Trichoderma peucedanum strain and application thereof
By screening and identifying Nordic Trichoderma strains V1 and V4, the problem of preventing and treating crop pythyroid and Phytophthyroid in the prior art was solved, and effective antagonism of pathogens and plant proliferation effects were achieved.
Patent Information
- Application Number
- CN202411738888.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-05-13
AI Technical Summary
The prior art is difficult to effectively prevent and control pythyroid disease and Phytophthora in crops, and the use of chemical pesticides leads to soil and water pollution, threatening the safety of humans and animals.
The Nordic Trichoderma strains V1 and V4, which have the strongest antagonism effect on plant pathogen oomycetes, were screened out, and their genetic background was determined through molecular biological identification, and it was found that they had strong cellulase and protease secretion ability through systematic enzyme activity observation.
Nordic Trichoderma strain V1 can significantly remove Phytophthora capsia and Pythium citrus and fruits, and show significant prevention and treatment effects on chili blight and cucumber seedlings in indoor pot experiments, and also has a proliferation effect on chili seedlings.
Smart Images
Figure CN119979334A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of microbial control, and specifically relates to a Nordic Trichoderma strain and application thereof. Background Art
[0002] Oomycetes are fungi-like microorganisms with morphological characteristics similar to filamentous fungi. They can cause important diseases such as Pythium, Phytophthora, Downy Mildew and White Rust. Oomycetes can infect the roots, rhizomes, leaves, flowers and fruits of crops, causing symptoms such as root rot, rhizome rot, fruit rot, ulcers and spots, which cause considerable harm to crops. They spread quickly and can cause a reduction or even complete loss of yields of many crops. Among them, Phytophthora and Pythium are important hidden dangers that seriously affect the yield of beans, cereals and vegetables. Due to the wide range of hosts of Pythium and Phytophthora, there are differences in the occurrence and epidemic patterns of Pythium and Phytophthora diseases in different ecological environments, which makes it very difficult to prevent and control Pythium and Phytophthora diseases in crops. The use of chemical agents is currently the main means of disease prevention and control in crop production, but the misuse and abuse of highly toxic chemical fungicides causes soil and water pollution, which threatens the safety of humans and livestock. Therefore, it is necessary to develop some high-efficiency, low-toxicity, low-residue and highly selective fungicides to control the occurrence and harm of Pythium and Phytophthora diseases. Biological control is a method of killing or inhibiting agricultural pests by using living organisms or their metabolites. Compared with chemical pesticides, biological pesticides have the advantages of high efficiency, strong selectivity, low residue, and low resistance, which conforms to the current concepts of environmental protection and green development.
[0003] Among biological control agents, Trichoderma is one of the current research hotspots. It has the ability to promote plant growth, improve plant tolerance to abiotic stresses, and control crop diseases through different direct mechanisms (fungal parasitism and production of cell wall lytic enzymes, antibiotic effects, competition for space or nutrients) or indirect mechanisms (inducing plant defense). Therefore, new Trichoderma strains with excellent functions are still to be discovered. Summary of the invention
[0004] In order to solve the above technical problems, the present invention provides a Nordic Trichoderma strain and its application. The present invention screens out strains V1 and V4 with the strongest antagonistic effects on several plant pathogenic oomycetes, and finally determines their genetic background through molecular biological identification. Through systematic enzyme activity observation, it was found that the V1 strain has a strong cellulase and protease secretion ability. Thereafter, through antagonism experiments, it was verified that the V1 strain can effectively remove pepper blight and citrus pythium cells. The biocontrol effect of the Nordic Trichoderma strain on pepper blight and cucumber seedling damping-off disease was studied through indoor pot experiments, and its growth-promoting effect on pepper seedlings was explored. The research results show that both V1 and V4 treatments have very significant prevention and control and growth-promoting effects, among which the V1 effect is more significant.
[0005] The first aspect of the present invention provides a Trichoderma nordicum strain V1, whose deposit number is CGMCC No:41478.
[0006] The Nordic Trichoderma strain V1 (Trichoderma nordicum V1) of the present invention was deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration on July 26, 2024, with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No: 41478. The culture name is Nordic Trichoderma nordicum, and the classification name is Trichoderma nordicum.
[0007] The second aspect of the present invention provides a Nordic Trichoderma hyphae, wherein the Nordic Trichoderma hyphae is obtained by culturing the Nordic Trichoderma strain as described in the first aspect of the present invention.
[0008] The third aspect of the present invention provides a Nordic Trichoderma fermentation broth, which is obtained by culturing the Nordic Trichoderma strain as described in the first aspect of the present invention or by culturing the Nordic Trichoderma mycelium as described in the second aspect of the present invention.
[0009] The fermentation liquid can be obtained by liquid fermentation of the Nordic Trichoderma, and the fermentation liquid contains fermentation products of Trichoderma spores.
[0010] In a preferred embodiment, before liquid fermentation, the Nordic Trichoderma can be firstly subjected to solid fermentation to obtain a mass covered with Trichoderma, and then the fermentation product of Trichoderma spores can be separated from the mass.
[0011] The fourth aspect of the present invention provides the use of the Nordic Trichoderma strain as described in the first aspect of the present invention, the Nordic Trichoderma hyphae as described in the second aspect of the present invention and / or the Nordic Trichoderma fermentation broth as described in the third aspect of the present invention in biological control.
[0012] In a preferred embodiment, the biological control is to inhibit the growth of pathogenic bacteria.
[0013] In a preferred embodiment, in a specific embodiment, the pathogens include one or more of Phytophthora capsici (P. capsici LT263), Pythium aphanidermatum (P. aphanidermatum HBT1), Pythium sojae (P. sojae), Pythium ultimum (P. ultimum), and Pythium myriotylum (P. myriotylum).
[0014] In a preferred embodiment, the soybean phytophthora is soybean phytophthora (P. sojae P6497).
[0015] In a preferred embodiment, the Pythium ultimum is Pythium ultimum G001. In a preferred embodiment, the Pythium myriotylum is Pythium myriotylum SWQ7 (CGMCC NO. 21459).
[0016] In a preferred embodiment, the pathogenic strains to be tested are deposited in the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences.
[0017] In a preferred embodiment, the biological control is the treatment of plant diseases.
[0018] In a preferred embodiment, the plant diseases include one or more of pepper blight, aphaniderma and cucumber seedling damping-off.
[0019] The present invention also provides a method for culturing the mycelium of Trichoderma spp. as described in the second aspect of the present invention, comprising the following steps: culturing the Trichoderma spp. strain on a fermentation medium.
[0020] The present invention also provides a method for culturing the Nordic Trichoderma fermentation broth as described in the third aspect of the present invention, comprising the following steps: inoculating the Nordic Trichoderma hyphae into a fermentation medium for fermentation to obtain the broth.
[0021] The present invention also provides use of the Nordic Trichoderma strain as described in the first aspect of the present invention in preparing Nordic Trichoderma mycelium or Nordic Trichoderma fermentation broth.
[0022] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.
[0023] The reagents and raw materials used in the present invention are commercially available.
[0024] The positive and progressive effects of the present invention are:
[0025] This laboratory isolated ten strains of Trichoderma from the magnolia stumps in Xianlin, Nanjing, Jiangsu. Through extensive confrontation culture, the inhibitory effects of the strains on several plant pathogenic oomycetes were determined, and the strains V1 and V4 with the strongest antagonistic effects on several plant pathogenic oomycetes were screened out. Finally, their genetic background was determined through molecular biological identification. Systematic enzyme activity observations showed that the V1 strain had a strong ability to secrete cellulase and protease. Subsequently, through antagonism experiments, it was verified that the V1 strain could effectively remove pepper phytophthora and citrus ophytophthora cells. The biocontrol effect of Nordic Trichoderma strains on pepper blight and cucumber seedling damping-off disease was studied through indoor pot experiments, and its growth-promoting effect on pepper seedlings was explored. The results showed that both V1 and V4 treatments had very significant control and growth-promoting effects, among which the V1 effect was more significant.
[0026] Biomaterial Deposit Information
[0027] The Nordic Trichoderma strain V1 (Trichoderma nordicum V1) of the present invention was deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration on July 26, 2024, with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No: 41478. The culture name is Nordic Trichoderma nordicum, and the classification name is Trichoderma nordicum. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is the antagonism heat map between the tested biocontrol Trichoderma and pathogenic oomycetes.
[0029] Figure 2 This is a plate change diagram of the antagonistic effect of Nordic Trichoderma V1 on Phytophthora capsici LT263 and Pythium aphanidermatum HBT1. After the Trichoderma came into contact with the oomycete colony, photos were taken every 24 hours to record the antagonistic situation, and the Trichoderma antagonistic circle was marked, as shown by the dotted lines in the figure.
[0030] Figure 3 The antagonistic circle of Trichoderma V1 and Pythium HBT1 was cultured at 33℃ for 96h. The mycelium of the antagonistic circle (middle) and the single colony (right) of Pythium was observed. On the fifth day, three technical replicate plates were randomly selected and the first (1 st )、Third (3 rd ) and the fifth day (5 th ) was inoculated with a 5 mm agar block at the position of the Trichoderma antagonistic zone on a 10% V8 plate for culture.
[0031] Figure 4 This is a diagram of cellulase activity observation of Nordic Trichoderma strain V1 and dark green Trichoderma reference strain, where the edge of the Trichoderma colony on the enzyme activity observation plate is indicated by a black dotted line.
[0032] Figure 5 This is an observation diagram of the protease activity of Nordic Trichoderma strain V1 and dark green Trichoderma reference strain, in which the edge of the Trichoderma colony on the enzyme activity observation plate is indicated by a black dotted line.
[0033] Figure 6 These are pictures of the effectiveness of Nordic derma V1 and V4 in preventing pepper blight in potted plants.
[0034] Figure 7 The potted plant protection effect of Nordic Trichoderma V1 and V4 against pepper blight.
[0035] Figure 8 The growth-promoting effect of Nordic Trichoderma V1 and V4 on pepper.
[0036] Fig. 9 The plate control effect of Nordic Trichoderma V1 and V4 on Pythium aphanidermatum.
[0037] Fig.10 The plate control effect of Nordic Trichoderma V1 and V4 on Pythium aphanidermatum. DETAILED DESCRIPTION
[0038] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are selected according to conventional methods and conditions, or according to the product specifications. The experimental materials and experimental methods of the following examples are as follows:
[0039] (1) Test strains
[0040] Ten Trichoderma genus strains were isolated from Magnolia tree stumps in Xianlin, Nanjing, Jiangsu Province, namely Trichoderma nordicum V1, Trichoderma nordicum V2, Trichoderma nordicum V4, Trichoderma nordicum V5, Trichoderma nordicum V6, Trichoderma nordicum V7, Trichoderma nordicum V13, Trichoderma nordicum T1, Trichoderma nordicum T2 and Trichoderma nordicum T3, and the Nordic Trichoderma strain (Trichoderma nordicumV1, deposit number CGMCC 41478), Trichoderma virens reference strain (T. virens Gv29.8, TUCIM 3530), Trichoderma atroviride reference strain (T. atroviride IMI206040, TUCIM 1680) and Trichoderma asperellum reference strain (T. asperellum CBS433.97) of the present invention were screened out;
[0041] The tested Trichoderma strains are publicly available from the following culture collections: TUCIM: Culture Collection of Industrial Microorganisms of the Technical University of Vienna; CBS: Institute for Biodiversity of Fungi of West Frederick.
[0042] Test pathogens: Phytophthora capsici LT263, Pythium aphanidermatum HBT1, Pythium sojae P6497, Pythium ultimum G001, Pythium myriotylum SWQ7 (CGMCC NO.21459).
[0043] The tested pathogenic strains were deposited from the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences.
[0044] (2) Test culture medium
[0045] 10% V8 medium: 340mL V8 vegetable juice, 3.4g calcium carbonate, centrifuge at 5000×g for 10min, discard the large particles in the vegetable juice at the bottom, mix the supernatant with distilled water at a volume ratio of 1:9, and use it as 10% V8 liquid medium. Add 1.5% w / v agar powder to the liquid medium to use as 10% V8 solid medium. Sterilize the medium at 121℃ for 20min. Pour 12.5mL of melted solid medium into a plastic culture dish with a diameter of 9cm, blow it in the dish after cooling until there are no visible droplets, and use it as a 10% V8 plate.
[0046] (3) Test seeds
[0047] Pepper seeds (Sujiao No. 5) and cucumber seeds (Lufeng) were purchased from Mingda Seed Store, No. 50, Zhongling Street, Xuanwu District, Nanjing, Jiangsu Province.
[0048] (4) Trichoderma spore fermentation culture system
[0049] The liquid fermentation medium consisted of 3.38 g lignite, 1.88 g corn steep liquor, 1.5 g glucose, and 0.38 g yeast extract. The culture conditions were as follows: 3 mL of spore solution (8 × 10 8 spores), liquid volume 75mL / 250mL, rotation speed 180r / min, initial pH 5.0, temperature 28°C, culture time 7 days, and collect spores with sterile water.
[0050] The solid fermentation medium consists of: 17.1 g wheat bran, 11.4 g rice husk, 0.5 g ammonium sulfate, 14 g sucrose, 0.5 g potassium dihydrogen phosphate, 0.57 g soybean powder, and 43 mL dd H2O. The culture conditions are: inoculation concentration of 5.2 × 10 5 spores, the seed liquid was 6 days old, cultured at 24°C under light, stirred 60 hours after inoculation, then allowed to ferment for 8 days, and the spores were collected with sterile water.
[0051] (5) Inoculum of plant pathogenic oomycetes
[0052] Capsici Phytophthora inoculum: After culturing Capsici Phytophthora on 10% V8 plates for 5 days, scoop out bacterial cakes with a 7 mm borer, take 6 pieces and inoculate them into 120 mL 10% V8 liquid culture medium, shake and culture at 150 r / min and 25° C. for 7 days, and break the mycelium into a bacterial suspension using a crushing mixer.
[0053] Inoculum of Pythium aphanidermatum: After Pythium aphanidermatum was cultured on 10% V8 plates for 5 days, the bacterial cake was dug out with a borer with a hole diameter of 7 mm, and then the bacterial disk was placed at the base of the plant.
[0054] (6) Culture medium for enzyme activity observation
[0055] Cellulase activity observation medium: After preparing the liquid fungal carbon source-free basal medium, add AZCL-HE-cellulose powder (the powder is degraded by cellulase and releases blue dye, which is used as a cellulase detection substrate here), and add two cellulase inducers, namely cellulose crystal powder or oomycete mycelium powder.
[0056] Oomycete mycelium powder: Pythium was inoculated into 10% V8 liquid culture medium, cultured at 25°C, and then the mycelium was collected and washed. After freeze-drying, the mycelium was ground into powder to obtain the oomycete mycelium powder.
[0057] The culture medium was sterilized at 121°C for 20 min. 5 mL of the melted solid culture medium was poured into a plastic culture dish with a diameter of 6 cm, and after cooling, it was blown until no droplets were visible in the dish, and then covered with a cellophane film and set aside as a cellulase activity observation plate.
[0058] Protease activity observation medium: Prepare 2% w / v water agar medium and sterilize at 121℃ for 20min. When the water agar medium cools to 60℃, mix it with 2% w / v skim milk powder solution in a 1:1 volume ratio to obtain 1% w / v skim milk powder agar medium, in which skim milk will lose its milky white color after protease degradation and a transparent circle will appear. Pour 5mL of the mixed solid medium into a plastic culture dish with a diameter of 6cm, blow it in the dish after cooling until there are no visible droplets, and set aside as a protease activity observation plate.
[0059] The documents related to the following examples are as follows:
[0060] Bell, DK, HD Wells and CRS Markham (1982). "In vitro antagonism of Trichoderma species against six fungal plant pathogens." Phytopathology 72:379-382.
[0061] Zhang, GZ, HTYang, XJZhang, FYZhou,
[0062] Wang Aiying, Lou Binggan and Xu Tong (2007). "Inhibitory effects of secretions of Pythium oligandrum on plant pathogenic fungi and its control effect on tomato gray mold." Acta Phytophylacica Sinica (01): 57-60.
[0063] Ye Minshuo, Ma Yan and Huang Youjun (2020). "Research progress on the prevention and control of pepper blight with biocontrol Bacillus sp.." Chinese Agricultural Science Bulletin 36(15):123-129.
[0064] Example 1 Strain confrontation culture screening test method and strain species identification
[0065] 1.1 Activation of biocontrol bacteria and plant pathogenic oomycetes
[0066] The test strain was inoculated on a 10% V8 plate and cultured in the dark at 25°C for 24 to 96 hours.
[0067] 1.2 Antagonism test between Trichoderma and oomycetes
[0068] The tested Trichoderma was matched with several plant pathogenic oomycetes one by one, and the activated Trichoderma and oomycete mycelium blocks were taken with a 5mm puncher and inoculated on both ends of the 10% V8 plate. The biocontrol Trichoderma block was placed on one side of the plate, and the oomycete block was placed on the other side of the plate. The edge of the block was attached to the edge of the culture dish, and the edge of the block was 8 cm apart. There were 3 technical repeats. At the same time, another plate was inoculated with Trichoderma and oomycete as a control; the antagonistic test culture dish was cultured in a 25℃ incubator with 12h / d light for 15d. A total of two biological replicates were completed. During the experiment, the length data of the antagonistic line was recorded on odd days, and the radius of the Trichoderma antagonistic circle on that day was measured and recorded with a tape measure.
[0069] 1.3 Antagonistic real-time scoring system
[0070] The scoring system is as follows: observe the growth of biocontrol Trichoderma and pathogen hyphae (such as obvious mature conidia rings of Trichoderma or dense aerial hyphae of pathogenic oomycetes), measure and record the radius of the Trichoderma antagonistic circle on that day with a tape measure at a fixed time on each measurement day (there are no obvious oomycete-like aerial hyphae inside the antagonistic circle, take the Trichoderma block as the base point, and measure from the middle to the intersection of the antagonistic circles), and score according to the antagonism score comparison table established by Bell et al. (Bell, Wells et al. 1982).
[0071] Scoring rules: Level 1 means that Trichoderma completely covers the surface of the pathogen and keeps growing; Level 2 means that Trichoderma covers part of the pathogen hyphae and covers >2 / 3; Level 3 means that Trichoderma and pathogens each occupy approximately 1 / 2 of the culture medium surface; Level 4 means that the pathogen covers part of the Trichoderma colonies and occupies at least 2 / 3 of the culture medium surface; Level 5 means that the pathogen completely covers the surface of Trichoderma and keeps growing.
[0072] 1.4 Data Analysis and Statistics
[0073] The heatmap is based on the real-time score of the plate antagonism test of the two combinations of the tested biocontrol Trichoderma and oomycetes. The average value of the observation points of the two strains on the 5 odd days after contact is taken as the antagonism score of the corresponding combination. Based on this real-time score, the median clustering method is used, and the altgower clustering analysis of the rows (biocontrol Trichoderma) and columns (pathogens) is performed to obtain the antagonism heatmap. The heatmap drawing software is R studio.
[0074] 1.5 Real-time scoring results of the plate antagonism test
[0075] According to the scoring system, the smaller the score level, the better the antagonistic effect of Trichoderma on pathogens. Conversely, the larger the score level, the worse the antagonistic effect.
[0076] Depend on Figure 1 It can be seen that, except for the reference strain, the strongest antagonistic effects of the ten Trichoderma strains against five common plant oomycete diseases are found in V1 and V4.
[0077] As shown in Table 1, both the reference strain and the V1 strain have significant antagonism to pathogenic oomycetes.
[0078] Table 1 Antagonistic score table of the tested organisms against Trichoderma and pathogenic oomycetes
[0079]
[0080] Note: The mean ± standard deviation of the observation points on 5 odd-numbered days after the contact between Trichoderma and oomycete colonies was taken as the antagonism score of the corresponding combination.
[0081] 1.6 Species identification of biocontrol Trichoderma
[0082] The Nordic Trichoderma V1 and Nordic Trichoderma V4 strains, which have strong inhibitory effects on a variety of plant pathogenic oomycetes, were selected, and their clustered ITS-tef1-rpb2 sequences were analyzed from a phylogenetic perspective. The sequences of the V1 and V4 strains were highly overlapping.
[0083] Among the cluster sequences of the genus Trichoderma, Nordic Trichoderma (T.nordicum) was reported to be isolated in China (Zhang, Yang et al. 2022), and as can be seen from Table 2 below, the clustering of the test strain V1 and the Nordic Trichoderma reference strain sequence is highly similar, so the two highly overlapping selected test strains were named Nordic Trichoderma V1 and Nordic Trichoderma V4.
[0084] Table 2 Phylogenetic DNA marker sequence alignment of the tested Trichoderma strain V1
[0085]
[0086] Note: In the tef1 and rpb2 sequences of the V1 strain, several nucleotides at the 3' end of the DNA sequence were removed to avoid possible sequencing errors. After removing these nucleotides, the tef1 sequence of the V1 strain still differs from the Nordic Trichoderma tef1 sequence MH287501.1.
[0087] Example 2 Validation test of removing pathogenic oomycete cells by Nordic Trichoderma strain V1
[0088] 2.1 Antagonism test between Nordic Trichoderma strain V1 and oomycetes
[0089] Based on the antagonism test between biocontrol Trichoderma and oomycetes, the Nordic Trichoderma strain V1 was subjected to a plate confrontation test with Phytophthora capsici or Pythium aphanidermatum, with 8 technical replicates, and the radius of the Trichoderma antagonistic circle was recorded, and the real-time score of the plate antagonism test was calculated. The antagonistic plates were photographed and recorded every day after the colonies of the antagonists came into contact.
[0090] 2.2 Validation test of Nordic Trichoderma strain V1 in removing pathogenic oomycetes
[0091] The Nordic Trichoderma strain V1, Phytophthora capsici and Pythium aphanidermatum were inoculated separately on 10% V8 plates; in the antagonistic combination, three technical replicate plates were randomly selected. When the Trichoderma antagonistic circle was observed on the fifth day after the contact between the antagonistic colonies, the 5mm lipid blocks at the positions of the Trichoderma antagonistic circles on the first, third and fifth days were inoculated on 10% V8 plates; the V8 plates were placed in the dark at 25℃ and 33℃ for 96h and the growth was observed.
[0092] 2.3 Antagonistic plate results of Trichoderma spp. V1 against Phytophthora capsici and Pythium aphanidermatum
[0093] By repeating the plate antagonism test and recording it in detail, it was found that the Nordic Trichoderma strain V1 had a significant inhibitory and repelling effect on the colonies of pepper phytophthora and icterus apiaceus. Figure 2 After contact, the oomycete-like aerial hyphae on the upper plates were Figure 2 The lower middle part is covered with clustered hyphae of Trichoderma. In addition, the conidial ring of Trichoderma is relatively complete, not covered by oomycete hyphae and continues to grow.
[0094] 2.4 Effect of Trichoderma spp. V1 on the removal of Phytophthora capsici and Pythium aphanidermatum cells
[0095] By taking advantage of the different growth rates of Trichoderma and oomycetes at 33°C, single colonies of the tested Trichoderma and oomycetes, as well as mixed mycelium blocks after contact between Trichoderma and oomycetes were cultured at 33°C.
[0096] The results are as follows Figure 3 As shown in Table 3: When the single colony was cultured at 33°C, Trichoderma stopped growing, while the two tested oomycetes still had a certain growth ability. However, under the same culture conditions of 33°C, the mixed mycelium blocks of Trichoderma and oomycetes obtained in the antagonism circle had no visible mycelial growth, indicating that the number of oomycete cells was extremely low, that is, the oomycete cells were eliminated by Nordic Trichoderma V1 after antagonism. The mixed mycelium blocks could not grow any visible mycelium under the culture conditions of 33°C.
[0097] Table 3 Growth records of Trichoderma nordicum V1, Phytophthora capsici and Pythium aphanidermatum
[0098]
[0099] Example 3 Observation test of enzyme activity of Nordic Trichoderma strain V1
[0100] 3.1 Observation test of cellulase activity of Trichoderma spp. strain V1
[0101] The agar blocks of Nordic Trichoderma strain V1 and dark green Trichoderma reference strain were inoculated on one side of the cellulase activity observation plate, with 4 technical replicates, cultured at 25°C in the dark, and photographed on the next day to record the enzyme activity observation plate.
[0102] 3.2 Results of the observation test on cellulase activity of Trichoderma spp. V1
[0103] The cellulase detection substrate particles of Nordic Trichoderma strain V1 and dark green Trichoderma reference strain in the unit area of colony were degraded and released blue dye, indicating that both strains have strong cellulase activity, and the growth rate and cellulase activity of V1 strain are slightly higher than those of dark green Trichoderma reference strain. In addition, 0.4% w / v Pythium mycelium powder has a stronger induction of cellulase activity than 1% w / v cellulose crystal powder, which partially proves that the antagonistic strength of the two tested Trichoderma may come from their ability to degrade cellulose in the cell wall of oomycetes.
[0104] Specifically, if Figure 4 As shown, in the cellulase activity observation experiment, after two days of cultivation, the cellophane film on the surface and the colonies on the film were removed. The control plate was not inoculated with Trichoderma, and the cellulase detection substrate particles were not degraded, and remained in the form of small black particles. However, the treatment of inoculating Trichoderma produced an obvious cellulase activity detection substrate degradation reaction and released a blue dye area slightly smaller than the size of its Trichoderma colony. And according to Table 4, in the induction plate with cellulose crystals or freeze-dried powder of Pythium mycelium as the only carbon source, the growth rate of the V1 strain and its dye release rate were significantly greater than those of the reference strain.
[0105] Table 4 Growth of Trichoderma nordicum V1 and Trichoderma aureum reference strains on cellulase induction test plates and their degradation dye area records
[0106]
[0107] Note: The diameter of the enzyme activity observation plate was recorded two days after cultivation, which is consistent with the time of taking pictures.
[0108] 3.3 Results of the protease activity observation test of Nordic Trichoderma strain V1
[0109] Both the Nordic Trichoderma strain V1 and the dark green Trichoderma reference strain showed degradation of skim milk within a unit area of colonies, and the milky white background of the culture medium faded, indicating that both strains have strong protease activity and the protease activity of the two strains is similar. This partly proves that the antagonistic strength of the two test Trichoderma strains may come from their ability to degrade oomycete cell proteins.
[0110] Specifically, if Figure 5 As shown in Table 5 below, in the protease activity observation experiment, after two days of cultivation, the cellophane film on the surface and the colonies on the film were removed. The control plate was not inoculated with Trichoderma, and there was no obvious change in the protease detection plate and its cellophane film. However, the treatment of inoculating Trichoderma produced an obvious protease degradation reaction, and a transparent area appeared in the center of the detection plate, which changed from the original milky white color of the plate to colorless and transparent. And the size of the transparent circle was similar to the colonies grown on the cellophane film.
[0111] Table 5 Growth of Nordic Trichoderma V1 and Trichoderma sulphurea reference strains on protease detection plates and their skim milk degradation area records
[0112]
[0113] Note: The diameter of the enzyme activity observation plate was recorded two days after cultivation, which is consistent with the time of taking pictures.
[0114] Example 4: Indoor potted plant protection test of Nordic Trichoderma spore solution
[0115] 4.1 Determination of the potted efficacy of Trichoderma v1 and v4 against pepper blight
[0116] Pepper seedlings at the 4-6 leaf stage were transplanted and divided into groups. Each seedling in the treatment group was inoculated with 4 mL of 10 6 spores / mL Nordic Trichoderma V1 or V4 spore solution, the control group was inoculated with 4mL Nordic Trichoderma V1 and V4 spore solution inactivated by high temperature and high pressure. One week later, each seedling was inoculated with about 1×10 5 Spores (Wang Aiying, Lou Binggan et al. 2007). Each treatment was repeated 3 times, and each repeat had 10 pots. After treatment, observation was made regularly every day. The incidence rate was recorded after one week, and the disease index and control effect were calculated. Three biological replicates were set up. According to the method of "Pepper Disease Survey Specification" (NY / T2060.1-2011), the disease situation of the plants was investigated, and the incidence rate, disease index and control effect were calculated (Ye Minshuo, Ma Yan et al. 2020): disease index = 100 × ∑ (number of trees at each disease level × representative values of each level) / (total number of trees surveyed × maximum disease level); disease index - treatment disease index) / control disease index × 100; control effect (%) = (control disease index - treatment disease index) / control disease index × 100.
[0117] 4.2 Determination of the growth-promoting effect of Trichoderma v1 and v4 on pepper
[0118] When the pepper seedlings grew to 2-3 leaves, 4 mL of 10 6 spores / mL Nordic Trichoderma V1 or V4 spore solution, and 4mL of high temperature and high pressure inactivated V1 or V4 spore solution was used to irrigate the rhizosphere as a control. A total of 10 pots were used for each treatment. At the 4th week after treatment, the substrate adhering to the plant roots was washed clean with water and then sampled, and the plant height, root length, fresh weight and dry weight of the samples were measured. Three biological replicates were set up.
[0119] 4.3 Plate test of the efficacy of Trichoderma spp. V1 and V4 against Pythium root rot of cucumber seedlings
[0120] The experiment set up 8 treatments:
[0121] (1) Control group (CK): no microorganisms were inoculated;
[0122] (2) Inoculate V1 first and then Pythium aphanidermatum;
[0123] (3) Inoculate V4 first and then Pythium aphanidermatum;
[0124] (4) Inoculate with Pythium aphanidermatum first and then with V1;
[0125] (5) Inoculate with Pythium aphanidermatum first and then with V4;
[0126] (6) first inoculate with inactivated Trichoderma norvegicus and then with Pythium aphanidermatum;
[0127] (7) V1 only;
[0128] (8) V4 only;
[0129] Sow the sterilized cucumber seeds on 1% water agar. Put 8 seeds on each water agar plate. When the roots of the cucumber seedlings grow to about 1 cm, ensure that there are 6 cucumber seedlings on each plate. Inoculate 85 μL of 10 7 Spores / mL Nordic Trichoderma V1 or V4 spore solution, the control was inoculated with Nordic Trichoderma V1 or V4 spore solution inactivated by high temperature and high pressure. After culturing for 2 days, a fungus disk of Pythium aphanidermatum was inoculated 1 cm below the root of each cucumber. After culturing for 7 days, photos were taken and statistics were taken. There were 18 cucumbers in each treatment, and the experiment was repeated 3 times.
[0130] Cucumber seedling disease index statistics: The disease index of cucumber seedlings was recorded after 7 days of cultivation. The disease grading standard and calculation formula of cucumber seedlings are as follows:
[0131] Level 0: seeds germinated and seedlings were healthy;
[0132] Level 1: Seeds germinate and there are slight brown spots on the roots of seedlings;
[0133] Level 2: Seeds germinate and seedlings have large brown spots on their roots;
[0134] Level 3: seeds die after germination;
[0135] Disease index = ∑ (number of diseased plants at each level × representative value at each level) / (total number of plants surveyed × highest representative value);
[0136] Preventive effect (%) = 100 × (control disease index - treatment disease index) / control disease index.
[0137] 4.4 Results of the Trichoderma spore fermentation culture system
[0138] Solid fermentation: A solid fermentation system using "husk" and "bran" agricultural waste as the main raw materials was successfully established, and the spore production exceeded expectations, reaching 1.57×10 9 Spores / g, 100g per bottle, a total of 1.57×10 11 spore.
[0139] Liquid fermentation: A liquid fermentation system with lignite and corn flour as the main raw materials was successfully established, with rapid spore production of 3.2×10 8 Spores / ml, 75mL per bottle, a total of 2.4×10 10 spore.
[0140] As shown in Table 6 below, the low-cost solid fermentation has the highest spore production, which can reach 1.57×10 11 Spores, therefore, solid fermentation can be used to prepare spores of Trichoderma in pot experiments.
[0141] Table 6 Statistics of spore production of V1 by different methods
[0142]
[0143] 4.4 Efficacy of Nordic Trichoderma V1 and V4 in controlling pepper blight in potted plants
[0144] In the potted experiment of pepper blight inoculated with Trichoderma spores V1 and V4 by root irrigation method, there was a certain control effect on pepper blight. Seven days after inoculation with the spore solution of Phytophthora capsici, the pepper plants in the control group all showed symptoms related to pepper blight, most of the leaves wilted, and some plants died. Figure 6 and Figure 7 As shown in Table 7, after treatment with V1 and V4, the disease index of pepper blight was reduced to varying degrees. Compared with the control group, V1 had a potted plant protection effect of 100% against pepper phytophthora, and V4 had a protection effect of 83.87%. Three biological replicates obtained similar results.
[0145] Table 7 The potted control effect of Nordic Trichoderma V1 and V4 on pepper blight
[0146]
[0147] 4.5 Growth-promoting effects of Trichoderma v1 and v4 on pepper
[0148] Indoor potted plant test results Figure 8As shown in the results, the pepper plants were treated with the spore solution of the test strains V1 and V4 respectively, which had a significant growth-promoting effect on the growth of pepper. In the fourth week after V1 treatment, the biomass was significantly different, and its plant height, root length, fresh weight and dry weight were significantly different from the control (P<0.05), increasing by 36.53%, 65.06%, 86.53% and 52.45% respectively; V4 also had a growth-promoting effect on pepper plants. In the fourth week after treatment, its root length, fresh weight and dry weight were significantly different from the control (P<0.05), and its plant height, root length, fresh weight and dry weight were increased by 15.66%, 25.84%, 44% and 39.62% respectively compared with the control. Three biological repeated experiments obtained similar results.
[0149] 4.6 Effect of Nordic Trichoderma V1 and V4 on the prevention of Pythium root rot of cucumber seedlings on plates
[0150] like Fig. 9 , Fig.10 As shown in Table 8, compared with the control group inoculated with inactivated Trichoderma first and then Pythium aphanidermatum, when V1 or V4 was inoculated first and then Pythium aphanidermatum, V1 and V4 could significantly reduce the pathogenicity of Pythium aphanidermatum to cucumber seedlings, and the control effects reached 70.37% and 57.41%, respectively. When Pythium aphanidermatum was inoculated first and then V1 or V4, V1 and V4 had poor antagonistic effects on Pythium aphanidermatum, and the relative control effects were 11.11% and 7.41%, respectively. The above results show that when V1 and V4 are used to control Pythium aphanidermatum, V1 and V4 need to be applied in advance so that the control effect is significant when they occupy an absolute advantage.
[0151] Table 8 The plate control effect of Nordic Trichoderma V1 and V4 on Pythium aphanidermatum
[0152]
[0153] 4.7 Screening of the efficacy of Nordic Trichoderma spores in indoor potted plants
[0154] By comparing the spore production in plate, solid fermentation and liquid fermentation, the spore production in solid fermentation, which mainly uses agricultural waste as raw materials, is the highest, reaching 1.254×10 10 Spores / g, and solid fermentation can be static culture, so the solid fermentation method can be used as the application method for patent application.
[0155] The inventors conducted indoor pot experiments to study the biocontrol effects of Nordic Trichoderma strains on pepper blight and cucumber seedling damping-off disease, as well as the growth-promoting effects on pepper seedlings. The results showed that both V1 and V4 treatments had very significant control effects, with the V1 strain having a more significant effect.
[0156] The sequence involved in the present invention is as follows:
[0157] The internal transcribed spacer sequence of Trichoderma nordicum V1 strain is 571 bp in length (SEQ ID NO: 1)
[0158] GenBank: PQ489411.1
[0159] ATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAA
[0160] CTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAA
[0161] CCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCT
[0162] CGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAA
[0163] AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG
[0164] CGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT
[0165] CTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCC
[0166] GAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGA
[0167] CCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGG
[0168] TCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGG
[0169] AGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTG
[0170] ACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA
[0171] > Trichoderma nordicum V1 strain rpb2 sequence (partial), length 805bp (SEQ ID NO:2), GenBank: PQ510043.1
[0172] CTTGTGGTCTGGTCAAGAATTTATCTCTCATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTTGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTCTATCGTCTTCAAAAGGCCGGCATTGCCACGGATGAAGACATAGGAGATGACCCAAATAAGCGCCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTCAACCCGAGAAGCTGTCCTTTTCCCCCCTTTGTCCAATTTTTCTGTCCCCTACGTTCAGATCGCTAATTGATGCTACACA
[0173] > Trichoderma nordicum V1 strain tef1 sequence (partial), length 551bp (SEQ ID NO:3), GenBank: PQ510044.1
[0174] CACTTTTCTGCTTTTTACATCGTGCCCGACAATTCTGTCCTCAGTCTTGTCTTTTTTCTCTCGCAGCATCACACCCCGCTTTACCTGTCTACCCCTCCTTTGGCACAGCAAAAATTTTCTGGCTGCCTTGCTTGGCTTTTAGTGGGGTGCCAACTTTTTTTTTGTTGTGGCCGGAACCCCGCTATCGCCACTGTCCCTCACTCAATTGCATCGTCTTCTGCTGGTTCATTGTGCTAATCATGCTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTCCGCTTTTCCTCATTGACCCTTTGAGACCATCATTCTAACGTGTCGCTCTGCAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATCCTGATCATCGCTGCCGGTACTGGTGAG
[0175] Note: In the tef1 and rpb2 sequences of strain V1, several nucleotides at the 3' end of the DNA sequence were removed to avoid possible sequencing errors.
Claims
1. A Trichoderma nordicum strain V1, whose deposit number is CGMCC No: 41478.
2. A Nordic Trichoderma mycelium, characterized in that The Trichoderma nordicum mycelium is obtained by culturing the Trichoderma nordicum strain V1 as claimed in claim 1.
3. A Nordic Trichoderma fermentation liquid, characterized in that The Trichoderma nordicum fermentation broth is obtained by culturing the Trichoderma nordicum strain V1 as claimed in claim 1 or by culturing the Trichoderma nordicum mycelium as claimed in claim 2.
4. Use of the Trichoderma nordicum strain V1 according to claim 1, the Trichoderma nordicum hyphae according to claim 2 and / or the Trichoderma nordicum fermentation liquid according to claim 3 in biological control.
5. The use according to claim 4, characterized in that The biological control is to inhibit the growth of pathogenic bacteria.
6. The use according to claim 5, characterized in that The pathogenic bacteria include one or more of Phytophthora capsici LT263, Pythium aphanidermatum HBT1, Pythium sojae, Pythium ultimum, and Pythium myriotylum.
7. The use according to claim 4, characterized in that The biological control is to treat plant diseases; preferably, the plant diseases include one or more of pepper blight and cucumber seedling damping-off disease.
8. The method for culturing Trichoderma mycelium according to claim 2, wherein: The method comprises the following steps: culturing the Nordic Trichoderma strain on a fermentation medium.
9. The method for culturing the Nordic Trichoderma fermentation liquid as claimed in claim 3, wherein: The following steps are involved: The Trichoderma mycelium is inoculated into a fermentation medium for fermentation.
10. Use of the Trichoderma nordicum strain V1 according to claim 1 in preparing Trichoderma nordicum mycelium or Trichoderma nordicum fermentation broth.