Rice blast antagonistic bacterium strain as well as preparation method and application thereof

Abstract

The invention discloses a rice blast antagonistic bacterium strain and a preparation method and application thereof, the classification name of the rice blast antagonistic bacterium strain is Streptomyces humidus H46, and the rice blast antagonistic bacterium strain is preserved in the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Microbiological Culture Collection Center, the address of the preservation unit is the 5th floor, No. 59, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City, and the preservation date is December 9, 2024; the preservation number is GDMCC (China General Microbiological Culture Collection Center) According to the invention, the control effect of rice blast can be improved, the strain is safe and environment-friendly, the influence of chemical pesticide use on the environment is reduced, the screened strain H46 has a remarkable inhibition effect on rice blast bacteria GUY11, the inhibition rate reaches 75.34%, and control effect experiments show that the strain H46 can also effectively reduce the morbidity and disease index of rice blast.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a rice blast antagonistic bacteria strain and a preparation method and application thereof. Background Art

[0002] Rice blast is one of the major diseases in rice production. It is caused by Magnaporthe oryzae and seriously affects rice yield and quality. Traditionally, the prevention and control of rice blast mainly relies on chemical pesticides, but the long-term use of chemical pesticides will lead to environmental pollution, increased resistance of pathogens, and impacts on non-target organisms. Therefore, the development of an environmentally friendly and sustainable prevention and control method is of great significance to ensure food security and sustainable agricultural development.

[0003] In the field of biological control, using microorganisms to fight plant pathogens is an effective strategy. These beneficial microorganisms can inhibit the growth and infection of pathogens by competing for nutrients, producing antimicrobial substances, and inducing plant resistance. In recent years, with the development of microbiology and molecular biology techniques, more and more microbial resources have been discovered and utilized, providing new ideas and methods for the biological control of rice blast.

[0004] Although some studies have reported successful cases of using microorganisms to control rice blast, there are still some challenges and limitations. First, there are differences in the sensitivity of different regions and different rice varieties to pathogens, and it is necessary to screen out biocontrol strains with broad applicability. Secondly, the stability and durability of biocontrol strains are also important factors affecting their application effects. In addition, the mechanism of action of biocontrol strains is complex, and it is necessary to conduct in-depth research on the molecular mechanism of their interaction with pathogens to guide the rational application of biocontrol strains.

[0005] Currently, there is a lack of a rice blast antagonistic bacteria strain and a preparation method and application thereof. Summary of the invention

[0006] The purpose of the present invention is to provide a rice blast antagonistic bacteria strain and a preparation method and application thereof.

[0007] In order to solve the problems of the prior art, the present invention provides the following technical solutions: In a first aspect, the present application provides a rice blast antagonistic bacteria strain;

[0008] In a second aspect, the present application provides a rice blast antagonistic bacterial agent;

[0009] In a third aspect, the present application provides a method for preparing a spore suspension of a rice blast antagonistic bacteria strain;

[0010] In a fourth aspect, the present application provides a use of a rice blast antagonistic bacteria strain or a rice blast antagonistic bacteria agent in the preparation of a preparation for preventing and controlling rice blast.

[0011] The first aspect of the present application provides a rice blast antagonistic bacteria strain, which is classified and named Streptomyces humidus H46 and is preserved in the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Microbiological Culture Collection Center. The address of the preservation unit is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The preservation date is December 9, 2024; the preservation number is GDMCC No.65595.

[0012] Furthermore, the 16s rDNA sequence of the rice blast antagonistic bacteria strain is the nucleotide sequence shown in SEQ ID No.1.

[0013] A second aspect of the present application provides a rice blast antagonistic bacteria agent prepared from a rice blast antagonistic bacteria strain.

[0014] Furthermore, the active ingredient is at least one of the following (a), (b), and (c):

[0015] (a) a fermentation culture of a strain of antagonistic bacteria against rice blast;

[0016] (b) a spore suspension of the obtained rice blast antagonistic bacteria strain;

[0017] (c) Ultrasonic lysis precipitation of the obtained rice blast antagonistic bacteria strain cells.

[0018] The third aspect of the present application provides a method for preparing a rice blast antagonistic bacteria agent, comprising the following steps: using an inoculation loop to pick up an activated single colony of Streptomyces humidus H46 and inoculate it into 200 mL of Gobber liquid culture medium, and culturing it in a shaker at 33° C. and 180 rpm for 3 days for use.

[0019] Furthermore, the Gao liquid culture medium consists of 20 g / L soluble starch, 1 g / L potassium nitrate, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.01 g / L ferrous sulfate and 0.5 g / L sodium chloride.

[0020] A fourth aspect of the present application provides a use of a rice blast antagonistic bacteria strain or a rice blast antagonistic bacteria agent in the preparation of a preparation for preventing and controlling rice blast.

[0021] Beneficial effects: The present invention can improve the control effect of rice blast, is safe and environmentally friendly, and reduces the impact of chemical pesticide use on the environment. The screened strain H46 has a significant inhibitory effect on rice blast fungus GUY11, with an inhibition rate of 75.34%, and can effectively reduce the incidence and disease index of rice blast.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] (1) In this invention, we focus on a bacterial strain H46 with significant antagonistic activity screened from soil samples collected from the intercropping system of Huangkenuo and Shanyou 63 in the Jianshui Rice Research Base in Yunnan. Through a series of experimental verifications, we found that the strain can effectively inhibit the growth of rice blast fungus, reduce the incidence of rice blast disease, and have a negative impact on the germination of rice blast fungus spores and the formation of appressorium. These findings provide a scientific basis for the development of new biological control agents.

[0024] (2) Environmental friendliness: Compared with traditional chemical pesticide control methods, the biological control method adopted by the present invention reduces the use of chemical pesticides and reduces environmental pollution, which is a more environmentally friendly control strategy. Reduced pathogen resistance: Long-term use of chemical pesticides will lead to the enhancement of pathogen resistance, while the biological control method of the present invention can reduce the development of such resistance and extend the effective use period of chemical pesticides.

[0025] (3) Clear mechanism of action: Through plate confrontation method and scanning electron microscopy observation, the present invention reveals the effect of strain H46 on the growth and morphology of rice blast fungus, as well as its inhibitory effect on spore germination and appressorium formation of rice blast fungus, providing a scientific basis for a deeper understanding of its mechanism of action. Wide application potential: Strain H46 was screened from soil samples from the Yunnan Jianshui Rice Research Base, showing its adaptability and application potential under different environmental conditions, and is expected to be promoted and applied in a variety of rice-growing areas.

[0026] (4) Promoting plant health: The method of the present invention can not only prevent and control rice blast, but also promote the healthy growth of rice by inducing plant resistance and other mechanisms, thereby improving the overall yield and quality of the crop. Cost-effectiveness: Compared with traditional chemical control methods, biological control methods generally have lower costs and can provide farmers with an economical and effective control option. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The schematic diagram of the strain H46 of the present invention belonging to Streptomyces hygrophilus.

[0028] Figure 2 This is a comparative analysis diagram of the sequencing results of the H46 strain of the present invention and the NCBI database.

[0029] Figure 3 It is a flat plate confrontation result diagram of the present invention.

[0030] Figure 4 This is a diagram showing changes in mycelium of rice blast fungus after being treated with biocontrol bacteria according to the present invention.

[0031] Figure 5 The figure shows the effect of the strain of the present invention on the spore germination and appressorium of rice blast fungus.

[0032] Figure 6 This is a graph showing the effect of the fermentation liquid of the strain of the present invention on the incidence of rice blast.

[0033] Figure 7 This is a diagram showing the effect of the fermentation broth of the strain of the present invention on spore germination. DETAILED DESCRIPTION

[0034] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0035] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0036] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0037] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0038] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0039] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as μg, mg, g, kg, etc.

[0040] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0041] A first aspect of an embodiment of the present application provides a rice blast antagonistic bacteria strain, the rice blast antagonistic bacteria strain is classified and named Streptomyces humidus H46, and is preserved in the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Microbiological Culture Collection Center, the address of the preservation unit is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, the preservation date is December 9, 2024; the preservation number is GDMCC No.65595.

[0042] In some embodiments, the 16S rDNA sequence of the rice blast antagonistic bacteria strain is the nucleotide sequence shown in SEQ ID No.1.

[0043] SEQ ID No.1:

[0044] GCCATGCTACAGCTAGACGTGTTAGTCGAACGATGAACCACTTCGGTGGGGATTAGTGGCGAACGGG

[0045] TGAGTAACACGTGGGCAATCTGCCCTTCACTCTGGGACAAGCCCTGGAAACGGGGTCTAATACCGGA

[0046] TAATACTTCCACTCGCATGGGTGGGGGTTGAAAGCTCCGGCGGTGAAGGATGAGCCCGCGGCCTATC

[0047] AGCTTGTTGGTGAGGTAATGGCTCACCAAGGCGACGACGGGTAGCCGGCCTGAGAGGGCGACCGGC

[0048] CACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGG

[0049] GCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCA

[0050] GGGAAGAAGCGAAAGTGACGGTACCTGCAGAAGAAGCGCCGGCTAACTACGTGCCAGCAGCCGCGG

[0051] TAATACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGT

[0052] CGGATGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCAGACTAGAGTGTGGTAGG

[0053] GGAGATCGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAGGC

[0054] GGATCTCTGGGCCATTACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTG

[0055] GTAGTCCACGCCGTAAACGGTGGGAACTAGGTGTTGGCGACATTCCACGTCGTCGGTGCCGCAGCTA

[0056] ACGCATTAAGTTCCCCGCCTGGGG

[0057] A second aspect of the embodiments of the present application provides a rice blast antagonistic bacteria agent prepared from a rice blast antagonistic bacteria strain.

[0058] In some embodiments, the active ingredient is at least one of the following (a), (b), and (c):

[0059] (a) a fermentation culture of a strain of antagonistic bacteria against rice blast;

[0060] (b) a spore suspension of the obtained rice blast antagonistic bacteria strain;

[0061] (c) Ultrasonic lysis precipitation of the obtained rice blast antagonistic bacteria strain cells.

[0062] The third aspect of the embodiment of the present application provides a method for preparing a rice blast antagonistic bacteria agent, comprising the following steps: using an inoculation loop to pick up an activated single colony of Streptomyces humidus H46 and inoculate it into 200 mL of Gobber liquid culture medium, and culturing it in a shaker at 33° C. and 180 rpm for 3 days for use.

[0063] In some embodiments, the Gobber liquid medium consists of 20 g / L soluble starch, 1 g / L potassium nitrate, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.01 g / L ferrous sulfate, and 0.5 g / L sodium chloride.

[0064] A fourth aspect of the embodiments of the present application provides a use of a rice blast antagonistic bacteria strain or a rice blast antagonistic bacteria agent in the preparation of a preparation for preventing and controlling rice blast.

[0065] Example 1

[0066] The invention discloses a rice blast antagonistic bacteria strain, which is classified and named as Streptomyces humidus H46, and is preserved in the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Province Microbiological Culture Collection Center, and the address of the preservation unit is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the preservation date is December 9, 2024; the preservation number is GDMCC No.65595.

[0067] The 16S rDNA sequence of the rice blast antagonistic bacteria strain is the nucleotide sequence shown in SEQ ID No.1.

[0068] Example 2

[0069] The rice blast antagonistic bacterial agent prepared by a rice blast antagonistic bacterial strain of the present invention has an active ingredient of at least one of the following (a), (b), and (c):

[0070] (a) a fermentation culture of a strain of antagonistic bacteria against rice blast;

[0071] (b) a spore suspension of the obtained rice blast antagonistic bacteria strain;

[0072] (c) Ultrasonic lysis precipitation of the obtained rice blast antagonistic bacteria strain cells.

[0073] Example 3

[0074] The invention discloses a method for preparing a rice blast antagonistic bacterial agent, comprising the following steps: picking an activated single colony of Streptomyces humidus H46 with an inoculation loop and inoculating it into 200 mL of Goe's liquid medium, placing it in a shaking incubator at 33°C and 180 rpm for culturing for 3 days for standby use. The Goe's liquid medium is composed of 20 g / L soluble starch, 1 g / L potassium nitrate, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.01 g / L ferrous sulfate and 0.5 g / L sodium chloride.

[0075] Example 4

[0076] The invention discloses an application of a rice blast antagonistic bacteria strain or a rice blast antagonistic bacteria agent in preparing a preparation for preventing and controlling rice blast.

[0077] Example 5

[0078] 1. Sample Preparation

[0079] The root soil of Huangkenuo was collected from the intercropping system of Huangkenuo and Shanyou 63 in the Jianshui Rice Research Base in Yunnan. 10g of mixed soil sample was placed in a triangular flask containing 100mL of sterile water and rotated at 28℃ and 150r / min for 30min. After the soil solution was allowed to stand for 1h, 5mL of supernatant was taken and added to 45mL of sterile water to make 10 －1 Concentration dilution, and so on, dilute the soil solution to 10 －3 , 10 －4 , 10 －5 , 10 －6 concentration.

[0080] 2. Preparation of Culture Medium

[0081] Dissolve Gao's medium No. 1 (20 g soluble starch, 1 g potassium nitrate, 0.5 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate, 0.01 g ferrous sulfate, 0.5 g sodium chloride) in 1000 mL of distilled water, heat until agar is completely dissolved, dispense the medium into appropriate containers, and sterilize at 121°C for 15 min using an autoclave. After sterilization, allow the medium to cool to about 50°C, then pour into a sterile culture dish for later use.

[0082] 3. Separation and purification

[0083] 500ul of soil solution of each concentration was evenly spread on the culture medium and cultured at 28℃ for 7 days. The grown bacterial colonies were streaked 3 times to obtain pure culture strains. The obtained pure culture strains were numbered in the order of screening. The target strains screened from interplanted HKN were numbered "H1, H2...H46".

[0084] 4. Screening of antagonistic bacteria against rice blast fungus

[0085] The rice blast strain (GUY11) preserved on the laboratory filter paper was picked up on the PDA medium for activation and then used for standby. The plate confrontation method was used to take the activated rice blast fungus cake with a diameter of 1 cm with a hole puncher and place it in the center of the PDA medium. The purified strain was inoculated 3 cm away from the fungus cake. After culturing at 28°C, the diameter of the inhibition zone was measured (cross method), and the inhibition rate was calculated to screen the strain with antagonistic activity.

[0086] Inhibition rate = (control colony diameter - treated colony diameter) / (control colony diameter - bacterial cake diameter) × 100%

[0087] 1. Screening and identification of strains

[0088] H46 grown on Gottfried's medium formed white, light yellow, irregular colonies with a moist, smooth surface ( Figure 1 ). The 16s rDNA sequence of strain H46 obtained by sequencing was 1430 dp. The sequencing results of strain H46 were compared with the NCBI database and it was inferred that strain H46 belonged to Streptomyces hygrophilus ( Figure 2 ).

[0089] Test Example 1

[0090] Effects of strains on the growth of rice blast pathogen GUY11

[0091] The plate confrontation results showed that the strain had a significant inhibitory effect on the rice blast pathogen GUY11, with an inhibition rate of 75.34% ( Figure 3 ). In addition, under the scanning electron microscope, the mycelium of the control group was tubular, slender and relatively smooth, with even branches forming a complex network structure, showing normal morphological characteristics. However, the mycelium treated with biocontrol bacteria was severely deformed, including the entanglement of pathogenic mycelium and stickiness ( Figure 4 ).

[0092] Effects of strains on spore germination and appressorium of Magnaporthe grisea

[0093] The results showed that the germination rate of mycelium in the blank control group was 95.3%, and the appressorium formation rate was 89%. After being treated with the fermentation liquid of the strain, the germination rate of the rice blast fungus was 91.3%, and the appressorium formation rate was significantly reduced to 29.3% ( Figure 5 ).

[0094] Pot experiment to determine the efficacy

[0095] The fermentation liquid of the strain was used to irrigate the roots of Huangkenuo, and sterile water was used as a control. When the rice seedlings were planted to the three-leaf and one-heart stage, 20 ml of the fermentation liquid was added to the roots. After 24 hours of fermentation liquid treatment, the suspension of rice blast fungus spores was evenly sprayed on the leaves. Seven days after the inoculation of rice blast fungus, the incidence of rice blast was investigated, and the incidence rate and disease index were calculated. The results showed that the fermentation liquid of the strain could significantly reduce the incidence of rice blast ( Figure 6 ).

[0096] Test Example 2

[0097] Isolation and Identification of Antagonistic Bacteria to Rice Blast Pathogen

[0098] Soil samples were collected from the root system of interplanted rice, and microorganisms were isolated by dilution method. The bacteria with good antagonistic effect on GUY11 were screened by plate confrontation culture method. The strain gene set was compared with the NCBI database, and the strain was identified as Streptomyces humidus. The inhibition rate of mycelial growth of GUY11 was 75.34% (Table 2). The classification, identification and number of the strains are shown in Table 1:

[0099] Table 1

[0100]

[0101] The inhibitory effect of the strain on rice blast fungus is shown in Table 2:

[0102] Table 2

[0103]

[0104] Effects of bacteria on mycelial morphology of rice blast fungus

[0105] The plate confrontation method was used. After the inhibition zone appeared on the plate, the rice blast fungus near the antagonistic bacteria was picked on the slide. The plate inoculated with only rice blast fungus was used as the control. The changes in the morphological structure of the rice blast fungus hyphae were observed under a microscope. The results showed that the mycelium of the rice blast fungus treated with strain H46 showed sticky and entangled phenomena.

[0106] Effects of bacterial strain fermentation broth on spore germination

[0107] In order to clarify the effect of antagonistic bacteria on the germination of GUY11, the spore germination and appressorium formation under different treatments were observed and compared under a microscope, and 100 spores were selected to calculate the germination rate and appressorium formation rate. The results showed that the mycelial germination rate of rice blast fungus in the blank control group was 95.3% and the appressorium formation rate was 89%. After treatment with antagonistic bacteria H46, the germination rate and appressorium formation rate of rice blast fungus were reduced to 91.3% and 29.3%, respectively.

[0108] Figure 7 This is a diagram showing the effect of the fermentation broth of the strain of the present invention on spore germination.

[0109] Effect of a single bacterial strain on rice blast

[0110] The fermentation liquid of strain H46 was used to irrigate the roots of two rice varieties, Huangkenuo and Lijiang Xintuan Heigu, respectively. Sterile water was used as the control. Three replicates were set for each treatment. The rice seedlings were planted to the three-leaf and one-heart stage, and 20 ml of fermentation liquid was added to irrigate the roots. After 24 hours of fermentation liquid treatment, the suspension of rice blast fungus spores was evenly sprayed on the leaves. After 7 days of inoculation with rice blast fungus, the incidence of rice blast was investigated, and the incidence rate and disease index were calculated. The results showed that the fermentation liquid of the strain can reduce the incidence of rice blast. The effect of the fermentation liquid of the strain on the incidence of Huangkenuo is shown in Table 3:

[0111] Table 3

[0112]

[0113] The effect of the fermentation liquid of a single strain on the disease of Xintuan Black Valley in Lijiang is shown in Table 4:

[0114] Table 4

[0115]

[0116] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A rice blast antagonistic bacteria strain, characterized in that: The rice blast antagonistic bacteria strain is named Streptomyces humidus H46, and is deposited in the Institute of Microbiology, Guangdong Academy of Sciences, Guangdong Microbiological Culture Collection Center. The address of the depository is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit date is December 9, 2024; Deposit number: GDMCC No.65595.

2. The rice blast antagonistic bacteria strain according to claim 1, characterized in that: The 16s rDNA sequence of the rice blast antagonistic bacteria strain is the nucleotide sequence shown in SEQ ID No.

1.

3. The rice blast antagonistic bacteria agent prepared from the rice blast antagonistic bacteria strain according to claim 1.

4. The rice blast antagonistic bacteria agent according to claim 3, wherein the active ingredient is at least one of the following (a), (b), and (c): (a) a fermentation culture of the rice blast antagonistic bacteria strain according to claim 1; (b) a spore suspension of the rice blast antagonistic bacteria strain obtained according to claim 1; (c) ultrasonic lysis precipitation of the rice blast antagonistic bacteria strain cells obtained according to claim 1.

5. The method for preparing the rice blast antagonistic bacteria agent according to claim 3, characterized in that The method comprises the following steps: picking an activated single colony of Streptomyces humidus H46 with an inoculation loop and inoculating it into 200 mL of Goethe's liquid culture medium, and culturing it in a shaking incubator at 33° C. and 180 rpm for 3 days for use.

6. The method for preparing the rice blast antagonistic bacteria agent according to claim 5, characterized in that: The Goeber liquid culture medium consists of 20 g / L soluble starch, 1 g / L potassium nitrate, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.01 g / L ferrous sulfate and 0.5 g / L sodium chloride.

7. Use of the rice blast antagonistic bacteria strain according to claim 1 or the rice blast antagonistic bacteria agent according to claim 3 in the preparation of a preparation for preventing and controlling rice blast.

Images