide ipa1 have the same function.

[0056] As used herein, the term "conservative variant polypeptide" refers to a polypeptide that substantially maintains the same biological function or activity as the polypeptide. The "conservative variant polypeptide" may be (i) a polypeptide in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substitution group in one or more amino acid residues, or (iii) a polypeptide formed by the fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide formed by the fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or protein sequence used to purify the polypeptide. For example, (1) the amino acid residues shown in ipa1 of the polypeptide are substituted. (1) a polypeptide having the function of polypeptide ipa1 formed by substitution, deletion or addition of one or more (e.g., 1-20, preferably 1-10; more preferably 1-5; more preferably 1-3) amino acid residues; (2) a polypeptide having more than 50% (preferably more than 60%; more preferably more than 70%; more preferably more than 80%; more preferably more than 85%; more preferably more than 90%; more preferably more than 95%; more preferably more than 98%; more preferably more than 99%) identity with the sequence shown in polypeptide ipa1; or (3) a polypeptide having the function of polypeptide ipa1 formed by adding a tag sequence to the N or C terminus of the polypeptide ipa1, or adding a signal peptide sequence to its N terminus. polypeptides. According to the teachings of this article, these fragments, derivatives and analogs are within the scope known to those skilled in the art. The term "variation" or "mutation" includes, but is not limited to, replacement, deletion, insertion, chemical modification of amino acid residues, preferably a forward mutation, i.e., a mutation that improves function. The substitution may be a non-conservative substitution, a conservative substitution, or a combination of non-conservative and conservative substitutions. "Conservative" amino acid substitutions or mutations refer to the interchangeability of residues with similar side chains, and therefore generally include replacing an amino acid in a polypeptide with an amino acid in the same or similar amino acid defined class. However, as used herein, if a conservative mutation may instead be aliphatic to aliphatic, non-polar to non-polar, polar to Polar, acidic to acidic, basic to basic, aromatic to aromatic, or restricted residue to restricted residue substitution, conservative mutation does not include hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing or small residue to small residue substitution. It is well known in the art that common cases of conservative substitution include: mutual substitution between aromatic amino acids F, W, and Y; mutual substitution between hydrophobic amino acids L, I, and V; mutual substitution between polar amino acids Q and N; mutual substitution between basic amino acids K, R, and H; mutual substitution between acidic amino acids D and E; and mutual substitution between hydroxyl amino acids S and T. In addition, A, V, L, or I can be conservatively mutated to another aliphatic residue or another non-polar residue.

[0057] Exemplary conservative substitutions can be made, for example, according to the following table.

[0058] Initial residue Representative replacement Preferred substitutions Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu

[0059] In order to express the polypeptide ipa1 in plants such as corn, its encoding gene is used as an exogenous gene to construct a gene expression cassette or expression construct as a DNA molecule, and the expression cassette / expression construct is operably connected to a plasmid vector through subcloning to obtain a recombinant plasmid, and then the recombinant plasmid is transformed into a host cell to obtain a transformant, i.e., a genetically engineered bacterium or a recombinant bacterium, or is transferred into a plant through an Agrobacterium-mediated method to obtain a transgenic plant.

[0060] As used herein, the terms "(plant height and / or leaf angle) decrease", "decrease" or "reduction" can mean a decrease of at least 10% compared to a reference level (such as wild-type corn such as B73), for example, a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a decrease of 100%, or any decrease between 10%-100% compared to a reference level.

[0061] In the description of the technical solutions of the present invention, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0062] In this article, for the sake of simplicity, a certain protein, such as the polypeptide ipa1, is sometimes used interchangeably with its encoding gene (DNA) name ipa1. Those skilled in the art should understand that they represent different types of substances in different description occasions. Those skilled in the art can easily understand their meanings based on the context. For example, for ipa1, when used to describe the protein function or category of reducing plant height and / or leaf angle, it refers to the protein; when described as a gene, it refers to the encoding gene of the protein.

[0063] As used herein, the "expression cassette" or "gene expression cassette" refers to a gene expression system that contains all the necessary elements required to express the target protein ipa1, which generally includes the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; in addition, it may optionally include a signal peptide coding sequence such as mCherry (red fluorescent protein), GFP (green fluorescent protein) or YFP (yellow fluorescent protein), etc.; these elements are operably linked.

[0064] As used herein, the "expression construct" or "expression construct" refers to a recombinant DNA molecule that includes a desired nucleic acid coding sequence (e.g., SEQ ID NO: 2), which may include one or more gene expression cassettes. The "construct" is usually contained in an expression vector (plasmid vector).

[0065] As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) and a host cell from different sources. For example, a nucleic acid is exogenous to a host cell if the combination of nucleic acid and host cell does not normally occur in nature. A particular sequence is "exogenous" to a cell or organism into which it is inserted.

[0066] As used herein, the term "operably linked" or "operably linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene nucleic acid sequence SEQ ID NO: 2, so that transcription of the nucleic acid sequence is guided by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0067] The nucleic acid construct of the present invention can be manipulated in a variety of ways to ensure the expression of the polypeptide ipa1. The nucleic acid construct can be manipulated before inserting it into a vector according to the different expression vectors or requirements. The technology of using recombinant DNA methods to change polynucleotide sequences is known in the art.

[0068] In certain embodiments, the nucleic acid construct is a vector. The vector may be a cloning vector, an expression vector, or a gene knock-in vector. The nucleic acid sequence SEQ ID NO:2 of the present invention can be cloned into many types of vectors, for example, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Cloning vectors can be used to provide the coding sequence of the protein or polypeptide of the present invention. The expression vector can be provided to the cell in the form of a bacterial vector or a viral vector. The expression of the ipa1 gene is usually achieved by operably connecting the nucleic acid sequence SEQ ID NO:2 of the present invention to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration of eukaryotic cells. A typical expression vector comprises an expression control sequence that can be used to regulate the expression of the desired nucleic acid sequence.

[0069] A knock-in vector can be used to integrate the polynucleotide sequence SEQ ID NO:2 described herein into the region of interest of the host genome. Typically, the knock-in vector may contain, in addition to the polynucleotide sequence, a 5' homology arm and a 3' homology arm required for homologous recombination of the genome. In some embodiments, the nucleic acid construct herein contains a 5' homology arm, a polynucleotide sequence described herein, and a 3' homology arm. When using a knock-in vector, the CRISPR / Cas9 technology can be used simultaneously to homologously recombine the polynucleotide sequence to the position of interest. CRISPR / Cas9 technology guides the Cas9 nuclease to modify the genome at the insertion position by designing a guide RNA for the target gene, thereby increasing the homologous recombination efficiency of the gene modification region, and homologously recombine the target fragment SEQ ID NO:2 contained in the knock-in vector to the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as Cas9 nuclease, are well known in the art.

[0070] Methods well known to those skilled in the art can be used to construct nucleic acid constructs. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters include: lac or trp promoters of Escherichia coli; λ phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retroviruses and other known promoters that can control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline, ampicillin resistance or chloramphenicol for Escherichia coli and Agrobacterium.

[0071] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Examples include the SV40 enhancer of 100 to 270 base pairs on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0072] A vector containing an appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell to enable it to express the protein.

[0073] When the polypeptide ipa1 is used to improve the agronomic traits of Gramineae crops or to create new crop varieties with short stems and compact plant types, it is preferably transferred into the plants through traditional Agrobacterium-mediated methods, for which a recombinant Agrobacterium engineering strain expressing ipa1 needs to be constructed.

[0074] The terms "recombinant bacteria (strain)" and "(genetically) engineered bacteria (strain)" herein have the same meaning, and both refer to strains that have been genetically modified for wild-type Agrobacterium, such as Agrobacterium tumefaciens, and contain an ipa1 overexpression vector.

[0075] When using the traditional Agrobacterium-mediated method to construct transgenic plants, the construction method of transgenic plants includes:

[0076] 1) Providing Agrobacterium carrying an expression vector, wherein the expression vector contains a coding sequence of the polypeptide ipa1;

[0077] 2) contacting the plant cells, tissues or organs with the Agrobacterium in step 1) so that the coding sequence is transferred into the plant cells and integrated into the chromosomes of the plant cells;

[0078] 3) selecting plant cells or tissues into which the coding sequence has been transferred; and

[0079] 4) Regenerating the plant cells or tissues in step 3) into plants.

[0080] Whether the transgenic plant is successfully constructed can be identified by conventional PCR amplification methods. That is, after conventional tissue DNA extraction, amplification using conventional PCRmix reagents, reaction systems and PCR amplification procedures, PCR product sequencing is performed using forward primer ipa1-F and reverse primer ipa1-R.

[0081] The forward primer is ipa1-F: 5'-GGCACCTACTTCACCGTCTT-3' (SEQ ID NO: 5),

[0082] The reverse primer was ipa1-R: 5'-AGGAGCAGCAGAAGGAGAGA-3' (SEQ ID NO: 6).

[0083] The PCR product sequence of the positive transgenic plant, ipa1 mutant, is:

[0084] GGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGG A GGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCT(SEQ ID NO:7);

[0085] The normal PCR product sequence in wild plants such as corn B73 is:

[0086] GGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGG C GGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCT (SEQ ID NO: 8).

[0087] The PCR product shown in the sequence SEQ ID NO:7 can be used as a molecular marker of the excellent variation ipa1, and is relatively simple, fast and efficient for improving crops with dwarfing, small leaf angle and compact plants. During improvement, backcrossing and introduction methods can be used, and detection primers can be used for tracking detection, and the techniques are relatively conventional. Molecular marker selection can reduce the population size, shorten the improvement cycle, thereby greatly saving costs and improving breeding efficiency.

[0088] The combination of the above molecular markers and modern breeding technology can save and accelerate the cultivation of dwarf corn. The ipa1 mutation site is recessive, and both the male and female parents need to be improved at the same time. The ipa1 donor material and the backbone inbred line are used for hybridization and backcrossing, and the mutation site is selected by molecular markers. After 2-3 generations of backcrossing, the haploid is doubled to obtain a pure line with homozygous sites, and then screening, large-scale group matching and field testing are carried out to select excellent combinations for variety approval or production promotion, which greatly shortens the time of dwarf breeding.

[0089] The present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0090] Example

[0091] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0092] In the examples herein, if no specific description is given for the reaction temperature or the operating temperature, the temperature generally refers to room temperature (15-30° C.).

[0093] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., mainly with reference to "Molecular Cloning Experiment Guide" (3rd edition), compiled by J. Sambrook, DW Russell (USA), translated by Huang Peitang, etc., Science Press, Beijing, 2002). For example, the competent cell transformation method and the competent preparation method are all carried out with reference to "Molecular Cloning Experiment Guide" (3rd edition), Chapter 1, page 96. If necessary, the specific experimental conditions can be determined by simple experiments.

[0094] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0095] EMS mutagenesis, selfing, and hybridization of corn were carried out according to conventional breeding methods.

[0096] BSA sequencing analysis was performed by Paisono Biotech.

[0097] The primer synthesis and gene sequencing in the examples were all completed by Shanghai Boshang Biotechnology Co., Ltd.

[0098] The molecular biological methods and transgenic plant construction methods, including the construction of ipa1 overexpression recombinant plasmid and Agrobacterium engineering bacteria, are operated using technical means commonly used in the field.

[0099] Example 1: Screening of dwarf mutants by EMS mutagenesis

[0100] The hard-grain mutant fka1 (i.e., the hard-grain mutant fln1m reported in the patent document with publication number CN116769817B) was subjected to EMS mutagenesis, and it was found that the fka1 gene alone could improve the grains of the dent to a hard-grain type, while significantly reducing the water content without affecting the yield ( Figure 1 a and b) have important breeding value in cultivating hard-grained corn that is quick to dehydrate and easy to harvest mechanically. The contemporary M0 seeds induced by EMS were self-pollinated and harvested as single ears to obtain M1 generation seeds (equivalent to F2); each ear was planted into ear rows in the next season, with 15 seeds sown in each row. The phenotype was observed from the jointing and flowering stages, and dwarf mutants were found in multiple ear rows. Most of the plants were severely dwarfed, with undesirable traits such as yellow leaves and flowers, weak plants, small ears, small grains, and retarded growth and development. In addition, a semi-dwarf mutant was found in one ear row, and there were no obvious changes in the compact plant type, normal flowering, male flowers, ears, and grain development ( Figure 1 c), which has important application potential in the breeding of dwarf corn.

[0101] Example 2: Phenotypic analysis of the superior dwarf variant ipa1

[0102] The selected dwarf mutants were crossed with fka1 and then self-pollinated to obtain F2, which was then planted in the greenhouse of the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences of the Chinese Academy of Sciences, from which dwarf and normal plant height materials were isolated. Agronomic traits were investigated during the flowering period, and the results showed that the average plant height of the dwarf mutant dropped from 224 cm to 160 cm, a decrease of 28.7% ( Figure 2 a, d); the length of the internode below the ear is significantly shortened, resulting in a significant decrease in ear position ( Figure 2 b, c, e); the biomass of the aboveground and underground parts also decreased significantly ( Figure 2 f, g), while the leaf angles of the lower, middle, and upper leaves decreased significantly, by 10 degrees (°), 6 degrees, and 4 degrees, respectively, showing a compact plant type ( Figure 2 h). In addition, the phenotype was examined again by field planting at the Sanya Experimental Base of the Center for Excellence in Molecular Plant Sciences of the Chinese Academy of Sciences. The results showed that the plant height decreased from 190 cm to 134 cm, a decrease of 29.5% ( Figure 3a, b), ear position was significantly reduced ( Figure 3 c), the plants are compact, the ears and grains develop normally, and the 100-grain fresh weight has no significant change ( Figure 3 In d and e), due to the fka1 background, the grains are hard. In addition, there are no obvious changes in agronomic traits such as flowering period and tassel development. This mutant can lead to a dwarf and compact plant phenotype but does not affect other agronomic traits such as yield, which is very close to the requirements of the ideal plant type, so the mutant was named ipa1.

[0103] Example 3: Gene cloning and linkage analysis of ipa1

[0104] The F2 population of the ipa1 dwarf mutant and fka1 was planted in the field, each individual plant was labeled and leaves were frozen, and the plant height was counted during the flowering period, indicating that the separation was obvious. 50 mutant individuals were mixed and sequenced, and the sequencing data of fka1 were analyzed by the MutMap method. The results showed that only one obvious peak appeared on chromosome 1, and the candidate gene was Zm00001d031871 (Brachytic2, Br2). The mutation occurred at the 1347th base (the second exon) of the gene CDS, and the mutation from C to A caused the 449th amino acid to mutate from G (glycine Gly) to D (aspartic acid Asp) ( Figure 4 A molecular marker for this mutation was developed, and linkage analysis was performed on 64 dwarf individuals and 56 normal plant height individuals isolated from F2. The results showed that all dwarf individuals were homozygous mutations at this site; 36 normal plant height individuals were heterozygous genotypes, and 20 were wild-type genotypes ( Figure 4 c). Br2 is the most widely used gene in dwarf corn breeding, and a series of dwarf mutants have also been isolated. At the same time, the expression pattern of this gene was studied in the published transcriptome data of corn, and it was found that ipa1 was highly expressed in leaves, filaments, and cobs, and was relatively low in grains ( Figure 4 (middle d, Yi et al. 2019). This indicates that the variation at this locus is completely linked to the dwarf plant height phenotype.

[0105] The steps for genomic DNA extraction are as follows:

[0106] (1) Place corn leaves in a 2 mL tube, add steel beads, treat with liquid nitrogen, and grind (60 Hz, 60 s);

[0107] (2) After grinding, add 0.6 mL of CTAB extraction buffer, mix well, and place in a 65°C oven for 60 min, mixing every 10-15 min;

[0108] (3) Take out and place at room temperature for 5-10 minutes, add equal volumes of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, seal it and shake it for 5 minutes;

[0109] (4) Centrifuge at room temperature at 13,000 rpm for 15 min, aspirate the supernatant into a new 1.5 mL centrifuge tube; add an equal volume of isopropanol, invert and mix, and place at -20 degrees for 20 min; centrifuge at room temperature at 12,000 rpm for 1 min, and discard the supernatant;

[0110] (5) Wash the DNA precipitate with 1 mL of 75% ethanol 1 to 2 times, centrifuging at 12,000 rpm for 1 min each time, and then pour off the ethanol; dry the DNA precipitate at room temperature;

[0111] (6) Add 0.3 mL of ddH2O to dissolve the DNA precipitate.

[0112] PCR identification method:

[0113] (1) PCR reaction was performed using 2× PCR Master Mix reagent was used;

[0114] (2) Prepare 20 μL reaction system: 2× PCR Master Mix 10 μL, primers 1 μL each, DNA 2 μL, ddH2O 6 μL;

[0115] (3) PCR conditions were as follows: pre-denaturation at 95°C for 5 min, amplification at 95°C for 30 s, Tma for 30 s, 72°C for 1 min, 35 cycles, termination at 72°C for 10 min, and 16°C for 1 min.

[0116] Sequencing identification of PCR products:

[0117] The PCR product was sequenced and verified by a sequencing company, and the sequencing sequence and the target sequence of the vector were compared and analyzed using SnapGene software. The target sequence is 334 bp:

[0118] Example 4: Introduction of ipa1 into the B73 background can also produce dwarf and compact plant phenotypes

[0119] ipa1 and B73 were crossed and then selfed. The F2 generation plants were identified by molecular markers of fka1 and ipa1, and the ipa1 locus homozygous ears were obtained. The phenotype was also examined, and the results showed that the plant height decreased from 183 cm to 150 cm, a decrease of 20% ( Figure 5 a, b); the leaf angle above the ear decreased from 29 degrees to 24.9 degrees, and the plants were compact ( Figure 5 Middle c), the ear position was significantly reduced ( Figure 5d); the plant height phenotype is completely linked to the ipa1 genotype, the genotype of the dwarf plant is aa, and the genotype of the normal plant height is AA or Aa ( Figure 5 Middle e); the ears and kernels developed normally, and the 100-kernel fresh weight did not change significantly ( Figure 5 In f and g), the grains were dent-shaped, the same as B73. In addition, there were no significant changes in agronomic traits such as flowering period and tassel development.

[0120] The above experimental results show that the ipa1 mutant is an excellent variation with dwarfing and compact plants. It does not affect other agronomic traits such as corn yield, and is very close to the requirements of ideal plant type. It has important application potential in dwarfing breeding and close planting.

[0121] The above embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Any equivalent substitution or change made by a person skilled in the art based on the present invention is within the protection scope of the present invention.

[0122] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be regarded as an admission that the document is prior art or common knowledge.

[0123] Main references

[0124] [1]Troyer AF,Wellin EJ.Heterosis decreasing in hybrids:yield testinbreds[J].Crop Sci,2009,49(6):1969-1976.

[0125] [2]Mansfield BD,Mumm RH.Survey of plant density tolerance inU.S.maize germplasm[J].Crop Sci,2014,54(1):

[0126] [3] Wang Baobao, Wang Haiyang. Ideal plant type shaping for corn density tolerance improvement[J]. Biotechnology Bulletin, 2023, 39(8):1

[0127] [4] Li Denghai, Zhang Yonghui, Zhai Yanju, et al. The role of corn plant type in high-yield breeding. I. The yield-increasing effect of plant type [J]. Shandong Agricultural Science, 1992, 24(3): 4-8.

[0128] [5] Wang Tianyi, Wang Ronghuan, Wang Xiaqing, et al. Research on maize dwarf genes and dwarf breeding[J]. Biotechnology Bulletin, 2023, 39(8): 43-51.

[0129] [6]Multani DS,Briggs SP,Chamberlin MA,et al.Loss of an MDRtransporter in compact stalks of maize Br2 and sorghum dw3 mutants[J].Science,2003,302(5642):81-84

[0130] [7] Cui Shaoping. Breeding of dwarf genotype hybrid of corn br-2, Aidan 268[J]. China Seed Industry, 2014(12):68-69

[0131] [8] Zhao B, Xia Z, Sun C, et al. CRISPR / Cas9-mediated genomic editing ofBrachytic2 creates semi-dwarf mutant alleles for tailored maize breeding[J]. Plant Biotechnol J, 2025, 101-3.

Claims

1. A polypeptide, wherein the polypeptide is selected from the group consisting of: (a) a polypeptide with an amino acid sequence as shown in SEQ ID NO: 1, named ipa1; (b) a polypeptide derived from (a) which is formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence SEQ ID NO:1 and has the function of the polypeptide of (a); (c) a polypeptide derived from (a) that has a sequence homology of more than 95% with the polypeptide defined in (a) and has the function of the polypeptide of (a); or (d) A derivative polypeptide having a sequence containing the polypeptide sequence described in (a) or (b) or (c).

2. A polynucleotide selected from the group consisting of: (A) a polynucleotide encoding the polypeptide of claim 1; (B) a polynucleotide encoding a polypeptide whose amino acid sequence is as shown in SEQ ID NO: 1; (C) a polynucleotide whose nucleotide sequence is shown in SEQ ID NO: 2, which is a gene ipa1 encoding the polypeptide ipa1; (D) a polynucleotide having a nucleotide sequence homology of ≥95%, preferably ≥96%, preferably ≥97%, preferably ≥98%, more preferably ≥99% to the nucleotide sequence of SEQ ID NO: 2; (E) A nucleotide sequence complementary to the nucleotide sequence described in any one of (A) to (D).

3. A DNA molecule, characterized in that Comprising the polynucleotide as claimed in claim 2.

4. The DNA molecule according to claim 3, characterized in that The invention comprises a gene ipa1 encoding a polypeptide ipa1 having a nucleotide sequence of SEQ ID NO: 2 and a promoter located upstream.

5. A recombinant plasmid, characterized in that: Comprising the DNA molecule according to claim 3 or 4.

6. A microbial engineering bacterium, characterized in that: The transformant comprises the recombinant plasmid as claimed in claim 5.

7. The microbial engineering bacteria according to claim 5, characterized in that The microbial host is Agrobacterium.

8. Use of the polypeptide according to claim 1, the polynucleotide according to claim 2, the DNA molecule according to claim 3, the recombinant plasmid according to claim 4, or the microbial engineering bacteria according to claim 6 in reducing plant height and leaf angle, in improving agronomic traits of gramineous crops, or in breeding new varieties of short-stemmed and compact plants.

9. The use according to claim 8, characterized in that The plant is a grass crop selected from the group consisting of wheat, rice, corn, soybean, barley, oats, millet, rye and sorghum.

10. The use according to claim 8, characterized in that The polypeptide as claimed in claim 1 is overexpressed in plants by the following method to reduce plant height and / or leaf angle, improve agronomic traits of gramineous crops or cultivate new varieties of short-stemmed and compact plants: A. cloning the polynucleotide as claimed in claim 2 into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, transforming the plant by Agrobacterium-mediated method to obtain a transgenic plant overexpressing the polypeptide as claimed in claim 1; and / or B. cloning the polynucleotide as claimed in claim 2 on a plant chromosome by gene editing technology to obtain a transgenic plant overexpressing the polypeptide as claimed in claim 1; and / or C. Using gene editing technology, the gene Brachytic2 with the gene number Zm00001d031871 in the corn genome is replaced with the gene ipa1 encoding the polynucleotide as described in claim 2, such as the polypeptide ipa1.

11. A method for identifying transgenic corn overexpressing polypeptide ipa1 obtained in step C of claim 10, characterized in that: The steps include: Maize genomic DNA was extracted and PCR amplification was performed using the following primer pairs: Forward primer ipa1-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5), Reverse primer ipa1-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6), When the sequence of the PCR amplification product is SEQ ID NO: 7, it indicates that the corn genome contains the gene ipa1 having the nucleotide sequence of SEQ ID NO: 2; and / or Determining whether the protein expressed by the corn cell contains the polypeptide ipa1 having an amino acid sequence as shown in SEQ ID NO: 1, When the test results indicate that the corn genome contains the gene ipa1 with the nucleotide sequence of SEQ ID NO:2, or the protein expressed by the corn cells contains the polypeptide ipa1 with the amino acid sequence shown in SEQ ID NO:1, it indicates that the transgenic corn overexpresses the polypeptide ipa1, and the corn variety is considered a candidate for a dwarf, compact plant type variety.

12. A kit for implementing the method according to claim 11, characterized in that: The following PCR primers were included for amplifying the gene ipa1: Forward primer ipa1-F: GGCACCTACTTCACCGTCTT (SEQ ID NO: 5), Reverse primer ipa1-R: AGGAGCAGCAGAAGGAGAGA (SEQ ID NO: 6).

Images