An Antibody Against KOFU DNA Polymerase and Its Application

Abstract

The present disclosure provides an antibody against KOFU DNA polymerase and its application. The provided monoclonal antibody can efficiently and specifically neutralize the polymerization activity and exonuclease activity of KOFU DNA polymerase after mixed incubation with KOFU. After pre-denaturation, KOFU DNA polymerase restores its activity and can be applied to amplification reaction.

Description

Technical Field

[0001] This disclosure pertains to the fields of immunology and genetic engineering, and specifically relates to an antibody against KOFU DNA polymerase and its applications. Background Technology

[0002] In PCR technology, inaccurate experimental results are often caused by primer sequence design defects, primer overuse, primer dimers, or mismatches leading to nonspecific amplification. Furthermore, the high 3′-5′ exonuclease (proofreading) activity of DNA polymerases also causes primer and substrate degradation during room temperature system preparation and PCR temperature programming (e.g., Y-sequencing libraries). Hot-start PCR effectively addresses these issues. Hot-start enzymes primarily utilize enzyme modifiers that inhibit DNA polymerase activity at room temperature; upon heating to the denaturation temperature, the modifiers are inactivated, releasing enzyme activity and allowing the PCR reaction to proceed normally. Currently, most commercially available DNA polymerases employ antibody hot-start technology to solve these problems.

[0003] The KOFU DNA polymerase chimera is derived by replacing the Palm-figers region of the Pfu DNA polymerase with the same region of the KOD DNA polymerase. KOFU DNA polymerase possesses both high 5′-3′ polymerization activity and high 3′-5′ exonuclease (proofreading) activity, ensuring high yield and fidelity of PCR products. The high fidelity and amplification efficiency of KOFU DNA polymerase provide a superior option for next-generation sequencing library amplification.

[0004] However, there are currently no reports of monoclonal antibodies against KOFU DNA polymerase. There is an urgent need to develop a monoclonal antibody that blocks KOFU DNA polymerase in order to improve its specificity and sensitivity. Summary of the Invention

[0005] To address at least one of the above-mentioned problems, this disclosure provides an antibody against KOFU DNA polymerase and its application. Using the antibody provided by this disclosure, the activity of KOFU DNA polymerase can be neutralized efficiently and specifically.

[0006] According to one aspect of this disclosure, an anti-KOFU DNA polymerase antibody or an antigen-binding fragment thereof is provided, said antibody or antigen-binding fragment comprising:

[0007] (1) The following three heavy chain variable region complementarity-determining regions (HCDRs):

[0008] HCDR1, having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in SEQ ID NO:1, or having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region.

[0009] HCDR2, having the amino acid sequence of HCDR2 contained in the heavy chain variable region as shown in SEQ ID NO:1, or having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region.

[0010] HCDR3, having the amino acid sequence of HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO:1, or having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region; and / or

[0011] (2) The following three light chain variable region complementary determinant regions (LCDRs):

[0012] LCDR1, having the amino acid sequence of LCDR1 contained in the light chain variable region as shown in SEQ ID NO:2, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of LCDR1 contained in the light chain variable region.

[0013] LCDR2, having the amino acid sequence of LCDR2 contained in the light chain variable region as shown in SEQ ID NO:2, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of LCDR2 contained in the light chain variable region.

[0014] LCDR3 having the amino acid sequence of LCDR3 contained in the light chain variable region as shown in SEQ ID NO:2, or having an amino acid sequence with one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

[0015] In some embodiments, the antibody or its antigen-binding fragment comprises HCDR1, HCDR2 and HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO:1, and LCDR1, LCDR2 and LCDR3 contained in the light chain variable region as shown in SEQ ID NO:2.

[0016] In some implementations, the HCDR1-3 and / or the LCDR1-3 are defined by the IMGT numbering system, the Kabat numbering system, the Chothia numbering system, the Contact numbering system, or a combination thereof.

[0017] In some embodiments, the antibody or its antigen-binding fragment comprises:

[0018] (1) The following heavy chain variable regions and / or light chain variable regions, wherein HCDR1-3 and / or LCDR1-3 are defined according to the IMGT numbering system: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO:11, HCDR2 with sequence SEQ ID NO:12, and HCDR3 with sequence SEQ ID NO:13; and / or light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO:14, LCDR2 with sequence AAS, and LCDR3 with sequence SEQ ID NO:15;

[0019] or

[0020] (2) The following heavy chain variable regions and / or light chain variable regions, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Kabat numbering system as follows: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO:16, HCDR2 with sequence SEQ ID NO:17, and HCDR3 with sequence SEQ ID NO:18; and / or light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO:19, LCDR2 with sequence SEQ ID NO:20, and LCDR3 with sequence SEQ ID NO:15;

[0021] or

[0022] (3) The following heavy chain variable regions and / or light chain variable regions, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Chothia numbering system: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO:21, HCDR2 with sequence SEQ ID NO:22, and HCDR3 with sequence SEQ ID NO:18; and / or light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO:19, LCDR2 with sequence SEQ ID NO:20, and LCDR3 with sequence SEQ ID NO:15;

[0023] or

[0024] (4) The following heavy chain variable regions and / or light chain variable regions, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Contact numbering system as follows: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO:23, HCDR2 with sequence SEQ ID NO:24, and HCDR3 with sequence SEQ ID NO:25; and / or light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO:26, LCDR2 with sequence SEQ ID NO:27, and LCDR3 with sequence SEQ ID NO:28.

[0025] In some embodiments, the antibody or its antigen-binding fragment comprises:

[0026] The heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:1, an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it; and

[0027] The light chain variable region has an amino acid sequence as shown in SEQ ID NO:2, an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to it, or an amino acid sequence having at least 80% sequence identity with it.

[0028] In some embodiments, the antibody or its antigen-binding fragment comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO:1 and a light chain variable region having the amino acid sequence shown in SEQ ID NO:2.

[0029] In some embodiments, the antibody or its antigen-binding fragment includes antibody Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, scFv fragments, nanobodies, heavy chain variable region VH fragments, or light chain variable region VL fragments.

[0030] In some embodiments, the antibody or its antigen-binding fragment is derived from IgG, IgA, IgM, IgD, or IgE.

[0031] In some embodiments, the heavy chain of the antibody or its antigen-binding fragment is derived from any one of IgG1, IgG2a, IgG2b, IgG3 or IgG4, and / or the light chain is derived from any one of the kappa light chain and the lambda light chain.

[0032] In some embodiments, in the antibody or its antigen-binding fragment, the heavy chain is derived from IgG1 and the light chain is derived from the kappa light chain.

[0033] In some embodiments, the KOFU DNA polymerase has an amino acid sequence as shown in SEQ ID NO:3, or an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to it.

[0034] According to another aspect of this disclosure, an isolated nucleic acid molecule is provided that encodes the antibody or an antigen-binding fragment thereof.

[0035] According to another aspect of this disclosure, an expression cassette is provided that contains the isolated nucleic acid molecules.

[0036] In some implementations, the expression box also includes a promoter.

[0037] In some embodiments, the expression cassette further includes one or more of the following: enhancers, terminators, non-coding regions, or reporter genes.

[0038] According to another aspect of this disclosure, an expression vector is provided that comprises the isolated nucleic acid molecule.

[0039] According to another aspect of this disclosure, a host cell is provided comprising the isolated nucleic acid molecule, the expression cassette, or the expression vector.

[0040] In some embodiments, the host cell includes a eukaryotic or prokaryotic cell.

[0041] In some embodiments, the prokaryotic cells include bacteria.

[0042] In some embodiments, the bacteria include Escherichia coli, such as BL21(DE3), EcB1, EcB1SAintimin, EcB1SAintiminfap, EcB1SAYeeJ, and EcB1SAYeeJfap.

[0043] In some embodiments, the eukaryotic cells include yeast, insect, plant, mammalian cells, or hybridoma cells.

[0044] In some embodiments, the hybridoma cells are obtained by fusing myeloma cells and B lymphocytes.

[0045] In some embodiments, the B lymphocytes are derived from the spleen.

[0046] According to another aspect of this disclosure, a complex is provided comprising the antibody or its antigen-binding fragment thereof and KOFU DNA polymerase, wherein the antibody or its antigen-binding fragment and KOFU DNA polymerase specifically bind.

[0047] In some embodiments, the ratio of the antibody or its antigen-binding fragment to the KOFU DNA polymerase includes (0.8–12 μg): 1 U.

[0048] In some embodiments, the complex can initiate a DNA strand 5'-3' extension reaction or a DNA strand 3'-5' exonucleation reaction.

[0049] In some embodiments, the complex can initiate a DNA amplification reaction.

[0050] According to another aspect of this disclosure, a kit is provided comprising the antibody or its antigen-binding fragment, or the complex thereof.

[0051] In some embodiments, the kit further includes buffer solution and Mg 2+ dNTPs, DNA templates, and primers that can bind complementary to the DNA template.

[0052] According to another aspect of this disclosure, a conjugate is provided comprising: the antibody or an antigen-binding fragment thereof; and a conjugation portion.

[0053] In some implementations, the coupling portion is selected from detectable markers.

[0054] In some embodiments, the detectable markers include, but are not limited to, radioactive isotopes, fluorescent substances, luminescent substances, colored substances, polyethylene glycol, radionuclides, nucleic acids, polypeptides with binding activity, proteins, receptors, ligands, etc.

[0055] According to another aspect of this disclosure, a method for preparing the complex is provided, comprising the step of incubating the antibody or an antigen-binding fragment thereof with KOFU DNA polymerase.

[0056] According to another aspect of this disclosure, a method for amplifying DNA fragments by polymerase chain reaction is provided, the method comprising the steps of amplification using the antibody and KOFU DNA polymerase described above; or the steps of amplification using the complex described above.

[0057] In some embodiments, the method includes the step of heating the complex to ≥90°C, ≥91°C, ≥92°C, ≥93°C, ≥94°C, ≥95°C, ≥96°C, ≥97°C, ≥98°C, ≥99°C, ≥100°C, ≥101°C, ≥102°C, ≥103°C, ≥104°C, or ≥105°C to activate its activity, and then using the activated complex to amplify DNA fragments.

[0058] According to another aspect of this disclosure, a reaction system is provided, characterized in that the reaction system comprises the antibody or its antigen-binding fragment, or the complex.

[0059] In some embodiments, the reaction system further includes a buffer solution and Mg. 2+ dNTPs, DNA templates, and primers that can bind complementary to the DNA template.

[0060] According to another aspect of this disclosure, the use of the antibody or its antigen-binding fragment, and the complex thereof, in blocking KOFU DNA polymerase or amplifying DNA is provided.

[0061] In some embodiments, the blocking of KOFU DNA polymerase includes blocking its 5'-3' DNA polymerase activity and 3'-5' DNA exonuclease activity.

[0062] In some embodiments, the blocked KOFU DNA polymerase is heated to ≥90°C, ≥91°C, ≥92°C, ≥93°C, ≥94°C, ≥95°C, ≥96°C, ≥97°C, ≥98°C, ≥99°C, ≥100°C, ≥101°C, ≥102°C, ≥103°C, ≥104°C, or ≥105°C, after which the antibody or its antigen-binding fragment denatures and inactivates, thereby restoring the activity of the blocked KOFU DNA polymerase.

[0063] According to another aspect of this disclosure, the use of the antibody or its antigen-binding fragment, the isolated nucleic acid molecule, the expression cassette, the expression vector, or the host cell in the preparation of the complex or the conjugate is provided.

[0064] In some embodiments, the DNA polymerase activity of the complex is blocked before heating and activated by heating. The activity includes 5'-3' DNA polymerase activity and 3'-5' DNA exonuclease activity. The heating temperature is ≥90°C, ≥91°C, ≥92°C, ≥93°C, ≥94°C, ≥95°C, ≥96°C, ≥97°C, ≥98°C, ≥99°C, ≥100°C, ≥101°C, ≥102°C, ≥103°C, ≥104°C, or ≥105°C.

[0065] According to another aspect of this disclosure, the use of the antibody or its antigen-binding fragment, the isolated nucleic acid molecule, the expression cassette, the expression vector, or the host cell or the complex in a preparation kit is provided.

[0066] Beneficial effects:

[0067] The purpose of this disclosure is to provide an anti-polymerase monoclonal antibody and its applications. The provided monoclonal antibody has a high titer and, upon incubation with KOFU, can efficiently and specifically neutralize and block the polymerization and exonuclease activities of KOFU DNA polymerase. After pre-denaturation, the KOFU DNA polymerase recovers its polymerization and exonuclease activities. PCR based on the KOFU DNA polymerase and its monoclonal antibody complex is more convenient to operate, allowing for system preparation at room temperature or low temperature, and yielding more specific, efficient, and accurate results. It can also be applied to sequencing library amplification, resulting in libraries with high specificity and sensitivity. Attached Figure Description

[0068] Figure 1 The image shows an SDS-PAGE analysis of the purified KOFU DNA polymerase protein.

[0069] Figure 2 The results of the mouse serum neutralization KOFU DNA polymerase polymerization activity assay are shown.

[0070] Figure 3 The results of the mouse serum KOFU DNA polymerase exonuclease neutralization activity assay are shown.

[0071] Figure 4 The results of the second subclonal cell culture supernatant assay for KOFU DNA polymerase polymerization activity are shown.

[0072] Figure 5 The results of the second subclonal cell culture supernatant test for KOFU DNA polymerase exonuclease activity are shown.

[0073] Figure 6 The PAGE analysis results of the purified SM06 and SM08 antibodies are shown. Lane 1: Protein Marker. Lane 2: SM06 antibody. Lane 3: SM08 antibody.

[0074] Figure 7 The SDS-PAGE analysis of the purified SM06 and SM08 antibodies is shown. Lane 1: Protein Marker. Lane 2: SM06 antibody. Lane 3: SM08 antibody.

[0075] Figure 8 The diagram shows the effect of monoclonal antibodies on SM06 and SM08 hybridoma cells on neutralizing the polymerization activity of KOFU DNA polymerase.

[0076] Figure 9 The graph shows the recovery effect of KOFU DNA polymerase polymerization activity after hot start.

[0077] Figure 10The diagram shows the effect of SM06 monoclonal antibody on neutralizing the exonuclease activity of KOFU DNA polymerase in hybridoma cells.

[0078] Figure 11 The diagram shows the recovery effect of KOFU DNA polymerase exonuclease activity after hot start.

[0079] Figure 12 The image shows an RT-PCR agarose gel electrophoresis result. Detailed Implementation

[0080] This disclosure uses purified KOFU DNA polymerase as an immunogen to immunize mice, screens for mouse serum with the best blocking effect on KOFU polymerization activity, and selects master clones based on their blocking effect on KOFU polymerase and exonuclease. Subclones are then cultured using the master clones after dilution and screening, yielding a KOFU DNA polymerase monoclonal antibody containing a heavy chain complementarity-determining region (CDR) and a light chain CDR. The heavy chain CDR and light chain CDR regions are shown in Table 1, and the sequences of the heavy chain variable region and light chain variable region are shown in Table 2. The monoclonal antibody can neutralize the 5'-3' polymerization activity and 3'-5' exonuclease activity of KOFU DNA polymerase.

[0081] Table 1. CDR sequences of monoclonal antibodies

[0082]

[0083]

[0084] Table 2. Sequences of heavy chain and light chain variable regions of monoclonal antibodies.

[0085]

[0086] This disclosure also provides a hybridoma cell for producing the monoclonal antibodies described above. After routine domestication, the hybridoma cell can be cultured in suspension to produce large quantities of monoclonal antibodies.

[0087] This disclosure discloses a monoclonal antibody against KOFU DNA polymerase. With 1U of polymerase, only a minimum of 0.8 μg of antibody is required to simultaneously and efficiently neutralize both the polymerization and exonuclease activities of the polymerase. Therefore, PCR based on the KOFU DNA polymerase and this monoclonal antibody complex is more convenient to perform, allowing for system preparation at room temperature or low temperature, and yielding more specific, efficient, and accurate results.

[0088] definition

[0089] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure pertains. For purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0090] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references.

[0091] The term "about" as used herein is as understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is unfamiliar with the use of this term in the context in which it is used, "about" will mean a particular value plus or minus 10%.

[0092] The terms “specific recognition” or “specific binding” used in this article refer to the selective recognition and binding of an antibody to a ligand or receptor, which can be distinguished from unwanted or nonspecific binding.

[0093] As used herein, the term "antibody" includes complete antibodies and any antigen-binding fragments (i.e., "antigen-binding moieties," "antigen-binding polypeptides," or "immunobinding agents"), or their single chains. An antibody is a glycoprotein comprising at least two heavy chains (H) and two light chains (L) linked together by disulfide bonds, or its antigen-binding moieties. Each heavy chain includes a variable heavy chain (VH) region and a constant heavy chain (CH) region. Each light chain includes a variable light chain (VL) region and a constant light chain (CL) region. Each VH and VL region contains three regions with highly variable amino acid composition and sequence, called hypervariable regions or complementarity-determining regions (CDRs): CDR1, CDR2, and CDR3. The amino acid composition and sequence of regions in the VH and VL regions other than the CDR regions are relatively conserved and are called framework regions (FRs). Each VH or VL region has four framework regions, denoted as FR1, FR2, FR3, and FR4, respectively.

[0094] Immunoglobulins exist in five main classes: IgA, IgD, IgE, IgG, and IgM. These main classes can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The constant heavy chain domains corresponding to different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The light chains include different types of κ or λ, but the CH lengths differ between classes of immunoglobulins. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The hinge region, located between CH1 and CH2, is rich in proline and easily extends and bends, thereby altering the distance between antigen-binding sites and facilitating antibody binding to antigenic epitopes located at different positions. The hinge region is easily hydrolyzed by papain, pepsin, etc., producing different hydrolyzed fragments. Papain hydrolyzes Ig near the N-terminus of the two heavy chains linked by disulfide bonds in the hinge region, cleaving Ig into two identical Fab fragments and one Fc fragment. The Fab fragment is an antigen-binding fragment, consisting of a complete light chain and VH and CHI domains of the heavy chain.

[0095] Unless otherwise stated, the terms "antibody active fragment," "antibody fragment," "target-binding fragment," and "antigen-binding fragment" are used interchangeably in the context of this invention and refer to antibody fragments that specifically bind to antigens, such as fragments that retain one or more CDR regions. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; bispecific antibodies; linear antibodies; single-chain antibody molecules, such as single-chain Fv (ScFv); nanobodies and multispecific antibodies formed from antibody fragments.

[0096] As used herein, the term "variable region" or "variable domain" refers to a domain of the antibody heavy or light chain involved in the binding of an antigen-binding molecule to an antigen. The variable domains (VH and VL, respectively) of the heavy and light chains of natural antibodies typically have similar structures, with each domain containing four conserved frame regions (FRs) and three hypervariable regions (HVRs). A single VH or VL domain is sufficient to confer antigen-binding specificity. The term "variable" in this invention refers to the fact that certain segments of the variable domain are generally sequence-differentiated between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not uniformly distributed throughout the variable domain. Instead, it is concentrated in three segments within the variable domains of both the light and heavy chains, called hypervariable regions (HVRs). The more highly conserved portions of the variable domain are called frame regions (FRs). The variable domains of the natural heavy and light chains each contain four FRs, mostly in a β-sheet configuration, linked by three HVRs that form loops and, in some cases, form part of a β-sheet structure. The HVRs in each chain are tightly held together by the FR regions and, together with the HVRs of other chains, contribute to the formation of the antibody's antigen-binding site. The constant domain does not directly participate in antibody-antigen binding but has other effector functions, such as participating in antibody-dependent cytotoxicity.

[0097] As used herein, the terms "monoclonal antibody" or "mAb" refer to antibody molecules / formulations that consist of a single molecule. Monoclonal antibodies exhibit single binding specificity and affinity for a specific epitope. The antibodies of this invention may be derived from various species, including but not limited to mice, rats, rabbits, guinea pigs, and humans.

[0098] As used herein, the term "codon optimization" refers to modifying the codons of a gene or coding region of a nucleic acid molecule to reflect typical codon usage in the host organism without altering the polypeptide encoded by the nucleic acid molecule. Such optimization involves replacing at least one, more than one, or a large number of codons with one or more codons more frequently used in the host organism's genes. Codon optimization can improve the translation of transcript RNA molecules transcribed from coding sequences in expressing host cells or organisms, or improve the sequence of transcription of coding sequences. Codon optimization includes, but is not limited to, processes involving selecting codons for coding sequences to suit the codon preferences of expressing host organisms. Many organisms exhibit a bias or preference for using specific codons to encode specific amino acids for insertion into growing polypeptide chains. Codon preference, or codon bias, varies among organisms in terms of codon usage, is permitted by the degeneracy of the genetic code, and is well documented across many organisms. Codon bias is generally associated with the translation efficiency of messenger RNA (mRNA), which is considered to depend particularly on the characteristics of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The preference for tRNAs in a cell is often a reflection of the most frequently used codons in peptide synthesis. Therefore, custom genes can be expressed in specific host cells based on codon optimization.

[0099] As used herein, the term "hot start" generally refers to a means of limiting the availability of essential reaction components (e.g., polymerases) while the reaction mixture is held at a first temperature (typically a lower temperature) until a second temperature (typically a higher temperature) is reached to allow the essential components to participate in the reaction (e.g., extension, exonucleation, and / or amplification reactions). Hot-start reactions typically involve incubation at a first (e.g., lower) temperature followed by elevation to a second (e.g., higher) temperature that allows the desired reaction to proceed. Activation of a hot-start reaction can be achieved by incubating the reaction mixture at a temperature equal to or higher than the primer hybridization (annealing) temperature. Using a temperature equal to or higher than the primer hybridization temperature ensures primer binding specificity. Hot start can also be achieved by adding a heat-sensitive molecular entity to the DNA polymerase to increase the temperature at which the DNA polymerase initiates polymerization or correction reactions.

[0100] As used herein, the term "blocking" includes the specific binding of an enzyme to a molecule that is intolerant to specific conditions (e.g., high temperature, high pH, ​​high ion concentration, etc.) under normal conditions (e.g., low temperature or room temperature), rendering the enzyme completely or partially inactive. In some embodiments, blocking includes the specific binding of an antibody or antigen-binding fragment thereof described in this disclosure to a DNA polymerase (e.g., KOFU), rendering it completely inactive in polymerization and exonuclease activity under low temperature or room temperature conditions.

[0101] As used herein, the term "activation" includes the separation of a molecule from an enzyme under specific conditions (e.g., high temperature, high pH, ​​high ion concentration, etc.), allowing the enzyme to be released and become active. In some embodiments, activation includes inactivating the antibody or its antigen-binding fragment described herein at high temperature by dissociating it from a DNA polymerase (e.g., KOFU), thereby restoring the latter to polymerase and exonuclease activity.

[0102] The term "polyacrylamide gel electrophoresis (PAGE)" used in this article refers to a commonly used electrophoresis technique that uses polyacrylamide gel as the supporting medium. PAGE includes non-denaturing polyacrylamide gel electrophoresis (Native-PAGE) and denaturing polyacrylamide gel electrophoresis (where the protein denaturing agent is usually SDS, and the nucleic acid denaturing agent is usually urea, formamide, etc.). During Native-PAGE, proteins remain intact and gradually separate according to their molecular weight, shape, and attached charge. SDS-PAGE, on the other hand, separates proteins solely based on the molecular weight differences of their subunits.

[0103] SDS (sodium dodecyl sulfate) is an anionic surfactant that acts as a denaturant and solubilizer. It breaks intramolecular and intermolecular hydrogen bonds, causing molecules to unfold and thus disrupting the secondary and tertiary structures of protein molecules. Strong reducing agents such as β-mercaptoethanol and dithiothreitol (DTT) can break the disulfide bonds between cysteine ​​residues. After adding the reducing agent and SDS to the sample and gel, the molecules are depolymerized into polypeptide chains. The depolymerized amino acid side chains then bind with SDS to form protein-SDS micelles, whose negative charge greatly exceeds the original charge of the protein, thus eliminating the charge and structural differences between different molecules.

[0104] As used herein, the term "separated" refers to a state obtained artificially from the natural state. If a substance or component is naturally present, it may be due to changes in its natural environment, separation of the substance from its natural environment, or both. For example, an unseparated polynucleotide or polypeptide naturally present in a living organism, and a high-purity copy of the same polynucleotide or polypeptide separated from that natural state, is called a separated polynucleotide or polypeptide. The term "separated" does not exclude the presence of artificial or synthetic substances, nor does it exclude other impurities that do not affect the activity of the separated substance. For example, a separated antibody may be substantially free of other cellular material and / or chemicals.

[0105] As used in this article, the term "nucleic acid molecule" refers to any one or more nucleic acid segments present in a polynucleotide, such as DNA or RNA fragments.

[0106] As used herein, the term "vector" refers to a nucleic acid medium in which polynucleotides can be inserted. When a vector allows the expression of a protein encoded by the polynucleotides inserted therein, it is called an expression vector. This vector can be used to express the carried genetic material elements in host cells through transformation, transduction, or transfection. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, bacteriophages, granules, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and multivacuolar papillomaviruses (such as SV40). Vectors may contain multiple elements for controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain an origin of replication. For the vector expressing the antibody, a vector type in which the antibody heavy chain and light chain exist in different vectors or a vector type in which the heavy chain and light chain exist in the same vector can be used.

[0107] The term "host cell" as used herein is used interchangeably and refers to a cell in which exogenous nucleic acids have been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," including primary transformed cells and their derived progeny. The nucleic acids of the progeny may not be completely identical to those of the parent cells and may contain mutations. Host cells include cultured cells, such as cultured mammalian cells, such as CHO cells, 293 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells, yeast cells, insect cells, and plant cells. The host cells disclosed herein also include cells contained within transgenic animals, transgenic plants, or cultured plant or animal tissues.

[0108] The terms “hybridoma” and “hybridoma cell line” used in this article are used interchangeably. When referring to the terms “hybridoma” and “hybridoma cell line,” they also include subclones and progeny cells of the hybridoma.

[0109] As used in this article, the term "kit" refers to any delivery system used to deliver materials, including kits for research and clinical applications.

[0110] To make the objectives, technical solutions, and advantages of this disclosure clearer, the following detailed description is provided in conjunction with embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of this disclosure in any way. The actual scope of protection of this disclosure is set forth in the claims. In the following description, descriptions of well-known structures and techniques are omitted to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications. Unless otherwise specified, the devices, instruments, reagents, and / or kits used in the following embodiments are commercially available or obtained through conventional methods known to those skilled in the art.

[0111] Example

[0112] Example 1: Preparation of KOFU antigen

[0113] Codon optimization: The amino acid sequence of SEQ ID NO: 3 was codon optimized to obtain the KOFU DNA sequence (SEQ ID NO: 4), which was synthesized by Sangon Biotech. The KOFU enzyme it encodes has the amino acid sequence shown in SEQ ID NO: 3. The synthesized DNA sequence was cloned into the expression vector pET28a.

[0114] KOFU Expression: The pET28a expression vector containing the KOFU target gene was transformed into *E. coli* strain BL21(DE3). In a clean bench, a single colony was inoculated into 1 mL of LB(K+) medium and cultured overnight at 37°C with shaking. In the same clean bench, the overnight activated KOFU DNA polymerase / pET28a BL21(DE3) expression strain was inoculated at a rate of 2% into 10 mL of LB(K+) medium and cultured at 37°C with shaking for 4 h until the bacteria reached the logarithmic growth phase. After 4 h, the entire 10 mL of expression strain was transferred to 1 L of LB(K+) medium and cultured at 37°C with shaking. After approximately 3 h of culture, when the OD600 reached about 0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to 1 L of fermentation broth to a final concentration of 0.5 mM, and the mixture was cultured overnight at 25°C with shaking (16-18 h).

[0115] Purification: The bacterial sludge was collected by centrifugation, resuspended in lysis buffer, and sonicated at 350W for 2 / 3 seconds for 30 min. The lysed bacterial solution was then heat-treated at 80℃ for 30 min. The supernatant was collected by centrifugation at 11000 rpm for 20 min at 4℃. The supernatant was then filtered through a 0.45 μm filter and stored on ice. KOFU DNA polymerase was purified using a Ni column (Huiyan Biotechnology, HQ060313001L) and an ion exchange column (Tiandi Renhe, SI035C15) on an AKTA purification system. The eluted protein was finally dialyzed into PBS.

[0116] SDS-PAGE: SDS-PAGE was performed on the dialysis protein. The SDS-PAGE results are as follows: Figure 1 As shown, the purity is >95%, and it can be used as an antigen to immunize mice.

[0117] Example 2: Mouse immunization and serum titer detection

[0118] Using purified KOFU DNA polymerase as an immunogen, five Balb / c mice were immunized using a conventional immunization method, once every two weeks, for a total of three immunizations.

[0119] One week after the third immunization, blood samples were collected, and serum titers were determined using an enzyme-linked immunosorbent assay (ELISA). The ELISA assay used 5 μg / mL KOFU DNA polymerase to coat the plates. Serum was diluted with PBS at dilution factors of 8000 and 16000. 100 μL of diluted serum was added to each well of the ELISA plate for detection. The acceptable titer was determined by a serum diluted 16000 times, with an OD450 value ≥ 1.0 (OD450 - blank), where OD450 - blank refers to the OD450 value of the mouse serum before immunization.

[0120] Table 3 shows the ELISA results of serum titers in immunized mice. It can be seen that mice C and B have the best titers.

[0121] Table 3. Results of ELISA detection of serum titers in immunized mice.

[0122]

[0123] Example 3: Detection of polymerase activity in mouse serum

[0124] 1) Substrate annealing: Primer POL-MB-primer (5'-TCTGGGTCATCTTCTC GCGG-3', SEQ ID NO: 5) and probe POL-MB (5'FAM-CACCCTGAAGTACCATCGAGCAC GGCATATGAGCTGCGCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGACTC GATGGTACTTCAGGGTG-3'Dabcyl, SEQ ID NO: 6) were mixed according to the system shown in Table 4. The final concentration of POL-MB after mixing was 2.5 μM. The sample was heated in a gold bath at 95°C for 10 min, then the instrument was turned off. The sample was allowed to cool naturally to room temperature in the gold bath (generally overnight) to complete the annealing process. The annealed product was used as the test substrate.

[0125] Table 4. Preparation of substrate annealing system for polymer activity assay

[0126] reagents Volume (μL) 10uMPOL-MB 125 100uMPOL-MB primer 25 Tris-HCl (pH 7.4) 350

[0127] 2) Functional test of blocking KOFU polymerization activity in immunized mouse serum: The reaction system was prepared according to Table 5.

[0128] Table 5. Reaction system for blocking KOFU polymerization activity in mouse serum

[0129]

[0130]

[0131] The mouse serum and polymerase were premixed and incubated at 37°C for 30 minutes.

[0132] Reaction procedure: 37℃, 10s; 37℃, 1min (60 cycles, with fluorescence collection); 4℃, 1min 20s.

[0133] like Figure 2 The changes in fluorescence curves during the reaction process show that the serum of the five immunized mice showed the best blocking effect on KOFU polymerization activity in mice B and E, followed by mouse C.

[0134] Example 4: Detection of mouse serum exonuclease activity

[0135] 1) Substrate annealing: Primer EXO-F (ATCAGCAGGCCACACGTTAAACT GT-3`BHQ2, SEQ ID NO:7) and primer EXO-R (5`ROX-TGTCTTTAACGTGTGGCCTGCTGA T, SEQ ID NO:8) were mixed in a 1:1 ratio according to the system shown in Table 6. The final primer concentration after mixing was 2.5 μM. The sample was heated in a gold bath at 95°C for 10 min, and then the instrument was turned off. The sample was allowed to cool naturally to room temperature in the gold bath (generally overnight) to complete the annealing. The annealed product was used as the test substrate.

[0136] Table 6. Configuration of annealing system for substrates used in exotropy activity assay

[0137] reagents Volume (μL) 10uMEXO-F 125 10uMEXO-R 125 Tris-HCl (pH 7.4) 250

[0138] 2) Functional test of blocking KOFU exonuclease activity in immunized mouse serum: Prepare the reaction system according to Table 7.

[0139] Table 7. Response system for blocking KOFU exonuclease activity in mouse serum

[0140]

[0141] The mouse serum and polymerase were premixed and incubated at 37°C for 30 minutes.

[0142] Reaction procedure: 37℃, 10s; 37℃, 1min (60 cycles, with fluorescence collection); 4℃, 1min 20s.

[0143] Based on the changes in fluorescence curves during the reaction, the serum of the five immunized mice showed the best blocking effect on KOFU polymerization activity in mice B and E, followed by mouse C. Figure 3 ).

[0144] Based on Examples 2 to 4, the results of serum titer and functional testing were comprehensively analyzed, and mice C and E were selected for the next fusion experiment.

[0145] Example 5: Cell fusion and master clone screening

[0146] 1) Preparation before cell fusion:

[0147] Splenic lymphocyte preparation: Mice were euthanized by blood collection from their eyeballs. Spleens containing mouse B lymphocytes were harvested from mice C and E. Surface fat was removed, and the cells were homogenized and passed through a cell sieve. The cells were washed with 1640 incomplete culture medium (thermo) and resuspended, then counted. Blank Balb / c mice were used to prepare feeder cells.

[0148] SP20 myeloma cell preparation: Frozen mouse myeloma cells SP2 / 0 require 2 weeks of growth after thawing to reach a state suitable for fusion. Before fusion, cells are cultured to the logarithmic growth phase, resuspended in 1640 incomplete medium, and counted.

[0149] 2) Cell fusion: The above-mentioned mouse myeloma cells SP2 / 0 and spleen cells were mixed at a cell ratio of 1:1 and fused using electrofusion. All cells were seeded into 96-well plates for liquid culture, 100 μL / well (feeder cells were pre-seedled), with 30 plates per mouse.

[0150] 3) ELISA assay for antibody titer in cell culture supernatant: Coat ELISA plates with 1 μg / ml antigen, add 100 μL of hybridoma cell culture supernatant to each well, and measure the antibody titer for the first 125 ODs. 450 - Positive well supernatant with a blank value ≥1.0 or ≈1.0 requires functional testing (Table 8).

[0151] Table 8. ELISA results of master clone culture supernatant requiring functional testing

[0152]

[0153]

[0154] 4) The supernatant of the culture of the first 125 clones screened by ELISA was used to screen for KOFU polymerization activity blocking experiment, and the reaction system was prepared according to Table 9.

[0155] Table 9. Cell supernatant blocking KOFU polymerization activity reaction system

[0156]

[0157] The cell culture supernatant and polymerase were premixed and incubated at 37°C for 30 min. Two or three replicates were performed.

[0158] Reaction procedure: 37℃, 10s; 37℃, 1min (60 cycles, with fluorescence collection); 4℃, 1min 20s.

[0159] The supernatant of the first 125 globulin clones screened by ELISA was subjected to KOFU exonuclease activity blocking assay, and the reaction system was prepared according to Table 10.

[0160] Table 10 Cell supernatant blocking KOFU exonuclease activity reaction system

[0161]

[0162] The cell culture supernatant and polymerase were mixed beforehand and incubated at 37°C for 30 minutes. Two or three replicates were performed.

[0163] Reaction procedure: 37℃, 10s; 37℃, 30s (100 cycles, with fluorescence collection); 4℃, 1min, 20s.

[0164] Based on the results of the blocking experiment, the functional detection results of 30 master clones, namely 1-E7, 10-C3, 11-F1, 13-H6, 13-C10, 13-H11, 14-B2, 14-C7, 15-D3, 16-A3, 16-C5, 17-A2, 18-C2, 18-F6, 19-H7, 1-A4, 1-C1, 1-E6, 20-B8, 21-F1, 21-H8, 22-A2, 2-E3, 2-E7, 30-A3, 3-B11, 6-A9, 7-A2, 8-F1, and 8-H6, were superior, and the next step of the subcloning experiment was carried out.

[0165] Example 6: Subcloning of hybridoma cells

[0166] 1) First subcloning

[0167] Using a limiting dilution method, 30 selected positive cell lines were diluted to an average of 0.8 cells per well and aliquoted into 96-well plates containing feeder cells. Each positive cell line was then aliquoted into 48 wells. After approximately 5 days of culture, the wells containing cells were subjected to supernatant antibody ELISA assays according to step 3) of Example 5. A portion of the supernatant from the first subclonal culture was picked for KOFU polymerization activity and exonuclease activity blocking function tests (specific procedures are the same as in Example 5). The main selection criteria were: single clones, and ELISA OD... 450 - Blank ≥ 1.0, a maximum of 5 subclones can be selected from each master clone. Table 11 shows the ELISA results of the supernatant of the first clone (subclones) selected according to the selection principle for functional testing.

[0168] Table 11 Results of ELISA tests conducted by Yiya Shangqing that require blocking function testing

[0169]

[0170]

[0171] The supernatants of all cell lines in the table above were subjected to KOFU polymerization activity and exonuclease activity blocking function tests (test method refers to Example 5). According to the test results, A10, G9, H10, F1, D1, H12, G7, H10, and A6 (a maximum of 2 subclones were selected from each master clone) all had good blocking effects on KOFU polymerization and exonuclease activity. These 9 cell lines were then subjected to a second subcloning (second subcloning).

[0172] 2) Second subcloning:

[0173] Nine selected subclonal cells were subjected to a second round of limiting dilution to obtain stable monoclonals. The diluted monoclonals were then subjected to ELISA testing according to step 3) of Example 5. The ELISA results are shown in Table 12. The primers, reagents, and reaction procedures used in step 4) of Example 5 were followed to verify the neutralizing KOFU polymerization activity and exonuclease activity in the supernatant of the second subclonal cell culture. The results are shown in Table 12. Figure 4 and Figure 5 .

[0174] Table 12 Results of ELISA assay in the supernatant from the second subcloning culture.

[0175]

[0176] Figure 4 and Figure 5 The comparison results showed that SM06 and SM08 in the second subcloning had better functional test results, and SM06 and SM08 were selected for the next experiment.

[0177] Example 7: Culture and antibody production of hybridoma cells SM06 and SM08

[0178] Although the culture supernatants of SM06 and SM08 in Example 6 performed well in functional verification, the composition of the cell culture supernatant is relatively complex. Other components in the cell supernatant may affect the interaction results between the monoclonal antibody and KOFU polymerase. Therefore, it is necessary to purify the antibody in the supernatant for confirmation.

[0179] 1) Hybridoma cell culture: Cultured according to conventional semi-adherent cell culture.

[0180] Cryopreservation medium: 1604 basal medium + 50% FBS + 10% DMSO. Cryopreserved cell density: 1 × 10⁻⁶ cells / year. 6 per mL.

[0181] Hybridoma culture medium: 1604 basal medium + 10% FBS.

[0182] Cell passage: Normal passage can usually be resumed after 2-3 passages. Hybridoma cells are semi-adherent cells; when microscopic observation shows that the cells cover more than 80% of the bottom area of ​​the flask, they are ready for passage. Gently tap the bottom of the flask; after observing that most cells are in suspension under the microscope, mix the cells by pipetting and then proceed with passage culture (generally 1:2 or 1:3 passage). After passage, the cells should ideally cover about 20%-30% of the bottom area of ​​the flask. Passage can usually be arranged after 2-3 days.

[0183] 2) Antibody purification:

[0184] When producing antibodies, cells need to be cultured for 3-5 days, and cells produced after antibody production cannot be reused.

[0185] Collect the culture supernatant and centrifuge at 3000-5000g for 20-30 min. Filter the supernatant through a 0.45μM filter. Purify the antibody using an AKTA purification system with a Protein A column. Immediately neutralize the eluted protein with 0.1x 1M Tris-HCl (pH 8.0). Finally, concentrate the antibody using a 30kD concentrator and replace the medium with PBS. Perform non-denaturing polyacrylamide gel electrophoresis (Native-PAGE) and SDS-PAGE on the final antibody.

[0186] Figure 6 and Figure 7 The images show the Native-PAGE and SDS-PAGE analyses of the purified hybridoma cell monoclonal antibodies SM06 and SM08, respectively. As can be seen, the overall size, heavy chain size, and light chain size of the SM06 and SM08 antibodies are as expected, and the purity of both exceeds 90%.

[0187] Example 8: Functional Validation of SM06 and SM08 Antibodies

[0188] In addition to testing the blocking effect of the antibody on the polymerization and exonucleation of KOFU DNA polymerase, it is also necessary to test the hot-start effect of the antibody after heating at 98°C for 45 seconds.

[0189] 1) Functional test of antibody blocking KOFU polymerization activity: The reaction system was prepared according to Table 13, and the blocking effect of different antibody input amounts (0.4μg~12μg) and 1U KOFU incubation was tested.

[0190] Table 13 Antibody blocking KOFU polymerization activity reaction system

[0191]

[0192] Where "χ" represents the volume calculated based on antibody concentration and dosage; the antibody and polymerase are pre-mixed and incubated at 37°C for 30 minutes. Two or three replicates are recommended.

[0193] Reaction procedure: 37℃, 10s; 37℃, 1min (40 cycles, with fluorescence collected; results as shown below). Figure 8 (As shown); 98℃, 45s; 37℃, 1min (40 cycles, and fluorescence was collected, results are shown). Figure 9 (As shown), 1 min 20 s.

[0194] Figure 8 The results showed that SM06 and SM08 monoclonal antibodies neutralized the polymerization activity of KOFU DNA polymerase, respectively. It can be seen that 0.4 μg of SM06 antibody has a better blocking effect on polymerization activity than 12 μg of SM08 antibody, and 0.8 μg of SM06 antibody can achieve a 95% blocking effect on polymerization activity. Figure 9 The experimental results showed that, after a hot start at 98℃ for 45 seconds, the KOFU DNA polymerase polymerization activity was well restored. Figure 9 ).

[0195] 2) Functional test of SM06 antibody blocking KOFU exonuclease activity: Prepare the reaction system according to Table 14.

[0196] Table 14 Antibody blocking KOFU exonuclease activity reaction system

[0197]

[0198] Where "χ" represents the volume calculated based on antibody concentration and dosage; the antibody and polymerase are pre-mixed and incubated at 37°C for 30 minutes. Two or three replicates are recommended.

[0199] Reaction procedure: 37℃, 10s; 37℃, 30s (80 cycles, with fluorescence collected; results as shown below). Figure 10(As shown); 98℃, 45s; 37℃, 30s (80 cycles, and fluorescence was collected, results are shown). Figure 11 (As shown), 1 min 20 s.

[0200] Figure 10 The image shows the effect of SM06 monoclonal antibody on neutralizing the exonuclease activity of KOFU DNA polymerase in hybridoma cells. Similarly, 0.8 μg of SM06 antibody can achieve a 96% blocking effect on exonuclease activity, and after a 45s heat start at 98℃, the exonuclease activity of KOFU DNA polymerase is well restored. Figure 11 ).

[0201] In summary, SM06 performed best in functional validation and was the final selected hybridoma cell.

[0202] Example 9: Antibody sequencing of hybridoma cells SM06

[0203] Subtypes of the heavy and light chains of the SM06 monoclonal antibody in hybridoma cells were identified, and the heavy and light chains were sequenced.

[0204] Reverse transcription and PCR primers for the heavy chains were designed for the constant regions of the heavy chains of the four antibody subtypes (IgG1, IgG2a, IgG2b, IgG3) in mice, and reverse transcription and PCR primers for the light chains were designed for the constant regions of the two light chain types (kappa, lambda) in mice, as shown in Table 15.

[0205] Table 15 Primers used in this embodiment

[0206]

[0207] In Table 15, " / rG / " represents guanine nucleotides; / rG / / rG / / rG / represents an RNA sequence consisting of three guanine nucleotides.

[0208] Table 15 lists the references for TSO RT and ISPCR: Meyer L, et al. A simplified workflow for monoclonal antibody sequencing. PLoS One. 2019 Jun 24; 14(6)).

[0209] Culture SM06 cells and collect 1×10⁶ cells. 6 RNA was extracted from live cells using TRizol reagent (Thermo Fisher, 15596018CN).

[0210] Reverse transcription:

[0211] Prepare the premixed reaction system shown in Table 16:

[0212] Table 16. Premixed Reaction System

[0213] Components quantity Total RNA 200ng Reverse RT primers (10 μM) 2μL 10mMdNTP 1μL <![CDATA[Nuclease-freeH2O]]> Make up to 10 μL

[0214] 65℃, 5 minutes; immediately place on ice;

[0215] After the temperature stabilizes, immediately separate the components and prepare the system shown in Table 17:

[0216] Table 17. Reverse Transcription Reaction System

[0217] Components Volume (μL) 5×RTBuffer 4 Template-switcholigo (100μM) 0.6 MaximaHMinusReverseTranscriptase(Thermofisher) 0.5 RNaseInhibitor(YEASEN,10603ES10) 0.5 <![CDATA[Nuclease-freeH2O]]> 4.4 Previous denaturation product 10 Total volume 20

[0218] 50℃, 30 min; 85℃, 5 min; 4℃, hold.

[0219] PCR reaction system is shown in Table 18:

[0220] Table 18. PCR Reaction System

[0221] Element Volume (μL) 2×KOFUmix 25 RT product cDNA 3 10μMISPCR 2.5 10μM reverse primer 2.5 <![CDATA[Nuclease-freeH2O]]> 17 Total volume 50

[0222] The reaction procedure is shown in Table 19:

[0223] Table 19. Reaction Procedure

[0224]

[0225]

[0226] The PCR products were recovered by 1% agarose gel electrophoresis using pMD. TM TA cloning was performed using the 18-T Vector Cloning Kit (TAKARA), and 5 single colonies from each of the heavy and light strands were selected for bacterial culture and sequencing.

[0227] Once the sequence is confirmed (at least 3 colonies are identical), sequence alignment is performed using IgBLAST and / or IMGT / V-QUEST to delineate the backbone region (FR) and CDR of the antibody gene.

[0228] The obtained sequence was codon-optimized using the 293 expression system and sent to a biotechnology company for gene synthesis (pCDNA3.4 expression plasmid delivery). It was then expressed using the Expi293F expression system, purified with Protein A, and finally the antibody was functionally validated to determine the effectiveness of the test sequence.

[0229] Subtype identification results as follows Figure 12 The RT-PCR agarose gel electrophoresis image shown indicates that the SM06 monoclonal antibody is IgG1, and the light chain is the κ chain.

[0230] Sequencing results showed that the nucleic acid sequences of the variable regions of the heavy and light chains are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively, and the amino acid sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0231] The technical solutions disclosed herein are not limited to the specific embodiments described above. Any technical modifications made based on the technical solutions disclosed herein shall fall within the protection scope of this disclosure.

Claims

1. An antibody against KOFU DNA polymerase or an antigen-binding fragment thereof, said antibody or antigen-binding fragment comprising: HCDR1, HCDR2 and HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO: 1, and LCDR1, LCDR2 and LCDR3 contained in the light chain variable region as shown in SEQ ID NO: 2; The HCDR1-3 and the LCDR1-3 are defined by the same system: the system is selected from any one of the IMGT numbering system, Kabat numbering system, Chothia numbering system, and Contact numbering system.

2. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody or its antigen-binding fragment comprises: (1) The following heavy chain variable regions and light chain variable regions, wherein HCDR1-3 and LCDR1-3 are defined according to the IMGT numbering system: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO: 11, HCDR2 with sequence SEQ ID NO: 12, and HCDR3 with sequence SEQ ID NO: 13; and light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO: 14, LCDR2 with sequence AAS, and LCDR3 with sequence SEQ ID NO: 15; or (2) The following heavy chain variable regions and light chain variable regions, wherein HCDR1-3 and LCDR1-3 are defined according to the Kabat numbering system: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO: 16, HCDR2 with sequence SEQ ID NO: 17, and HCDR3 with sequence SEQ ID NO: 18; and light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO: 19, LCDR2 with sequence SEQ ID NO: 20, and LCDR3 with sequence SEQ ID NO: 15; or (3) The following heavy chain variable regions and light chain variable regions, wherein HCDR1-3 and LCDR1-3 are defined according to the Chothia numbering system: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO: 21, HCDR2 with sequence SEQ ID NO: 22, and HCDR3 with sequence SEQ ID NO: 18; and light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO: 19, LCDR2 with sequence SEQ ID NO: 20, and LCDR3 with sequence SEQ ID NO: 15; or (4) The following heavy chain variable regions and light chain variable regions, wherein HCDR1-3 and LCDR1-3 are defined according to the Contact numbering system: heavy chain variable regions containing the following 3 HCDRs: HCDR1 with sequence SEQ ID NO: 23, HCDR2 with sequence SEQ ID NO: 24, and HCDR3 with sequence SEQ ID NO: 25; and light chain variable regions containing the following 3 LCDRs: LCDR1 with sequence SEQ ID NO: 26, LCDR2 with sequence SEQ ID NO: 27, and LCDR3 with sequence SEQ ID NO:

28.

3. The antibody or its antigen-binding fragment according to claim 1 or 2, characterized in that, The antibody or its antigen-binding fragment comprises: The heavy chain variable region having an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO: 1; and The light chain variable region has an amino acid sequence having one or more amino acid substitutions, deletions, or additions compared to the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO:

2.

4. The antibody or its antigen-binding fragment according to claim 3, characterized in that, The antibody or its antigen-binding fragment comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having the amino acid sequence shown in SEQ ID NO:

2.

5. The antibody or its antigen-binding fragment according to claim 4, characterized in that, The antibody or its antigen-binding fragment includes antibody Fab fragment, Fab' fragment, F(ab')2 fragment, Fv fragment or scFv fragment.

6. The antibody or its antigen-binding fragment according to claim 4, characterized in that, The antibody or its antigen-binding fragment is derived from IgG, IgA, IgM, IgD or IgE.

7. The antibody or its antigen-binding fragment according to claim 4, characterized in that, In the antibody or its antigen-binding fragment, the heavy chain is derived from any one of IgG1, IgG2a, IgG2b, IgG3 or IgG4, and / or the light chain is derived from any one of the kappa light chain and the lambda light chain.

8. An isolated nucleic acid molecule encoding an antibody or an antigen-binding fragment thereof as described in any one of claims 1 to 7.

9. An expression cassette comprising the isolated nucleic acid molecule of claim 8.

10. An expression vector comprising the isolated nucleic acid molecule of claim 8.

11. A host cell comprising the isolated nucleic acid molecule as claimed in claim 8, the expression cassette as claimed in claim 9, or the expression vector as claimed in claim 10; The host cell is a eukaryotic or prokaryotic cell; The eukaryotic cells are yeast, insect, or mammalian cells.

12. The host cell according to claim 11, characterized in that, The prokaryotic cells are bacteria.

13. The host cell according to claim 12, characterized in that, The bacteria in question is Escherichia coli.

14. A complex comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 7 and KOFU DNA polymerase, wherein the antibody or antigen-binding fragment thereof and KOFU DNA polymerase are specifically bound.

15. The complex according to claim 14, characterized in that, The KOFU DNA polymerase has the amino acid sequence shown in SEQ ID NO:

3.

16. A kit comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 7, and KOFU DNA polymerase.

17. A method for amplifying DNA, the method comprising: The step of amplification using the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 7 and KOFU DNA polymerase; or The step of amplification using the complex according to any one of claims 14-15.

18. A conjugate comprising: an antibody or an antigen-binding fragment thereof as described in any one of claims 1 to 7; and a conjugation portion; The coupling portion is selected from detectable markers.

19. The use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 7 in blocking KOFU DNA polymerase or amplifying DNA, wherein the use is for purposes other than disease diagnosis and / or treatment.

Images