Escherichia coli probiotic EcN engineering strain and application thereof in preparation of streptococcus pneumoniae capsular polysaccharide

Abstract

The invention belongs to the technical field of a streptococcus pneumoniae capsular polysaccharide vaccine produced by biological fermentation. According to the escherichia coli probiotic EcN engineering strain provided by the invention, compared with an original strain EcN, genes wecA and waaL are knocked out; meanwhile, plasmid is used for expressing a streptococcus pneumoniae capsular polysaccharide synthesis gene cluster to obtain an EcN engineering strain. Specific antiserum identification of capsular polysaccharide shows that the EcN engineering strain can synthesize streptococcus pneumoniae capsular polysaccharide, not only can synthesize neutral polysaccharide, but also can synthesize negatively-charged acidic polysaccharide. Moreover, compared with streptococcus pneumoniae, the capsular polysaccharide chain synthesized by the EcN engineering strain is longer, higher in yield and high in homogeneity; and sterilization is not needed, so that the method is safe and easy to operate. The method disclosed by the invention can be used for preparing streptococcus pneumoniae polysaccharide vaccines, and also can be used for synthesizing polysaccharide vaccines in intestinal tracts by orally taking escherichia coli probiotic engineering bacteria.

Description

Technical Field

[0001] The invention belongs to the technical field of producing streptococcal capsular polysaccharides by biological fermentation Background Art

[0002] Escherichia coli Nissle1917 (EcN) is a non-pathogenic Escherichia coli strain with serotype O6:K5:H1, which has unique microecological characteristics and immunomodulatory effects. EcN does not produce hemolysin, enterotoxin or other protein toxins, so it does not trigger host inflammatory response, showing extremely high safety. It is certified by the U.S. Food and Drug Administration (FDA) as an edible microorganism that is safe for humans. Due to its safety and effectiveness, EcN has been widely used in probiotic preparations in recent years and has become a universal chassis strain for the development of smart microorganisms.

[0003] The lipopolysaccharide (LPS) of Escherichia coli is composed of lipid A, core oligosaccharide and O-antigen, with O-antigen located on the outermost side. The gene cluster located between the galF and gnd genes on the genome is responsible for the synthesis of O-antigen polysaccharide, which is synthesized through a Wzx / Wzy-dependent pathway, such as Figure 1 As shown. In short, the oligosaccharide unit is synthesized by multiple glycosyltransferases on the lipid carrier (Und-P) embedded in the inner side of the cell membrane, and then flipped to the outer side of the membrane by the translocase (Wzx). The polymerase (Wzy) connects the oligosaccharide units into polysaccharide chains, and the regulatory protein (Wzz) controls the length of the polysaccharide chain. Finally, the ligase (WaaL) connects the polysaccharide to the lipid A-core oligosaccharide to synthesize lipopolysaccharide. However, EcN cannot synthesize the complete O-antigen because its polymerase gene has a point mutation and loses its function. EcN can only synthesize lipopolysaccharide with one oligosaccharide unit.

[0004] Streptococcus pneumoniae is a globally prevalent pathogenic bacterium that can cause severe invasive diseases such as pneumonia, sepsis, and meningitis in humans. The surface of Streptococcus pneumoniae is covered with a layer of capsular polysaccharide (CPS), which is the most critical pathogenic factor and important antigen of bacteria. Therefore, the capsular polysaccharide of the serotype with strong invasiveness is prepared into polysaccharide vaccine or polysaccharide protein conjugate vaccine, which plays a huge role in protecting people from bacterial infection. The prerequisite for preparing sugar vaccines is to obtain high-purity capsular polysaccharide. However, capsular polysaccharide is currently extracted and purified from pathogenic Streptococcus pneumoniae. It is necessary to inactivate and lyse the bacteria with bactericides or lysing agents first. In addition, cell wall polysaccharide contamination must be removed, and finally high-purity capsular polysaccharide can be obtained after multiple steps of purification, resulting in low polysaccharide yield and high vaccine price. With the continuous growth of global demand for Streptococcus pneumoniae vaccines, the development of new synthesis methods for capsular polysaccharide antigens has become increasingly urgent and important, and has broad application prospects. The capsular polysaccharide of Streptococcus pneumoniae is also synthesized through a Wzx / Wzy-dependent pathway. Therefore, using EcN as a chassis strain and expressing the capsular polysaccharide synthesis gene cluster with a plasmid can synthesize the capsular polysaccharide of Streptococcus pneumoniae. Summary of the invention

[0005] The present invention utilizes Nissle1917 (EcN) to synthesize the capsular polysaccharide of Streptococcus pneumoniae. Figure 2 As shown, the CRISPR-Cas9 technology was first used to knock out the initiating glycosyltransferase gene wecA for synthesizing O-antigen in EcN to obtain the mutant strain EcNΔwecA, which cannot synthesize O-antigen; then the ligase gene waaL was knocked out to obtain the double gene knockout mutant strain EcNΔwecAΔwaaL, which cannot synthesize LPS. These EcN mutant strains can be used as chassis strains. Then the gene cluster (cps locus) for synthesizing streptococcal capsular polysaccharides was constructed into an expression vector to obtain the plasmid pCPS, and the plasmid pCPS was transferred to the above chassis strain to obtain the target engineering strain; the gene expression in the gene cluster was induced to synthesize the oligosaccharide unit (repeat unit) of the capsular polysaccharide on the lipid carrier on the inner side of the Escherichia coli cell membrane, the pneumococcal translocase Wzx transferred the oligosaccharide unit to the outer side of the cell membrane, and the polymerase Wzy polymerized the oligosaccharide unit into a long chain of capsular polysaccharide. The Wzz protein of Escherichia coli can regulate the length of capsular polysaccharides. The ligase WaaL of Escherichia coli connects the capsular polysaccharide chain to the lipid A-core oligosaccharide, which is then transferred to the outside of the cell membrane and finally to the cell wall of Escherichia coli.

[0006] The invention provides an Escherichia coli mutant strain, in which gene wecA is knocked out compared with a starting strain; the starting strain is Escherichia coli Nissle1917.

[0007] In a specific embodiment of the present invention, the gene waaL is also knocked out.

[0008] In a specific embodiment of the present invention, the plasmid pCPS14 carries the capsular polysaccharide synthesis gene cluster of Streptococcus pneumoniae serotype 14; the base sequence of the plasmid pCPS14 is shown in SEQ ID NO.1 in the sequence listing.

[0009] In a specific embodiment of the present invention, the plasmid pCPS23F carries the capsular polysaccharide synthesis gene cluster of Streptococcus pneumoniae serotype 23F; the base sequence of the plasmid pCPS23F is shown in SEQ ID NO.2 in the sequence listing.

[0010] Through the identification of specific antiserum of capsular polysaccharides, it was found that the engineered strain of EcN can synthesize the capsular polysaccharides of Streptococcus pneumoniae, not only the neutral capsular polysaccharides, but also the negatively charged acidic capsular polysaccharides.

[0011] Moreover, compared with S. pneumoniae, the capsular polysaccharide chains synthesized by the engineered strain of EcN are longer and produced in higher quantities.

[0012] The invention obtains an engineered strain by genetically modifying the probiotic E. coli EcN, and uses the engineered strain to synthesize capsular polysaccharides with different structural characteristics of Streptococcus pneumoniae. The synthesized polysaccharide has high homogeneity. The method of the invention can be used for large-scale culture and large-scale synthesis without sterilization, and is safe and easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a diagram of the synthesis pathway of Escherichia coli O-antigen.

[0014] Figure 2 This is a diagram of the synthesis of capsular polysaccharide (CPS) of pathogenic streptococci using the EcN chassis strain of E. coli. Among them, A is a diagram of the synthesis of capsular polysaccharide in the EcNΔwecA strain and being transferred to the bacterial surface; B is a diagram of the synthesis of capsular polysaccharide in the periplasmic region of the EcNΔwecAΔwaaL strain.

[0015] Figure 3 These are the silver staining results of lipopolysaccharide (LPS) from different strains.

[0016] Figure 4 This is a map of the capsular polysaccharide synthesis gene clusters of Streptococcus pneumoniae serotypes 14 and 23F.

[0017] The genes enclosed by boxes are constructed into the expression vector, and the 4 regulatory protein genes at the 5' end of the gene cluster and other genes that have lost their functions are not included. Specifically, the synthetic genes of serotype 14 capsular polysaccharide constructed into the vector include wchA, wchJ, wchK, wzy, wchL, wchM, wchN, wzx; the synthetic genes of serotype 23F capsular polysaccharide include wchA, wchF, wzy, wchV, wchW, wzx, wchX, gtp1, gtp2, gtp3, rmlA, rmlC, rmlB, rmlD.

[0018] Figure 5 The following are the verification images of the recombinant plasmids pCPS14 and pCPS23F. A is the PCR product image of the serotype 14 capsular polysaccharide gene cluster in pCPS14; B is the PCR product image of the internal fragment of the serotype 23F capsular polysaccharide gene cluster in pCPS23F.

[0019] Figure 6 is a map of the recombinant plasmid pCPS14.

[0020] Figure 7 This is a map of the recombinant plasmid pCPS23F.

[0021] Figure 8 This is a graph showing the immunoblot results of the capsular polysaccharides of Streptococcus pneumoniae serotypes 14 and 23F produced by Escherichia coli.

[0022] Among them, the capsular polysaccharide was detected with specific antiserum of the capsular polysaccharide and HRP-labeled antibody. A is the capsular polysaccharide of serotype 14 produced by different strains; B is the capsular polysaccharide of serotype 23F produced by different strains. Escherichia coli carrying the empty plasmid pBBR1-MCS-3 was used as a negative control, and the capsular polysaccharide of the wild-type strain of Streptococcus pneumoniae was used as a positive control.

[0023] Fig. 9 This is a diagram of the expression of Streptococcus pneumoniae capsular polysaccharide in Escherichia coli.

[0024] Among them, the capsular polysaccharide was detected by antiserum specific to the capsular polysaccharide and fluorescently labeled IgG antibodies. A is a diagram of different E. coli strains containing pCPS14 and empty plasmids. The strains containing pCPS14 all emit fluorescence, while the strains containing the empty plasmid have no fluorescence. B is a diagram of different E. coli strains containing pCPS23F and empty plasmids. The strains containing pCPS23 all emit fluorescence, while the strains containing the plasmid have no fluorescence. E. coli containing the empty plasmid pBBR1-MCS-3 was used as a negative control, and Streptococcus pneumoniae serotypes 14 and 23F were used as positive controls.

[0025] Fig.10 It is a graph of capsular polysaccharide production of different strains.

[0026] Among them, A is a graph showing the production of capsular polysaccharide CPS14 in different E. coli strains, in which the capsular polysaccharide production of Streptococcus pneumoniae serotype 14 is used as a control. B is a graph showing the production of capsular polysaccharide CPS23F in different E. coli strains, in which the capsular polysaccharide production of Streptococcus pneumoniae serotype 23F is used as a control. DETAILED DESCRIPTION

[0027] Example 1

[0028] 1. Using Crisper-Cas9 technology to knock out the genes for synthesizing O-antigen and lipopolysaccharide in E. coli EcN to obtain a chassis strain

[0029] The serotype of Escherichia coli EcN strain is O6:K5:H1, and the NCBI sequence number of its genome is NZ_CP007799.1 (reference Journal of Biotechnology, 2014, 187, 106-107).

[0030] The specific steps are as follows:

[0031] 1. Knockout of wecA gene to obtain mutant strain EcNΔwecA

[0032] 1.1 Extract bacterial genomic DNA.

[0033] Inoculate the bacteria into 3mL SOB medium, culture at 37°C and 200rpm for 16 hours, and collect the cells by centrifugation at 5000rpm for 3 minutes. Resuspend the bacteria with 250μL 50mM Tris (pH8.0) buffer, and collect the cells by centrifugation at 5000rpm for 3 minutes. Resuspend the bacteria with 250μL 50mM Tris (pH8.0) buffer, add 10μL 0.4M EDTA and 10μL 20 mg / mL lysozyme, and continue to act for 20 minutes to lyse the bacteria. Add 1.5μL 20 mg / mL proteinase K to degrade proteins. Add 15μL 10% SDS and incubate at 50℃ for 2 hours. Add 2μL 10 mg / mL RNAse and remove RNA by incubating at 65℃ for 30 minutes. After transferring the solution to a centrifuge tube, add 250 μL of phenol: chloroform: isoamyl alcohol (25:24:1), centrifuge at 12,000 rpm for 5 minutes, transfer the supernatant to a centrifuge tube, and repeat the extraction once to remove the protein. Add another 250 μL of chloroform: isoamyl alcohol (24:1), centrifuge at 12,000 rpm for 5 minutes to remove the residual phenol. Transfer the supernatant to a clean centrifuge tube, add 600 μL of pre-cooled anhydrous ethanol, and centrifuge at 12,000 rpm for 10 minutes to precipitate the DNA. Wash the DNA with 70% ice ethanol to remove salt ions, centrifuge at 12,000 rpm for 5 minutes to precipitate the genomic DNA, and dissolve it in 100 μL of TE after drying.

[0034] 1.2 Knockout of wecA gene by Crisper-Cas9 technology

[0035] (1) Obtaining upstream and downstream homologous recombination fragments of the wecA gene

[0036] First, the sequence of the wecA gene in the NCBI nucleic acid database (GenBank) was searched and compared, and it was found that the wecA gene was located between 2728809 and 2729912 bp in the EcN strain genome. Primers were designed based on the upstream and downstream sequences of the gene and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primer sequences are as follows: WecA-FF (5'-TCCTGCCATACCATTCACA-3'); WecA-FR (5'-CCTGGAGCATTGGACGCCCACTTCGTAGATAACTTCGTCCATT-3'); WecA-RF (5'-TGGACGAAGTTATCTACGAAGTGGGCGTCCAATGCTCC-3'); WecA-RR (5'-CGGTAATGAAGATTCGGCTGT-3'); Using the genome as a template, the polymerase 2xKOD ONE DNA Polymerase (TOYOBO Bio-Technology, CO., LTD) and the primer pair WecA-FF / WecA-FR and primer pair WecA-RF / WecA-RR were used for PCR amplification to obtain the upstream and downstream homologous recombination fragments of the wecA gene, respectively.

[0037] The PCR reaction system is as follows:

[0038]

[0039] Amplification reaction conditions: 98℃ pre-denaturation for 2 minutes, 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute and 30 seconds, 40 cycles, and 72℃ incubation for 5 minutes. Purify the PCR product with a purification kit (AXYPREP PCR cleanup kit). Then connect the upstream and downstream fragments through Overlap PCR reaction to obtain a recombinant DNA fragment with homology arms. The Overlap PCR reaction system is as follows:

[0040]

[0041] (2) Construction of plasmid pEcgRNA-WecA

[0042] First, the N20 sequence was designed based on the knockout target wecA gene. Escherichia coli EcN was selected and the N20 sequence of the wecA gene was retrieved using the CHOPCHOP online tool. Based on their off-target effects and cleavage efficiency, the appropriate N20 sequence was selected to ensure specificity and efficiency, and the restriction endonuclease Bsal cleavage site and protective bases were added and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The sequence of this DNA is as follows, with the N20 sequence underlined: TGAGACC AGACTGCGTAGAAATCGTGG GGTCTCG.

[0043] Secondly, the plasmid pEcg RNA (Addgene, plasmid number #166581) was digested with Bsal to remove the toxic gene ccdB, and the synthetic DNA fragment containing the N20 sequence was also digested.

[0044] The restriction enzyme digestion reaction system of the plasmid is as follows:

[0045]

[0046] The enzyme digestion system of N20 fragment is as follows:

[0047]

[0048] The digested plasmid and N20 fragment were ligated by T4 DNA ligase at 37°C for 3h. The reaction system was as follows:

[0049]

[0050] Finally, the ligation product was transformed into E. coli DH5α heat shock competent cells (TianGen), placed on ice for 30 min, placed at 42°C for 90 s, placed on ice for 2-3 min, and then 1 mL of SOB medium was added, cultured at 200 rpm and 37°C for 1 h, and 200 μL of bacterial solution was taken out and applied to SOB solid medium with 100 μg / mL streptomycin. The plasmid was extracted with a plasmid extraction kit, and the plasmid was identified by PCR and sequencing, and named as plasmid pEcg RNA-WecA.

[0051] The primers were as follows: pEcgRNA-F (5′- CGAACTGAGATACCTACAGCGTGAG -3′), pEcgRNA -R (5′-ATGTTCTCTTGCTTTTGTCAGCAAGAT -3′).

[0052] The structure of the plasmid pEcgRNA-WecA is described as follows: N20 sequence is inserted between the 5'-GGTATAATACTAGTTGAGACC-3' and 5'-GGTCTCGGTTTTAGAGCTAG-3' fragments of the starting vector pEcgRNA. AGACTGCGTAGAAATCGTGG -3' DNA fragment, keeping other sequences of the vector pEcgRNA unchanged to obtain the recombinant vector.

[0053] (3) Transform the plasmid pEcCas (Addgene, plasmid number #73227) into EcN to obtain strain EcN(pEcCas)

[0054] First, prepare EcN electrocompetent cells. Pick a loop of EcN bacteria frozen at -80°C and streak it on SOB solid medium, and culture it in a 37°C incubator for 24 hours. Inoculate a single colony into SOB liquid medium and culture it with aeration for 16 hours. Transfer the culture of the initial culture to 100mL of medium at a ratio of 1:100 and continue to culture for 5-6 hours. When the bacteria grow to OD600 of 0.3-0.4, add 10mM arabinose for induction. When the bacteria grow to OD600 of 0.6-0.8, start making competent cells. Aliquot the 100mL of cultured cells, add 50mL of bacterial solution to each centrifuge tube and centrifuge at 4°C 5000rpm for 10min to collect the bacteria. Then resuspend it with 50mL of pre-cooled sterile water. After centrifugation, remove the supernatant, add 25mL of 20% pre-cooled glycerol solution, respin, centrifuge at 5000rpm for 10min, and repeat this step twice. Remove the supernatant and aliquot 100uL per tube and store at -80°C. Then transform the pEcCas plasmid into the above-mentioned EcN competent cells. Mix 100μL competent cells and 100ng pEcCas plasmid, flick and insert on ice, and use an electroporator (Bio-Rad) for electrotransformation. Immediately after transformation, add 1mL of SOB medium, culture the bacteria at 37°C, 200rpm for 1h, take 100-200μL and spread on a plate containing 100μg / mL kanamycin to select transformants. Use colony PCR to identify whether the colony contains plasmid pEcCas and obtain strain EcN (pEcCas). The primers were as follows: pEc-cas-F-2 (5′-TGAGAATGGCAAAAGCTTATGCATTTCTTTCC -3′), pEc-cas-R-1 (5′-ATGAGTTTGATGATTTCAATAATAGTTTTAATGACCTCCGA -3′).

[0055] (4) Obtaining strain EcN (pEcCas, pEcgRNA-WecA)

[0056] Prepare EcN (pEcCas) into competent cells as shown in step 1.2.3. Then mix 100uL competent cells with 400ng of the recombinant DNA fragment obtained in step 1.2.1 and 100ng of the pEcgRNA-WecA plasmid obtained in step 1.2.2 for electroporation and immediately add to 1mL of SOB medium. After culturing the bacteria for 1h, take 100-200μL and spread it on SOB solid medium containing 100μg / mL kanamycin plate and 100 μg / mL streptomycin to screen transformants. Finally, primers were designed at the upstream and downstream sites of the wecA gene, and the wecA gene knockout mutant was screened by colony PCR to obtain a knockout strain containing two plasmids, named ΔwecA (pEcgRNA-WecA, pEcCas). The primer sequences are as follows: WecA -TEST-F (5'-GACGAACGTCCGGAAGAAGTAACC-3'); WecA -TEST-R (5'-CAGGGTTGGACCAACATTCAGG-3').

[0057] (5) Eliminate pEcgRNA plasmid and pEcCas plasmid

[0058] First, the knockout strain with two plasmids was inoculated into 2 mL of SOB medium containing 10 mM rhamnose and 50 μg / mL kanamycin. The culture was cultured overnight at 200 rpm and 37 ° C for 12 hours, and single colonies were selected and inoculated on plates with 50 μg / mL kanamycin and 50 μg / mL streptomycin, respectively. After 24 hours of culture, the single clones sensitive to streptomycin were strains that eliminated pEcgRNA. Then, the knockout strain with pEcCas plasmid was inoculated into 2 mL of SOB medium containing 5 g / L glucose and 10 g / L sucrose. The culture was cultured overnight at 200 rpm and 37 ° C, and the culture was streaked on a plate of non-resistant SOB solid medium and cultured at 37 ° C for 12 hours. Single colonies were randomly selected and inoculated on 50 μg / mL kanamycin and antibiotic-free plates, respectively. After culturing for 24 h, the single clone that was sensitive to streptomycin was the strain that eliminated pEcCas, and finally the knockout strain EcNΔwecA without plasmid was obtained.

[0059] 2. Knockout of the waaL gene by Crisper-Cas9 technology to obtain the mutant strain EcNΔwecAΔwaaL

[0060] 2.1 Obtaining upstream and downstream homologous recombination fragments of the waaL gene

[0061] First, the sequence of the waaL gene in the NCBI nucleic acid database (GenBank) was searched and compared, and it was found that the waaL gene was located between 2538602 and 2539852 bp in the EcN strain genome. The primers were designed according to the upstream and downstream sequences of the gene as follows: WaaL-FF (5'-AAAATCATGGATGTCTGAGTTACAATAATAATTAAGGATGAGTA -3'); WaaL-FR (5'-TCTCTTTATCCCCTTTCCTTATGC -3'); WaaL-FR (5'-TAGCATAGGTTGAAATTATTAATGAATATGTGAAATAAAATCAGCA -3'); WaaL-RF (5'-CAATCCCAGGGATTAAGTTTGACTGGGT -3'). The genome of ΔwecA was used as a template for PCR amplification, and the upstream and downstream homologous recombination fragments of the waaL gene were obtained using primer pair WaaL-FF / WaaL-FR and primer pair WaaL-RF / WaaL-RR, respectively.

[0062] The PCR reaction system is as follows:

[0063]

[0064] 2xKOD ONE DNA Polymerase PCR amplification reaction conditions: 98℃ pre-denaturation for 2 minutes, 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute and 30 seconds, 40 cycles, 72℃ incubation for 5 minutes. Primer synthesis company: Shanghai Sangon Biotechnology Co., Ltd. PCR products were purified using a purification kit (AXYPREP PCR cleanup kit). The upstream and downstream fragments were then connected through Overlap PCR reaction to obtain a recombinant fragment with homology arms. The Overlap PCR reaction system is as follows:

[0065]

[0066] 2.2 Construction of plasmid pEcgRNA-WaaL

[0067] First, the N20 sequence was designed based on the knockout target waaL gene.

[0068] E. coli EcN was selected and the N20 sequence of the waaL gene was searched using the CHOPCHOP online tool. Based on their off-target effects and cleavage efficiency, appropriate N20 sequences were selected to ensure specificity and efficiency, and then synthesized by Shanghai Bioengineering Company after adding restriction endonuclease Bsal cleavage sites and protective bases. The sequence is as follows, where the N20 sequence is underlined: TGAGACC CCGTGTTGCATTATCAGCTT GGTCTCG.

[0069] Secondly, the plasmid pEcgRNA was digested by Bsal to remove the toxic gene ccdB, and the synthesized DNA fragment containing the N20 sequence was digested at the same time. The digestion reaction system is as follows:

[0070]

[0071] The N20 fragment reaction system is as follows:

[0072]

[0073] The digested plasmid and N20 fragment were connected by T4 DNA ligase. The reaction system was as follows:

[0074]

[0075] The ligation product was transformed into E. coli DH5α heat shock competent cells. The transformation method was as described above. The plasmid was extracted using a plasmid extraction kit (TIANGEN). The plasmid was identified by PCR and sequencing and named plasmid pEcgRNA-WaaL. The primers are as follows: pEcgRNA-F (5'- CGAACTGAGATACCTACAGCGTGAG -3'), pEcgRNA -R (5'-ATGTTCTCTTGCTTTTGTCAGCAAGAT -3').

[0076] The structure of the plasmid pEcg RNA-WaaL is described as follows: N20 sequence 5'-GGTATAATACTAGTTGAGACC -3' and 5'-GGTCTCGGTTTTAGAGCTAG-3' fragments of the starting vector pEcgRNA are inserted between CCGTGTTGCATTATCAGCTT -3' DNA fragment, keeping other sequences of the vector pEcgRNA unchanged to obtain the recombinant vector.

[0077] 2.3 Preparation of strain EcNΔwecA (pEcCas) into competent cells

[0078] Prepare electrocompetent cells of EcNΔwecA (pEcCas) as described in step 1.1.

[0079] 2.4 Obtaining strain EcNΔwecAΔwaaL

[0080] 100 μL of the competent cells, 400 ng of the recombinant DNA fragment obtained in step 2.2.1, and 100 ng of the pEcgRNA-WaaL plasmid obtained in step 2.2.2 were mixed, and transformed by electroporation. Transformants were screened on SOB solid medium containing 100 μg / mL kanamycin and 100 μg / mL streptomycin. Finally, primers were designed at the upstream and downstream sites of the waaL gene, and the waaL gene knockout mutants were screened by colony PCR to obtain a knockout strain containing two plasmids, named EcNΔwecAΔwaaL (pEcgRNA-wecA, pEcCas). The primers are as follows: WaaL-TEST-F (5'-ATGGCGGTGTTTCGTCTGC-3'), WaaL-TEST-R (5'-AGCGAGTTATTCCTGTGGC-3').

[0081] Finally, the two plasmids were eliminated according to the method described in step 1.2 to obtain the strain EcNΔwecAΔwaaL.

[0082] (5) Obtaining strain EcNΔwaaL

[0083] Prepare electrocompetent cells of EcN (pEcCas) according to the method described in step 1.1. Mix 100 μL of competent cells with 400 ng of recombinant DNA fragments obtained in step 2.2.1 and 100 ng of pEcgRNA-WaaL plasmid obtained in step 2.2.2, perform electrotransformation according to the method described in step 2.1.4, screen and identify transformants, obtain EcNΔwaaL (pEcgRNA-wecA, pEcCas) strains, and finally eliminate the two plasmids according to the method described in step 1.2 to obtain strain EcNΔwaaL.

[0084] 3. Identify lipopolysaccharide (LPS) of different knockout strains and further verify gene knockout by verifying phenotypic changes

[0085] 3.1 Extraction of LPS.

[0086] Inoculate the bacteria in 2 mL SOB medium and culture overnight at 37°C. The next day, transfer to a 100 mL shake flask. When the OD600 grows to between 0.6 and 1.0, extract LPS and collect the bacteria by centrifugation at 6000 rpm for 10 minutes. Resuspend the bacteria in 10 mL, 30 mM Tris-HCl buffer (pH 8.1) and centrifuge at 5000 rpm at 4°C for 10 minutes. Repeat once to wash the bacteria. Resuspend the bacteria in 5 mL 30 mM Tris buffer containing 20% ​​sucrose. Add 50 μL lysozyme at a concentration of 1 mg / mL and act at room temperature for 30 minutes. Transfer the centrifuge tube to a -70°C refrigerator, freeze the cells for 30 minutes, thaw at room temperature, and repeat 4 times to lyse the cells. Add 3-5 mL 5 mM EDTA (pH 7.3) and shake to mix. Transfer the solution to a pre-cooled 50 mL centrifuge tube. Ultrasonicate on ice to disrupt the cells. Centrifuge at 8000 rpm and 4°C for 30 minutes, transfer the supernatant to another centrifuge tube, centrifuge at 18000 rpm and 4°C for 60 minutes, remove the supernatant, and freeze-dry the lower precipitate sample to obtain crude LPS.

[0087] 3.2 Electrophoresis and silver staining of LPS

[0088] The crude LPS was freeze-dried and resuspended in a solution containing 20mM Tris-HCl and 0.2% SDS, and protein contaminants were removed by proteinase K at 56°C for 1h. 2xDS Sample buffer was added to boil the sample before loading, and electrophoresis was performed at 50mA for 3h. The gel after electrophoresis was immersed in 200mL of fixative solution (150mL ethanol, 50mL glacial acetic acid, 3.5g periodic acid, and water was added to 500mL) for 1h and then washed with ddH2O for 10min each time, for a total of three washes. After staining with staining solution (0.25g silver nitrate, water was added to 250mL) for 30min, it was washed three times with ddH2O for 10s each time. The gel was developed with pre-cooled colorimetric solution (6 g sodium carbonate, 108 μL formaldehyde (37%-40%) to 200 mL) for about 4 min, the reaction was terminated with 1% acetic acid, and the sample was washed with ddH2O. Figure 3 As shown. Silver staining results showed that the LPS of the wild strain was a semi-rough LPS, the O-antigen had only one oligosaccharide unit, and its LPS showed two bands. The EcNΔwecA strain could not synthesize the O-antigen; the EcNΔwaaL strain could synthesize the O-antigen, but the O-antigen could not be connected to the lipid A-core oligosaccharide; and the EcNΔwecAΔwaaL strain could neither synthesize the O-antigen nor connect the polysaccharide to the lipid A-core oligosaccharide. Therefore, these mutant strains could not produce complete LPS, and the electrophoresis diagram showed one band, which was the lipid A-core oligosaccharide ( Figure 3). The silver staining results of LPS further showed that we obtained the correct mutant strain.

[0089] 2. Construction of an expression plasmid carrying the gene cluster for the synthesis of streptococcal capsular polysaccharide

[0090] The capsular polysaccharide structures of pneumococcal vaccines serotypes 14 and 23F are complex and have branched structures. The capsular polysaccharide of serotype 14 is a neutral polysaccharide, and the capsular polysaccharide of serotype 23F is an acidic polysaccharide with a negative charge. The genes that synthesize the capsular polysaccharide of pneumococcus are clustered at the same site on the genome (called cps locus), and their gene clusters are composed of Figure 4 shown.

[0091] 1. Extraction of the S. pneumoniae genome

[0092] The genome of Streptococcus was extracted using Wizard genome extraction kit (Promega). The bacteria were inoculated in 10 mL of BHI medium (OXIDE) and cultured overnight until OD600 = 0.4-0.6. The bacteria were collected by centrifugation at 6000 rpm for 5 min and washed twice with 50 mM EDTA buffer. Resuspended in 480 μL 50 mM EDTA buffer, 6 μL 100 mg / ml lysozyme (Sigma), 50 μL 10 unit / μL mutanolysin (Sigma), and incubated at 37°C for 1 h. Centrifuged at 12000 rpm for 1 min, added 600 μL Nuclei Lysis Solution, and incubated at 80°C for 5 min. After cooling to room temperature, 5 μL RNase was added and incubated at 37°C for 1 h. Add 200 μL Protein Precipitation Solution, vortex to mix, and centrifuge at 13100 rpm for 10 min. Transfer the supernatant to a new tube, add 600 μL of isopropanol, vortex to mix, centrifuge at 13000 rpm for 10 min to precipitate genomic DNA, add 600 μL of 70% ethanol solution to wash the DNA, and centrifuge at 13000 rpm for 10 min to precipitate the DNA. After drying the DNA at room temperature, add 100 μL of DNA Rehydration Solution buffer to dissolve the genomic DNA.

[0093] 2. Construction of expression plasmid containing capsular polysaccharide gene cluster

[0094] (1) Obtaining gene clusters related to capsular polysaccharide synthesis

[0095] In this study, Long PCR was performed using the genome as a template to obtain the corresponding gene cluster fragments. The electrophoresis results of the PCR products are shown in Figure 5As shown. The Long PCR reaction product was recovered using an agarose gel recovery kit. The primers used in the Long PCR reaction are as follows:

[0096] CPS14-F (5'-GTATCACCAAACCCTACAGCC-3');

[0097] CPS14-R (5'-TCCTCTACCACCAAAGTTATCAA-3');

[0098] CPS23F-F (5'-CATTGTCCTACCTCTCACC-3');

[0099] CPS23F-R (5'-TTCATATTATCTGCCTCTTTTA-3').

[0100] The Long PCR reaction system is as follows:

[0101]

[0102] Long PCR reaction conditions: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 68°C for 2 min, repeated 35 cycles, incubation at 68°C for 10 min, and 4°C.

[0103] (2) Linearization of vector

[0104] Design primer pairs 14-pBBR1-F / 14-pBBR1-R with homology arms of capsular polysaccharide gene cluster CPS14 and primer pairs 23F-pBBR1-F / 23F-pBBR1-R with homology arms of capsular polysaccharide gene cluster CPS23F, respectively, and use vector pBBR1-MCS-3 (NovoPro, catalog number V012161) as templates for circular PCR to obtain linearized PCR products, which are then excised and purified to obtain linearized vectors with homology arms of gene clusters. The primers used are as follows, where the underlined sequences are polysaccharide gene cluster homology arm sequences. 14-pBBR1-F: TTGATAACTTTGGTGGTAGAGGA ATCAAGCTTATCGATACCGTCGAC. 14-pBBR1-R: GGCTGTAGGGTTTGGTGATAC TCCACTAGTTCTAGAGCGGCC. 23F-pBBR1-F: GACG GTGAGAGGTAGAGACAATG CGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTG. 23F-pBBR1-R: TAATAA AAGAGGCAGATAATGAAACCGCGGTGGAGCTCCAATTCGCCCTAT

[0105] The PCR reaction system is as follows:

[0106]

[0107] PCR reaction conditions: reaction conditions, 98°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 60°C annealing for 30 s, 68°C extension for 1 min, repeated 35 cycles, 68°C incubation for 10 min, 4°C cycling.

[0108] (3) One-step cloning method to construct recombinant plasmid

[0109] The concentration of the recovered PCR product was determined, and the linearized vector and the Long PCR gene cluster fragment were connected using a one-step cloning kit (Novozyme). The connection reaction system was reacted at 50°C for 15 minutes.

[0110] The ligation reaction system is as follows:

[0111]

[0112] (4) Obtaining recombinant plasmid

[0113] The above ligation product was transformed into E. coli DH10B heat shock competent cells. On ice for 30 min, 42°C for 90s, on ice for 2-3 min, then 1 mL of SOB medium was added, cultured at 37°C for 1 h, 200 μL of bacteria was spread on SOB solid medium containing 20 μg / mL tetracycline, and cultured at 30°C for 24 h.

[0114] Positive transformants were identified by conventional colony PCR using the following primers (eg Figure 5 and confirmed by sequencing.

[0115] Primers were as follows: cps14-test-1-F (5′-AAGTGAGCAAAGAAAAGAAGCC-3′). cps14-test-1-R (5′-CCCTGAAACCAACAAATCCA-3′). cps23F-test-1-F (5′-TTTTTGGTCTATCATCCTGCC-3′). cps23F-test-1-R (5′-AATGGTTTACTATGCTTTGC-3′).

[0116] Finally, plasmid pCPS14 expressing capsular polysaccharide of Streptococcus pneumoniae serotype 14 and plasmid pCPS23F expressing capsular polysaccharide of Streptococcus pneumoniae serotype 23F were obtained. The plasmid maps are shown in Figure 6 and Figure 7 The base sequence of the plasmid pCPS14 is shown in SEQ ID NO.1 in the sequence list. The base sequence of the plasmid pCPS23F is shown in SEQ ID NO.2 in the sequence list.

[0117] 3. Expression of Capsular Polysaccharide of Streptococcus pneumoniae in Escherichia coli Chassis Strains

[0118] 1. Transform the capsular polysaccharide expression plasmid into the chassis strain

[0119] The strains EcN, EcNΔwecA, and EcNΔwecAΔwaaL were prepared into electroporation competent cells according to the method described in 1.3, and the capsular polysaccharide expression plasmids pCPS14 and pCPS23F were transformed into the three competent cells. The strains carrying the capsular polysaccharide expression plasmids were screened by SOB solid medium with 50 μg / mL tetracycline to obtain strains carrying the capsular polysaccharide expression plasmids.

[0120] 2. Inducing plasmid expression of synthetic capsular polysaccharide

[0121] First, the strain with the plasmid was inoculated into 10 mL of SOB medium containing 50 μg / mL tetracycline, cultured overnight at 37°C, and transferred to 1 L of SOB medium containing 50 μg / mL tetracycline the next day. When the growth reached OD600 of 0.03, 1 mM IPTG and 4 mM MnCl2 were added to induce the bacteria at 28°C for 24 h, and the bacteria were collected by centrifugation at 6000 rpm for 10 minutes. The wet weight of the bacteria was weighed for subsequent calculation of the yield. The bacteria were resuspended in 200 mL, 30 mM Tris-HCl buffer (pH = 8.1), and centrifuged at 5500 rpm for 10 minutes to collect the bacteria. Repeat once to wash the bacteria. Then, the bacteria were resuspended in 30 mL of 30 mM Tris-HCl buffer (pH = 8.1) containing 20% ​​sucrose, 1 mg / mL lysozyme was added, and incubated on ice for 30 minutes. Place the centrifuge tube in a -70℃ freezer to freeze the cells for 30 minutes, then thaw at room temperature, repeat 4-5 times to break the cells. Then add 6mL 5mM EDTA (pH 7.3), vortex to mix, and use an ultrasonic disruptor on ice to break the bacteria until the solution is clear, centrifuge at 4℃, 8000rpm for 60 minutes, carefully transfer the supernatant to a centrifuge tube, and freeze-dry to obtain capsular polysaccharide.

[0122] 4. Detection of Capsular Polysaccharide Expression

[0123] 1. Identify the production of capsular polysaccharides by isolating and electrophoresing capsular polysaccharides from bacteria and immunoblotting with specific antibodies

[0124] (1) Electrophoresis of capsular polysaccharides by SDS-PAGE

[0125] Dissolve the capsular polysaccharide sample in 1mL of ddH2O, take out 100μL of the sample, add 10μL of proteinase K (20mg / mL) at 56°C for 1h to remove impurities, add 2x SDS Sample Buffer (Biyuntian), boil in a 100°C water bath for 5min for loading. Use the Gel Rapid Preparation Kit (Shanghai Yazyme Company) to prepare 12% SDS-PAGE separation gel and 5% stacking gel; take 10μL of the treated sample and load it, electrophoresed at 80 V. When the sample is separated from the stacking gel, change the voltage to 120 V and continue electrophoresis until the bromophenol blue in the protein standard (Aikerui Protein Marker) is electrophoresed to the bottom of the gel plate, and turn off the power.

[0126] (2) Identification of capsular polysaccharides by Western Blotting

[0127] Antisera to serotype 14 and antisera to serotype 23F were purchased from the Danish Serology Institute (Statens SerumInstitut, SSI). First, antisera specific to capsular polysaccharides were obtained. The wild-type EcN strain was cultured overnight in 50 mL SOB until OD600 was 0.6-0.8, and the bacteria were collected by centrifugation, washed once with 10 mL PBS, and the bacterial pellet was resuspended in 2 mL 1xPBS. 8 μL of antisera was mixed with 280 μL of bacterial suspension and 8 mL of PBS containing 1% (wt / vol) BSA and incubated overnight at 4°C. After centrifugation, antisera specific to serotype 14 capsular polysaccharide and antisera specific to serotype 23F capsular polysaccharide were obtained, respectively.

[0128] The above SDS-PAGE gel was placed in a wet transfer apparatus (Bio-Rad), and the membrane was transferred at 400 mA for 180 minutes. The polysaccharide was transferred to the PVDF membrane and blocked in 7% skim milk powder at room temperature for 2 hours. Then, antiserum specific to the capsular polysaccharide was added at a dilution of 1:1000, and incubated at 4°C overnight. The membrane was washed 3 times with PBST (1xPBS buffer containing 0.1% Tween), 10 minutes each time; then the membrane was covered with 7% skim milk powder, and a 1:5000 dilution of horseradish peroxidase-labeled goat anti-rabbit antibody (MedChemExpress) was added, and incubated at room temperature for 2 hours. The membrane was washed again with PBST 3 times, 10 minutes each time, and a developer was used, and HRP luminescence was used for color development.

[0129] The results of polysaccharide immunoblotting showed that no capsular polysaccharide was synthesized in strains containing the empty plasmid pBBR1-MCS-3, while strains containing the polysaccharide expression plasmid produced the corresponding capsular polysaccharide of Streptococcus pneumoniae. Moreover, the capsular polysaccharides synthesized in E. coli EcN and its mutants had more macromolecular bands, indicating that these capsular polysaccharides were much longer than the sugar chains of the capsular polysaccharides produced by Streptococcus pneumoniae itself, and also indicated that the regulatory proteins regulating the synthesis of O-antigen polysaccharides in E. coli EcN can also regulate the synthesis of capsular polysaccharides of Streptococcus pneumoniae and produce longer polysaccharide chains.

[0130] Among them, the capsular polysaccharides produced by strains EcN (pCPS14), EcN (pCPS23F) and strains EcNΔwecA (pCPS14), EcNΔwecA (pCPS23F) are all located on the surface of E. coli, and these capsular polysaccharides are transferred to lipid A-core oligosaccharides by ligase WaaL. The capsular polysaccharides produced by strains EcNΔwecAΔwaaL (pCPS14) and EcNΔwecAΔwaaL (pCPS23F) cannot be transferred to lipid A-core oligosaccharides and can only be located in the periplasmic region of E. coli cells. In short, the engineered strains using E. coli EcN are able to synthesize longer pneumococcal capsular polysaccharides.

[0131] 2. Observation of capsular polysaccharide production by labeling bacteria using immunofluorescence

[0132] The induced E. coli was washed with TBST (1xTBS buffer containing 0.1% Tween 20), and then resuspended in TBST containing 1% bovine serum albumin. The specific antiserum of the corresponding polysaccharide was added at a ratio of 1:1000 and incubated at 4°C for 2 hours. Wash with TBST three times to remove unbound antibodies. Then, green fluorescent FITC-labeled goat anti-rabbit IgG antibody (Thermo Fisher) was added at a ratio of 1:1000 and incubated for 2 hours. Wash the bacteria three times with TBST. Fluorescently labeled bacteria were added dropwise on a glass slide, and a fluorescence quencher was added at the same time. After sealing, the slide was observed under a fluorescence microscope. The results are shown as follows. Fig. 9 shown.

[0133] The results showed that none of the bacteria containing the empty plasmid pBBR1-MCS-3 emitted green fluorescence, while the bacteria containing the gene cluster expression plasmid all emitted green fluorescence. The fluorescence emitted by strain EcN and the gene knockout strain EcNΔwecA originated from the capsular polysaccharide on the lipid A-core oligosaccharide on the bacterial surface, while the fluorescence emitted by strain EcNΔwecAΔwaaL originated from the capsular polysaccharide in the periplasmic region of the bacteria. This result once again proves that the capsular polysaccharide of Streptococcus pneumoniae is expressed in the engineered strain of E. coli.

[0134] 3. Detection of the expression of capsular polysaccharide by ELISA

[0135] Detect the capsular polysaccharide (CPS) content on the bacteria: dilute the induced bacteria in 10 mL SOB to OD600 = 0.3-0.4 (about 5x10 9 CFU / mL), 1 mL of bacterial solution was centrifuged at 16100 × g for 1 min at room temperature to collect cells. The cells were resuspended in an equal volume of 1xPBS, 10 μL of proteinase K (Qiagen) was added, and incubated at 56°C for 1 hour. The supernatant was removed by centrifugation, and the cells were resuspended in 1 mL of 50 mM carbonate / bicarbonate buffer (Sigma). 200 μL of the suspension was added to an ELISA plate (Thermo Fisher), and a serial dilution of the capsular polysaccharide standard CPS14 or CPS23F (SSI diagnostics) was used as an internal standard, and incubated at 4°C overnight. The ELISA plate was washed with 1xPBS and incubated in PBS containing 1% (wt / vol) BSA at room temperature for 1 hour; the wells were washed four times with PBST, and the corresponding specific antiserum was added at 1:1000, incubated at room temperature for 1 hour, and washed four times with PBST. 1% (wt / vol) BSA in 1xPBS was added to the wells, and then goat anti-rabbit HRP antibody (Thermo Fisher) was added at a ratio of 1:10000 and incubated for 1 hour. After washing four times with PBST, o-phenylenediamine dihydrochloride (OPD) substrate (Sigma) was added for color development. The absorbance value at OD450nm was obtained using a microplate reader, and the absorbance value of Escherichia coli was calculated using the regression equation fitted by the capsular polysaccharide standard to obtain the amount of capsular polysaccharide produced by Escherichia coli.

[0136] The results showed that the capsular polysaccharide synthesized in the E. coli EcNΔwecAΔwaaL strain was the largest, followed by the E. coli EcNΔwecA strain, and the least capsular polysaccharide synthesized in the wild strain EcN.

[0137] The amount of capsular polysaccharide CPS23F synthesized by the EcNΔwecAΔwaaL strain was almost twice that of CPS23F synthesized by the wild-type strain EcN. Moreover, the amount of capsular polysaccharide synthesized by the chassis strain was higher than that produced by S. pneumoniae itself.

[0138] The ELISA method was used to quantitatively detect the production of capsular polysaccharides. A standard curve and a formula were obtained based on the capsular polysaccharides of Streptococcus pneumoniae, and the amount of capsular polysaccharides produced by different strains was calculated according to the formula.

[0139] The production of capsular polysaccharide CPS14 of different strains, among which the production of capsular polysaccharide of Streptococcus pneumoniae serotype 14 was used as a control. Among 1000 bacteria, the production of capsular polysaccharide of serotype 14 (S.P14) was 38.3pg / mL; the production of capsular polysaccharide of E. coli EcN (pCPS14) was 75.9pg / mL; the production of capsular polysaccharide of E. coli EcNΔwecA (pCPS14) was 103.5pg / mL; the production of capsular polysaccharide of E. coli EcNΔwecAΔwaaL (pCPS14) was 94.0pg / mL.

[0140] The production of capsular polysaccharide CPS23F of different strains, among which the production of capsular polysaccharide of Streptococcus pneumoniae serotype 23F was used as a control. Among 1000 bacteria, the production of capsular polysaccharide CPS23F of serotype 23F (S.P23F) was 17.3pg / mL; the production of capsular polysaccharide CPS23F of E. coli EcN (pCPS23F) was 16.9pg / mL; the production of capsular polysaccharide CPS23F of E. coli EcNΔwecA (pCPS23F) was 20.5pg / mL; the production of capsular polysaccharide CPS23F of E. coli EcNΔwecAΔwaaL (pCPS23F) was 45.5pg / mL.

[0141] Each biological sample was repeated 3 times, and the data are expressed as mean values, and the error value represents the standard error. The significance was analyzed and compared by Kruskal-Wallis and Dunn's test. *p < 0.05, **p < 0.001, ***p < 0.0005, ns indicates no significant difference.

Claims

1. An Escherichia coli probiotic EcN engineered strain, characterized in that: Compared with the starting strain, the gene wecA was knocked out; The strain is Escherichia coli Nissle1917.

2. The Escherichia coli probiotic EcN engineered strain according to claim 1, characterized in that: The gene waaL was also knocked out.

3. The Escherichia coli probiotic EcN engineered strain according to any one of claims 1 to 2, characterized in that: With plasmid pCPS14; The base sequence of the plasmid pCPS14 is shown in SEQ ID NO.1 in the sequence listing.

4. The Escherichia coli probiotic EcN engineered strain according to any one of claims 1 to 2, characterized in that: With plasmid pCPS23F; The base sequence of the plasmid pCPS23F is shown in SEQ ID NO.2 in the sequence listing.

5. Use of the Escherichia coli probiotic EcN engineered strain according to claim 3 in the preparation of capsular polysaccharides.

6. Use of the probiotic E. coli EcN engineered strain according to claim 5 in the preparation of capsular polysaccharides, characterized in that: The capsular polysaccharide is the capsular polysaccharide of Streptococcus pneumoniae.

7. Use of the probiotic E. coli EcN engineered strain according to claim 4 in preparing capsular polysaccharides.

8. Use of the probiotic E. coli EcN engineered strain according to claim 7 in preparing capsular polysaccharides, characterized in that: The capsular polysaccharide is the capsular polysaccharide of Streptococcus pneumoniae.

Images