Nano-carrier-based dsRNA biopesticide preparation as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of agriculture, discloses a dsRNA biopesticide preparation based on a nano-carrier and a preparation method and application of the dsRNA biopesticide preparation, and particularly discloses a nano-composite which comprises the nano-carrier and dsRNA, the dsRNA is loaded on the nano-carrier, and the dsRNA targets a chitin synthetase gene (CHS) or a v-type proton ATPase subunit B gene (V-ATPaseB). The invention provides a nano-composite containing dsRNA of a targeted CHS gene or V-ATPaseB gene, and the nano-composite is used as a novel biological pesticide preparation and has a good pest control effect and a good plant leaf protection effect. The nano-carrier used by the nano-composite can effectively deliver dsRNA, so that the dsRNA is prevented from being degraded in pest bodies, and the delivery efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of agriculture, and in particular relates to a dsRNA biological pesticide preparation based on a nanocarrier, and a preparation method and application thereof. Background Art

[0002] At present, pests are mainly controlled by chemical pesticides. However, the use of pesticides has also brought a series of problems, including environmental pollution, increased pest resistance, and impacts on non-target organisms. The long-term use of chemical pesticides leads to soil and water pollution, affects the balance of the ecosystem, and endangers human health. In addition, the increased resistance of pests to chemical pesticides has led to a gradual decline in the control effect, requiring the continuous increase in the amount of pesticides used, forming a vicious cycle. Therefore, it is necessary to seek new green and efficient pest control strategies.

[0003] RNA biological pesticide preparations use the principle of RNA interference (RNAi) to silence key genes in pests, inhibit the expression of important functional genes, cause the development of harmful organisms to stagnate or die, and achieve pest control. As a new type of pest control technology, RNAi technology has the following advantages in pest control: first, its high specificity and biosafety can achieve precise control; second, it is easy to operate and has a short cycle, saving manpower and time; third, it has strong targeting and has little effect on non-target organisms. dsRNA is easy to degrade and is not easy to produce resistance. It has high environmental and ecological safety and is suitable for large-scale field application. dsRNA biological pesticide preparations have a strong application prospect.

[0004] However, RNAi is limited in pest control by the efficiency and stability of double-stranded RNA (dsRNA) delivery, which seriously restricts the commercial use of dsRNA biopesticide preparations. dsRNA is extremely unstable in its natural state. A single dsRNA is completely degraded within 48 hours in soil and water environments, and its stability is easily affected by factors such as nucleases, precipitation, ultraviolet radiation, and microbial activity. Although the current spray-based dsRNA delivery method effectively avoids degradation by nucleases in the insect midgut, dsRNA is unstable in the environment and easily decomposed. RNAi pest control requires reliable dsRNA delivery technology and effective target genes. Therefore, it is urgent to develop a reliable dsRNA delivery technology to solve the above-mentioned problems in the use of dsRNA for pest control. Summary of the invention

[0005] In order to provide a method that can enhance the RNA interference efficiency of pest lethal genes, improve the dsRNA delivery efficiency and stability, and improve the pest control effect, the present invention aims to develop a dsRNA biopesticide preparation based on nanocarriers.

[0006] The first aspect of the present invention aims to provide a nanocomposite.

[0007] The second aspect of the present invention aims to provide a method for preparing the nanocomposite of the first aspect of the present invention.

[0008] The third aspect of the present invention aims to provide the use of the nanocomposite of the first aspect of the present invention in controlling pests or preparing products for controlling pests.

[0009] The fourth aspect of the present invention aims to provide a product.

[0010] The fifth aspect of the present invention aims to provide a method for controlling pests / protecting plant leaves.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is:

[0012] RNAi achieves sustainable control of pests by interfering with the expression of key genes for insect growth and development. Based on this, the inventors creatively proved that the chitin synthase gene (CHS) or the v-type proton ATPase subunit B gene (V-ATPaseB) are potential gene targets, and silenced the CHS and V-ATPaseB genes through RNAi technology, thereby improving the control effect of fall armyworm.

[0013] In a first aspect, the present invention provides a nanocomplex comprising a nanocarrier and dsRNA, wherein the dsRNA is loaded on the nanocarrier and targets a chitin synthase gene (CHS) or a v-type proton ATPase subunit B gene (V-ATPaseB).

[0014] In some embodiments of the present invention, the nucleotide sequence of the chitin synthase gene (CHS) is shown as SEQ ID NO:11, and the nucleotide sequence of the v-type proton ATPase subunit B gene (V-ATPaseB) is shown as SEQ ID NO:12.

[0015] In some embodiments of the present invention, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:14 or SEQ ID NO:15.

[0016] In some embodiments of the present invention, the nanocarrier comprises a polymer nanocomposite material of a zeolite imidazolate framework.

[0017] In some embodiments of the present invention, the nanocarrier is ZIF@polydopamine.

[0018] In some embodiments of the present invention, the nanocarrier is ZIF-8@polydopamine (ZIF-8@PDA).

[0019] The present invention develops a reliable carrier to break through the bottleneck of dsRNA delivery of fall armyworm, selects genes encoding CHS and V-ATPaseB as target genes, constructs an easily synthesized ZIF-8@polydopamine (ZIF-8@PDA) as a low-cost dsRNA nanocarrier, and the dsRNA loaded on the ZIF-8@PDA can be protected from degradation by external nucleases, has good biocompatibility and adhesion ability, and has enhanced stability. It can deliver dsRNA, can effectively increase the uptake and intracellular transport of dsRNA by insect cells, improves the target gene silencing efficiency, thereby inhibiting the growth of pests, activates endocytosis and macrophage phagocytosis pathways, improves the delivery efficiency, has a significant effect on the control of lepidopteran pests, and greatly reduces the cost of using dsRNA in the field.

[0020] Based on the characteristics of nanocarrier ZIF-8@PDA material with porous structure and large specific surface area, it has high adsorption properties and provides abundant binding sites for drug molecules (such as dsRNA / pesticides), which can enhance the stability of dsRNA, activate its endocytosis and phagosome pathway, and improve transport efficiency.

[0021] Nanocarrier ZIF-8@PDA can not only enhance the sustained-release properties of biological pesticide preparations, but also enhance the adhesion strength, increase the retention time of nanocarrier composite pesticides on plant leaves, and improve the utilization rate of pesticides and fertilizers.

[0022] The second aspect of the present invention provides a method for preparing the nanocomplex of the first aspect of the present invention, comprising the following steps: mixing ZIF@polydopamine and dsRNA, and reacting them to obtain the nanocomplex.

[0023] In some embodiments of the present invention, when ZIF@polydopamine is an unfinished product, the method for preparing the nanocomplex comprises the following steps: mixing dsRNA with Zn(NO3)2 and 2-methylimidazole, reacting at 700-900 rpm for 15-25 min, separating the solid and the liquid, mixing the precipitate with dopamine, and reacting at 700-900 rpm for 4-6 hours to obtain a nanocomplex.

[0024] The nanocomposites prepared using the finished or unfinished ZIF@polydopamine had similar effects.

[0025] The third aspect of the present invention provides use of the nanocomposite according to the first aspect of the present invention in controlling pests or preparing products for controlling pests.

[0026] In some embodiments of the present invention, the nanocomplex achieves the purpose of controlling pests by inhibiting the development of pests and / or promoting the death of pests.

[0027] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0028] In some embodiments of the present invention, the pests include at least one of the fall armyworm, fall armyworm, beet armyworm, cotton leafworm, armyworm, corn armyworm, cotton bollworm, tobacco hornworm, diamondback moth, cabbage looper, grape leafroller, wheat moth, and soybean armyworm.

[0029] In some embodiments of the present invention, the pest is fall armyworm.

[0030] In some embodiments of the invention, the product comprises a biopesticide formulation (eg, insecticide).

[0031] A fourth aspect of the present invention provides a product, wherein the product comprises the nanocomposite according to the first aspect of the present invention.

[0032] In some embodiments of the present invention, the product further comprises Serratia marcescens.

[0033] The nanocarrier-based dsRNA biopesticide formulation uses the nanocarrier ZIF-8@PDA as the core, loaded with dsRNA (dsCHS or / and dsV-ATPaseB), and then mixed with Serratia marcescens. ZIF-8@PDA can enhance the abundance of Serratia marcescens bacteria in the intestines of fall armyworms, inhibit the insect ROS immunity level, and thus increase the lethality of RNAi. In addition, pest populations infected with Serratia marcescens can enhance the plant's anti-insect immune response against herbivorous insects, induce enhanced activity of plant anti-insect defense enzymes (such as polyphenol oxidase PPO, etc.), thereby producing phytochemicals that enhance damage to herbivorous pests and weaken the ecological adaptability of pests.

[0034] In some embodiments of the invention, the product comprises a biopesticide formulation (eg, insecticide).

[0035] In some embodiments of the present invention, the product can be prepared into conventional dosage forms for use, such as dry powder, wettable powder, emulsifiable concentrate, microemulsion, paste, granules or suspensions.

[0036] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrators, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculating agents, filter aids, release retardants, and carriers. These excipients can be diluents (such as starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol and microcrystalline cellulose), absorbents (such as calcium sulfate, calcium hydrogen phosphate, light magnesium oxide and calcium carbonate), wetting agents (such as water and ethanol), binders (such as hydroxypropyl methylcellulose, povidone, starch slurry and syrup), disintegrants (such as dry starch, sodium hydroxymethyl starch, low-substituted hydroxypropyl cellulose, effervescent disintegrants and cross-linked polyvinylpyrrolidone), lubricants (magnesium stearate, talc, hydrogenated vegetable oil, polyethylene glycol and micropowder silica gel, etc.), colorants (such as titanium dioxide, sunset yellow, methylene blue and medicinal iron oxide, etc.), coating materials (such as acrylic resin, hydroxypropyl methylcellulose and povidone, etc.), solvents (such as water for injection, ethanol, propylene glycol and glycerol, etc.), acid-base regulators (such as hydrochloric acid, lactic acid, sodium hydroxide, tartaric acid and sodium tartrate, etc.), antioxidants (such as sodium sulfite, sodium pyrosulfite and sodium thiosulfate, etc.), antibacterial agents (such as phenol, benzyl alcohol and thimerosal, etc.), and isotonic regulators (such as sodium chloride and glucose, etc.).

[0037] Spraying products containing nanocomplexes (biopesticide preparations) interferes with pest growth and binds to Serratia marcescens (OD 600 =0.1~0.5) for comprehensive spraying to enhance the defense ability of plants, so that Serratia marcescens can infect pests and increase the mortality rate of biological pesticide preparations to pests.

[0038] The fifth aspect of the present invention provides a method for controlling pests or protecting plant leaves, comprising the step of applying the nanocomposite of the first aspect of the present invention or the product of the fourth aspect of the present invention to pests or pest habitats.

[0039] In some embodiments of the invention, the method comprises treating pests, pest food (such as corn or rice leaves), pest habitat (soil, area, material or environment where pests are growing or can grow, or materials, cultivated plants, plant propagation materials (such as seeds), soil, surface or space to be protected from pest attack or infestation) with the nanocomposite or product.

[0040] In some embodiments of the present invention, an effective dose of the nanocomplex of the first aspect of the present invention or the product of the fourth aspect of the present invention is applied to pests or pest habitats.

[0041] In some embodiments of the present invention, in general, "effective amount" means the amount of active ingredient required to achieve an observable effect on growth, including necrosis, death, retardation, prevention and removal, destruction or reduction of the presence and activity of the target organism. For the nanocomposite or product used in the present invention, the effective amount can vary. The effective amount of the nanocomposite or product also varies according to the prevailing conditions, such as the desired insecticidal effect and duration, climate, target species, location, mode of application, etc.

[0042] In some embodiments of the present invention, about 50 g of the nanocomposite is used per hectare, with a dilution ratio of 1:100 to 1:500. When applied in combination with Serratia marcescens, it is recommended to use 1 to 2 liters of bacterial suspension per hectare, with a concentration of 1 to 9×10 8 CFU / mL, to better achieve pest control.

[0043] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0044] In some embodiments of the present invention, the pests include at least one of the fall armyworm, fall armyworm, beet armyworm, cotton leafworm, armyworm, corn armyworm, cotton bollworm, tobacco hornworm, diamondback moth, cabbage looper, grape leafroller, wheat moth, and soybean armyworm.

[0045] In some embodiments of the present invention, the pest is fall armyworm.

[0046] In some embodiments of the present invention, the plant includes at least one of corn, rice, wheat, sugarcane, sorghum, peanut, soybean, Arabidopsis, Chinese cabbage, kale, cabbage, and wild rice stem.

[0047] The beneficial effects of the present invention are:

[0048] The present invention provides a nanocomposite containing dsRNA targeting chitin synthase gene (CHS) or v-type proton ATPase subunit B gene (V-ATPaseB), and the nanocomposite particles, as a new type of biological pesticide preparation, have good pest control effect and plant leaf protection effect. The nanocarrier used in the nanocomposite can effectively deliver dsRNA, avoid its degradation in the pest body, and improve the delivery efficiency.

[0049] The present invention feeds corn leaves containing nanocomplexes to fall armyworms, thereby proving that CHS and V-ATPaseB genes can be used as potential gene targets. By silencing CHS and V-ATPaseB genes through RNAi technology mediated by nanomaterials, the control effect on fall armyworms can be significantly improved.

[0050] On the basis of the nanocomposite, the present invention creatively combines the pest intestinal microorganism Serratia marcescens, and the nanocarrier in the nanocomposite can increase the abundance of Serratia marcescens bacteria in the pest intestine, inhibit the pest immunity level, increase the lethality of RNAi, increase the plant's defense response to herbivorous insects, and thus improve the effect of pest control.

[0051] The main component of the product provided by the present invention is a nanocomplex containing dsRNA molecules, which is safe and harmless to humans or animals, and can effectively reduce the use of chemical pesticides, and has no drug resistance problem, no environmental pollution problem, and is beneficial to environmental protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 SEM image of dsGFP@ZIF-8@PDA nanocomposite.

[0053] Figure 2 TEM image of dsGFP@ZIF-8@PDA nanocomposite.

[0054] Figure 3 Figure 2 shows the average radius of dsGFP@ZIF-8@PDA nanocomplexes.

[0055] Figure 4 The maximum loading capacity of dsRNA in ZIF-8 or ZIF-8@PDA was determined by 1% agarose gel electrophoresis in Example 2. In the figure, the red font SusdsRNA-ZIF-8 represents the suspension after synthesis and centrifugation; the red font dsRNA-ZIF-8 represents the products of different synthesis ratios.

[0056] Figure 5 This is the change diagram of the Zeta potential value of the dsGFP@ZIF-8@PDA nanocomplex.

[0057] Figure 6 The fluorescence intensity distribution diagram of the intestinal and fat body tissues of Spodoptera frugiperda was measured after corn leaves were treated with dsGFP / Cy3 and dsGFP / Cy3@ZIF-8@PDA respectively.

[0058] Figure 7 The survival rate of Fall Armyworm larvae within 4 days after treatment with different dsRNA and materials.

[0059] Figure 8 Figure 2 shows the body shape and intestinal tissue phenotype of Spodoptera frugiperda larvae treated with dsCHS@ZIP-8@PDA.

[0060] Fig. 9 Survival rate of Spodoptera frugiperda larvae within 4 days after treatment with Serratia marcescens and Enterococcus combined with dsCHS@ZIF-8@PDA nanocomplexes, respectively.

[0061] Fig.10 For Serratia marcescens and Enterococcus aureus (OD 600 =0.1)+dsCHS@ZIF-8@PDA aseptically performed ROS staining of intestinal tissue.

[0062] Fig.11 The cells were inoculated with sterile PBS, Serratia marcescens, and Enterococcus (OD 600 =0.1) of the fall armyworm phenotype. DETAILED DESCRIPTION

[0063] The present invention is further described in detail below through specific examples.

[0064] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0065] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0066] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0067] Example 1 Preparation of dsCHS and dsV-ATPaseB of Spodoptera frugiperda

[0068] The CHS mentioned in this embodiment is the chitin synthase gene of Spodoptera frugiperda. Chitin synthase is a key enzyme that controls the formation of chitin in the insect cuticle and midgut peritrophic membrane, and is an essential enzyme for insect molting, immune and digestive system functions. The nucleotide sequence of the CHS gene is shown in SEQ ID NO:11; the V-ATPaseB is the v-type proton ATPase subunit B gene of Spodoptera frugiperda. V-ATPaseB is a multi-subunit enzyme that can hydrolyze adenosine triphosphate (ATP) to transport protons across the cell membrane and has been shown to play an important role in many biological processes. The nucleotide sequence of the V-ATPaseB gene is shown in SEQ ID NO:12; the dsRNA synthesized with the GFP gene sequence was used as a blank control, and the nucleotide sequence of the GFP gene is shown in SEQ ID NO:13.

[0069]

[0070]

[0071] (SEQ ID NO: 13).

[0072] 1. Test Fall Armyworm

[0073] The fall armyworm used in this embodiment is a laboratory indoor rearing population, and the larvae are reared on corn leaves for a long time, under the conditions of 28±3°C, 14L:10D of light, and 60% to 65% relative humidity, on fresh corn leaves.

[0074] 2. dsRNA Synthesis

[0075] Total RNA was extracted from 10 fourth-instar fall armyworms and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using a 2×TaqPCR Mix kit to obtain 476 bp dsCHS and 446 bp dsV-ATPaseB fragments. The primers used for dsRNA synthesis and qPCR are detailed in Tables 1 and 2. The PCR reaction system included 1 μL template DNA, 1 μL each of 10 μM dsF / dsR primers, 25 μL of 2×Taq Master Mix (Dye Plus) and ddH2O added to 50 μL. The PCR product was purified by magnetic beads to remove impurities. The HighYield T7RNA transcription kit was used for dsRNA synthesis. The reaction system included 1 μg of purified PCR product, 1 μL T7RNA polymerase / RNase inhibitor, 2.5 μL 10× transcription buffer, 4.0 μL NTP Mix, and ddH2O supplemented to 25 μL. After the reaction solution was mixed, it was incubated at 37°C for 2 to 8 hours, and then 2 μL of DNase I was added for 15 minutes to remove the residual template DNA. The dsGFP of the green fluorescent protein (GFP) gene was used as a negative control. The synthesized dsRNA product was purified by magnetic beads, freeze-dried and stored at -20°C.

[0076] The nucleotide sequence of dsCHS is shown in SEQ ID NO:14, the nucleotide sequence of dsV-ATPaseB is shown in SEQ ID NO:15, and the nucleotide sequence of dsGFP is shown in SEQ ID NO:16.

[0077] TAAGACTGAGGACCTCGCAGAAATTGAAAAAGAAAAAGGCGATGAATACTATGAAACTATATCGGTTCACACGGATAACACTGGTTCTTCTCCGAAAGCTATTAAGTCATCAGATCAGATCACCAGGATATACGCATGCGCTACTATGTGGCACGAAACTAAAGACGAGATGATGGAGTTCTTGAAGTCTATTCTTCGGTTGGATGAGGATCAGTGCGCTCGGCGTGTGGCTCAAAAGTATTTACGAGTCGTTGACCCTGATTACTATGAATTCGAAACACATATTTTCTTAGACGACGCCTTCGAAATATCAGATCATAGTGACGATGATGCTCAAGTGAATCGTTTCGTGAAACTGCTTGTGGACACTATCGATGAAGCAGCTTCCGAAGTACATCAGACGAACATTCGCATTCGACCGCCCAAGAAGTATCCGGCGCCTTACGGAGGACGTTTGACTTGGGTACTGCCAGGAA(SEQ ID NO:14)。

[0078] TGCAGCTCAGACTCGCTGATGGCACTCTCCGCTCCGGTCAGGTGCTCGAGGTCAGCGGCACCAAGGCCGTGGTCCAGGTGTTCGAAGGTACATCAGGTATCGACGCCAAGAACACTCTCTGTGAGTTTACCGGCGACATCCTGCGTACTCCCGTGTCTGAAGATATGTTGGGTCGTGTATTCAACGGCTCCGGCAAGCCCATTGACAAGGGTCCCCCAATCCTCGCCGAGGACTTCTTGGACATCCAGGGACAACCCATCAACCCATGGTCCCGTATCTACCCCGAGGAGATGATCCAGACTGGTATCTCCGCTATTGACGTGATGAACTCCATCGCTCGTGGTCAGAAGATCCCCATCTTCTCCGCTGCTGGTCTGCCTCACAACGAAATTGCCGCCCAGATCTGTAGACAGGCCGGTCTTGTCAAGATCCCCGGCAAATCAGTG(SEQ ID NO:15)。

[0079] GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTG(SEQID NO:16).

[0080] Table 1 Primer information for dsRNA synthesis

[0081]

[0082] Table 2 Primer information for real-time fluorescence quantitative detection

[0083]

[0084] Example 2 Preparation of dsRNA@ZIF-8@PDA Nanocomplex

[0085] 526.9 μL of 10 mg / mL After the dsRNA solution was evenly mixed with 50 μL of 0.84 M Zn(NO3)2·6H2O solution, 484.1 μL of 3.04 M 2-methylimidazole solution was added and quickly shaken at 800 rpm for 20 min; centrifuged at 12000 rpm for 30 min at 4°C; the surface of the precipitate was repeatedly rinsed with DEPC water for 3 times, and then 2.2 mL of dopamine (DA) solution with a concentration of 2.8 mg / mL was added, and the reaction was terminated after continuous stirring at 800 rpm for 5 hours; the product was centrifuged at 5000 rpm for 10 min at 4°C, repeatedly micro-rinsed with DEPC water for 3 times, freeze-dried, and then stored at -20°C to prepare dsRNA@ZIF-8@PDA nanocomplexes, that is, dsGFP@ZIF-8@PDA, dsCHS@ZIF-8@PDA and dsV-ATPaseB@ZIF-8@PDA nanocomplexes were prepared respectively.

[0086] Taking dsGFP@ZIF-8@PDA nanocomposite as an example, the composite was characterized and analyzed. The scanning electron microscopy (SEM) of dsGFP@ZIF-8@PDA nanocomposite is shown in Figure 2. Figure 1 As shown in the transmission electron microscope (TEM) image Figure 2 As shown in Figure 2, the characterization images of dsGFP@ZIF-8@PDA reveal that the dsRNA@ZIF-8@PDA nanocomplex has a polyhedral spherical structure. Figure 3 As shown, the Gaussian probability distribution model statistics showed that the average diameter of the dsRNA@ZIF-8@PDA nanocomplex was 109.08±0.8 nm.

[0087] In order to explore the binding mechanism of dsRNA loaded into ZIF-8, microcalorimetric isothermal titration calorimetry (ITC) was used to measure the intermolecular forces. 2+ 10 mM 2-mIm solution was added and 0.5 mM dsGFP was added to 5 mM ZIF-8. Each titration peak was integrated using Origin software to calculate the interaction heat during each injection. The test temperature was set to 25 °C and the calculation formula for ΔG was as follows: ΔG = ΔH-TΔS.

[0088] The potential changes of ZIF-8, dsGFP@ZIF-8 and dsGFP@ZIF-8@PDA are shown in Figure 5As shown, electrostatic interactions were found between ZIF-8, dsGFP, and PDA. The positive values ​​of thermodynamic parameters ΔH and TΔS indicate that the self-assembly process of ZIF-8 is endothermic and driven mainly by electrostatic interactions and entropy changes. The low dissociation constant (Kd) and negative ΔG values ​​further confirm the strong interaction between dsGFP and ZIF-8, which is spontaneous.

[0089] In order to explore the maximum loading rate of dsRNA in dsRNA@ZIF-8@PDA, the loading rates of dsRNA in dsRNA@ZIF-8 and dsRNA@ZIF-8@PDA were calculated respectively. Specifically: First, 50 mg dsGFP@ZIF-8 was dissolved in 50 mL hydrochloric acid solution (DEPC water, pH = 1), and 1 μL of supernatant was used to determine the dsRNA concentration, and the concentration was represented by c. 50 mg dsGFP@ZIF-8 was then dispersed in 10 mL DEPC water and 10 mL DA solution (containing 0.1% Tris hydrochloric acid) and mixed for 5 hours. After centrifugation at 4 ° C and 13000 rpm for 20 minutes, the supernatant was removed, and the dsGFP@ZIF-8@PDA was weighed after freeze-drying. The mass of dsGFP@ZIF-8@PDA is represented by m. The loading rates of dsRNA@ZIF-8 (LR1) and dsRNA@ZIF-8@PDA (LR2) were calculated as follows:

[0090] Results Figure 4 , the loading rate of dsRNA@ZIF-8@PDA reached 10.25%, and the loading rate of dsRNA@ZIF-8 was about 8.3%.

[0091] Example 3 Determination of the stability and delivery efficiency of dsGFP@ZIF-8@PDA complex in fall armyworm

[0092] This example uses nanofluorescence to detect the stability of the dsGFP@ZIF-8@PDA complex in fall armyworm and the dsRNA delivery efficiency. The details are as follows:

[0093] 1. Stability

[0094] Hemolymph and intestinal fluid were collected from the fourth-instar fall armyworm and placed in a 1.5 mL centrifuge tube. 500 μL of pre-cooled PBS buffer was added and then centrifuged at 3000 rpm for 3 min at 4 °C. The supernatant was transferred to a new centrifuge tube to remove tissue contaminants. In the degradation experiment, hemolymph and intestinal fluid were mixed with 1 μg of dsGFP, respectively. At the same time, dsGFP@ZIF-8 and dsGFP@ZIF-8@PDA containing 1 μg of dsGFP were treated with hemolymph and intestinal fluid under the same conditions. The above mixture samples were incubated at 37 ± 1 °C for 1 hour, and then 10 μL of the mixture was taken for analysis by 1% agarose gel electrophoresis.

[0095] The results showed that ZIF-8@PDA nanocarriers could effectively protect dsRNA from enzymatic degradation compared with unencapsulated dsRNA, indicating that ZIF-8@PDA nanocarriers significantly improved the environmental stability of dsRNA.

[0096] 2. dsRNA delivery efficiency

[0097] To test the dsRNA delivery efficiency, dsGFP / Cy3@ZIF-8@PDA nanocomplexes were synthesized according to the method of Example 2. dsRNA was labeled with 0.1 μg / mL Cy3, and 526.9 μL of dsGFP labeled with Cy3 at a concentration of 15 mg / mL was added to the synthesis system with a total volume of 1.1 mL. The product was centrifuged at 5000 rpm for 10 min at 4°C, then gently rinsed with DEPC water 3 times and freeze-dried to obtain dsGFP / Cy3@ZIF-8@PDA. 1 mg of dsGFP / Cy3@ZIF-8@PDA dry powder was evenly dispersed in 50 mL of DEPC water. 2 mL of dsGFP / Cy3@ZIF-8@PDA solution was evenly coated on 60 cm 2 Rectangular corn leaves, dried and cut into 2cm pieces 2 Square leaves. At the same time, each square leaf was smeared with naked dsGFP / Cy3 as a control. The corn leaves treated as above were used to feed the fourth-instar fall armyworm larvae. After 24 hours of feeding, the intestinal tissue was dissected and fixed with 4% formaldehyde and DAPI solution for 15 minutes, and then washed three times with pH=7.4 phosphate buffer, each time for 5 minutes. The intestinal tissue was observed under a laser scanning confocal microscope.

[0098] To evaluate the uptake efficiency of dsRNA by Spodoptera frugiperda, naked dsGFP labeled with Cy3 was used as a control. The fluorescence brightness of dsGFP / Cy3 loaded on @ZIF-8@PDA was significantly higher than that of dsGFP / Cy3 in the intestinal tissue and hemolymph of Spodoptera frugiperda. The fluorescence intensity of dsGFP loaded on ZIF-8@PDA nanocarrier increased by 12.33 times ( Figure 6 ). This indicates that the dsGFP / Cy3@ZIF-8@PDA nanocomplex has a higher delivery effect on dsRNA. This result confirms that the ZIF-8@PDA nanocarrier promotes the uptake of dsGFP and effectively overcomes the bottleneck problem of low dsRNA delivery efficiency.

[0099] Example 4 Application and control efficacy evaluation of dsRNA@ZIF-8@PDA complex against fall armyworm

[0100] Weigh 5 mg of dsV-ATPaseB@ZIF-8@PDA and dsCHS@ZIF-8@PDA (prepared in Example 2), and completely disperse them in 100 mL of DEPC water, respectively, to obtain a treatment solution. Similarly, weigh 0.4 mg of dsV-ATPaseB and dsCHS freeze-dried powder, and completely disperse them in 100 mL of DEPC water, respectively. Apply 2 mL of the treatment solution on the corn leaves, cut them into square leaves with an area of ​​1 cm, and dry them twice. The feed leaves with DEPC water added were used as a control. In order to prevent the fall armyworms from attacking each other, each larva was placed individually in a small plastic grid, and 36 were treated each time. These leaves were placed in the middle of each small grid, and fresh leaves were replaced every 12 hours. Mortality, body length and body weight were recorded for 5 consecutive days.

[0101] The survival rate (%) was calculated at specific time intervals.

[0102]

[0103] Where Ntotal is the total number of fall armyworm larvae and Nt is the number of larvae that died at time t.

[0104] By comparing the survival rate of fall armyworm larvae after different treatments within 4 days, the experimental results are as follows: Figure 7 As shown, feeding dsCHS@ZIF-8@PDA and dsV-ATPaseB@ZIF-8@PDA significantly reduced the survival rate of the fall armyworm, which was only 31% to 38%. The naked dsRNA had limited absorption and was unstable, with no obvious insecticidal effect, and the survival rate of the fall armyworm reached 91%.

[0105] ZIF-8@PDA loaded with dsCHS or dsV-ATPaseB increased insect mortality and RNAi efficiency. dsCHS and dsV-ATPaseB loaded with ZIF-8@PDA significantly reduced the survival rate of S. frugiperda, while naked dsRNA had no obvious insecticidal effect due to the instability of naked dsRNA and the limited uptake of dsRNA by S. frugiperda. In particular, larvae fed with dsCHS@ZIF-8@PDA showed membrane lysis of the midgut peritrophic membrane such as Figure 8 Compared with naked dsCHS and dsV-ATPaseB, RNAi of dsCHS and dsV-ATPaseB mediated by ZIF-8@PDA nanomaterials was significantly enhanced.

[0106] Example 5 Serratia marcescens (OD 600 =0.1)+dsCHS@ZIF-8@PDA nanobiological agent on fall armyworm

[0107] Preparation of nanobiological agents: Serratia marcescens (SM) and Enterococcus mundtii (EM) solutions were adjusted to OD 600 =0.1, and 1 mg of dsCHS@ZIF-8@PDA freeze-dried powder was added to 50 mL of the bacterial solution to prepare the nanobiological preparation.

[0108] Leaf treatment and feeding: The above-mentioned nanobiological agent solution was evenly applied on sterile naturally dried corn leaves as the experimental group. At the same time, corn leaves coated with sterile PBS buffer were used as the control group. The aseptically cultured third-instar fall armyworm larvae were placed on the leaves of the experimental group and the control group for feeding. After 4 consecutive days of feeding, the number of deaths of fall armyworms in each treatment group was recorded. Each group was treated with 30 larvae of uniform growth, and the experiment was repeated 3 times. The survival rate (%) was calculated within a certain time interval.

[0109] The results are as follows Fig. 9 As shown, dsCHS@ZIF-8@PDA + Serratia marcescens (OD 600 =0.1) leaves, the survival rate of sterile fall armyworm larvae feeding on leaves was significantly lower than that of dsCHS@ZIF-8@PDA+Enterococcus or PBS buffer, and the survival rate of fall armyworms dropped below 30% after four days of treatment with dsCHS@ZIF-8@PDA+Serratia marcescens. The application of Serratia marcescens caused the ROS immunity level in the insect intestine to increase first and then decrease, increasing the synergistic insecticidal effect of dsRNA@ZIF-8@PDA and improving the mortality rate of pests.

[0110] Serratia marcescens activated the immune response of the fall armyworm. Fig.10 As shown in the figure, the ROS content changed significantly, first increasing significantly at 48 hours and then decreasing at 72 hours. dsCHS@ZIF-8@PDA inhibited the ROS immune response of Serratia marcescens enriched in the intestine of Spodoptera frugiperda, and had a significant synergistic insecticidal effect.

[0111] Example 6 Plant Anti-herbivory Response

[0112] Different populations of third-instar larvae of S. frugiperda, including sterile populations, populations infected with Serratia marcescens, and populations infected with Enterococcus, were inoculated on healthy corn plants sprayed with 10 mg / L dsCHS@ZIF-8@PDA nanocomposites. Ten third-instar larvae were placed on each corn plant, and four plants were used for each treatment, repeated three times, and the mortality was counted for four consecutive days. The content of glucose oxidase (GOX) in the oral secretions of different populations of S. frugiperda was determined, and the content of plant hormones jasmonic acid (JA), jasmonate isoleucine (JA-Ile), salicylic acid (SA), and polyphenol oxidase (PPO) activity were also determined.

[0113] The results are as follows Fig.11 As shown, the phenotypes of Spodoptera frugiperda after inoculation with sterile, Serratia marcescens and Enterococcus, respectively. The Spodoptera frugiperda inoculated with sterile or Enterococcus developed normally, while the body of the Spodoptera frugiperda infected with Serratia marcescens appeared red.

[0114] Experimental studies have found that fall armyworms infected with Serratia marcescens improve the plant's anti-insect defense level by enhancing the insect's glucose oxidase (GOX) activity and activating the jasmonic acid signaling pathway. Further inoculation experiments confirmed that fall armyworms inoculated with Serratia marcescens and eating corn plants sprayed with dsCHS@ZIF-8@PDA had a lower survival rate than fall armyworms inoculated with Enterococcus or sterile populations, indicating that the combination of Serratia marcescens and dsCHS@ZIF-8@PDA has great potential in pest control.

[0115] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A nanocomplex comprising a nanocarrier and a dsRNA, wherein the dsRNA is loaded on the nanocarrier through charge adsorption and hydrogen bonding, and the dsRNA targets a chitin synthase gene or a v-type proton ATPase subunit B gene.

2. The nanocomposite according to claim 1, characterized in that The nucleotide sequence of the dsRNA is shown in SEQ ID NO: 14 and / or SEQ ID NO:

15.

3. The nanocomposite according to claim 1 or 2, characterized in that: The nanocarrier comprises a polymer nanocomposite material of a zeolite imidazolate framework; Preferably, the nanocarrier is ZIF@polydopamine.

4. The method for preparing the nanocomposite according to claim 3, comprising the following steps: The ZIF@polydopamine and dsRNA are mixed and reacted to obtain a nanocomplex.

5. Use of the nanocomposite according to any one of claims 1 to 3 in controlling pests or preparing products for controlling pests.

6. The use according to claim 5, characterized in that: The nanocomposite achieves the purpose of controlling pests by inhibiting the development of pests and / or promoting the death of pests; Preferably, the pests include insects of the order Lepidoptera; Preferably, the pests include at least one of the fall armyworm, fall armyworm, beet armyworm, cotton leafworm, armyworm, corn armyworm, cotton bollworm, tobacco hornworm, diamondback moth, cabbage looper, grape leafroller, wheat moth, and soybean armyworm.

7. A product comprising the nanocomposite according to any one of claims 1 to 3.

8. The product according to claim 7, characterized in that The product also includes Serratia marcescens.

9. A method for controlling pests or protecting plant leaves, comprising the step of applying the nanocomposite according to any one of claims 1 to 3 or the product according to claim 7 or 8 to pests or their habitats.

10. The method according to claim 9, characterized in that The pests include insects of the order Lepidoptera.

Images