Immune globulin heavy chain variable region locus as well as assembly method and application thereof

Abstract

The invention discloses an IGHV region gene locus assembly based on Gibson assembly as well as a method and application of the IGHV region gene locus assembly. The assembly method comprises the following steps: designing upstream and downstream specific PCR (Polymerase Chain Reaction) primers for amplifying each target gene segment to obtain a corresponding single target gene segment, transforming a universal vector pUC19 into a subcloning vector, and obtaining a corresponding pMIGH-IGHV plasmid in a Gibson assembly mode; the preparation method comprises the following steps: carrying out Gibson assembly and double enzyme digestion, and then carrying out Gibson assembly to obtain pCC1BAC-IGHV (1-6V), pCC1BAC-IGHV (1-10V) and pCC1BAC-IGHV (1-15V), so as to obtain an assembled product. According to the assembling method disclosed by the invention, a plurality of target gene segments as long as 3.5 kb can be sequentially assembled according to a design sequence, and an assembled product can reach a hundred kb level or even an Mb level. According to the assembly mode provided by the invention, the human IGHV region gene locus can be simply and effectively prepared, and the human IGHV region gene locus can be applied to preparation of diversified antibodies according to conventional requirements.

Description

Technical Field

[0001] The present invention relates to the fields of synthetic biology and biotechnology, and in particular to a rapidly assembled and modified immunoglobulin heavy chain variable region locus and an assembly method and application thereof. Background Art

[0002] Antibodies are produced by plasma cells after the proliferation and differentiation of B lymphocytes from mammalian bone marrow under antigen stimulation. They are a general term for secretory immunoglobulins (Ig) that can specifically bind to corresponding antigens. The germline loci of mammalian immunoglobulins (Immunoglobulin, Ig) are composed of variable regions (variable region, V) and constant regions (constant region, C). The variable region (VH) of the immunoglobulin heavy chain locus is composed of variable (Variable, V), diversity (Diversity, D) and joining (Joining, J) gene segments; while the variable region (VL) of the antibody light chain locus only has V and J gene segments. The germline genes of Ig exist as separated V, D, J and C gene segments. Only after gene rearrangement to form VDJ (LGH) or VJ (IGL) connection, and then connected with the C gene segment, can a complete and functional immunoglobulin be encoded. In the early development of B cells, after recombination activating gene (RAG) recognizes the conserved rearrangement signal sequence (RSS) at both ends of the Ig germline gene locus V, D and J gene segments, it splices the variable region of the Ig germline gene into only one VDJ combination (VDJ rearrangement) through DNA double-strand break and repair. After rearrangement, the VDJ segment is transcribed together with the downstream C segment (IGHM and IGHD) to form diverse antibodies. Therefore, VDJ rearrangement is the most important mechanism for the production of antibody diversity and the basis for the body's immune system to produce specific antibodies against different antigens.

[0003] The variable region of the human Ig germline heavy chain locus is about 1.3Mb long, of which the V gene region is about 0.9Mb, and is composed of 55 functional gene fragments and 50 non-functional gene fragments. The length of the non-functional gene fragment accounts for about 66% of the entire V gene region. Directed transformation of the natural Ig germline heavy chain locus, deletion of non-functional gene fragments or increase of functional gene fragments is an important means to study the mechanism of V(D)J rearrangement and the mechanism of antibody diversity production, and is also the key to building a new generation of humanized antibody mouse platform. Given that each functional V gene fragment is up to 3.5kb long, including the coding region, upstream promoter, RSS sequence and proximal CTCF site sequence, its sequence structure is complex. When it is necessary to construct an artificial chromosome with up to 50 V gene fragments in the order of in vivo, it is necessary to establish an efficient long-fragment DNA assembly technology.

[0004] Directed modification of natural Ig germline loci, rearrangement of natural gene clusters in a predetermined order, further modification of specific regulatory elements within the loci, or addition or deletion of specific gene fragments, etc., is an important means to study the V(D)J rearrangement mechanism and the mechanism of antibody neutralization activity and affinity generation. Although the development of de novo double-stranded DNA synthesis technology has made recombinant DNA engineering more flexible, due to technical limitations, the length of the synthesized fragment is usually 200-2000kb.

[0005] Gibson assembly is a molecular biology technique for constructing recombinant DNA. It was first proposed and published by Daniel G. Gibson and others at the University of California, Ireland. Since then, the technique has been improved and expanded to become an important tool in the fields of synthetic biology and molecular biology. Usually, the Gibson assembly process first requires adding homologous fragments to the ends of DNA fragments, and then incubating these DNA fragments with a mix (containing three enzymes) for one hour before transforming competent cells. This mix contains three different types of enzymes: 1) an exonuclease that digests DNA from the 5' end to produce sticky ends that are easy to pair with other homologous ends. 2) a polymerase that is used to repair gaps. 3) a DNA ligase that achieves seamless splicing to form a complete DNA molecule. Gibson assembly technology is also suitable for the assembly of multiple fragments. Compared with the traditional segment-by-segment construction method, Gibson assembly technology can complete the construction of multiple fragments in one step.

[0006] At present, the conventional Gibson assembly technology faces at least the following common technical difficulties in assembling long DNA fragments: (1) Each gene fragment to be assembled is too long and contains a lot of highly repetitive sequences, which makes it difficult to design specific primers and perform conventional PCR; (2) The number of gene fragments to be assembled is large, and it takes a lot of time and effort to assemble them in sequence according to the conventional process; (3) Although the conventional Gibson assembly technology can connect up to 6 fragments at a time, the inserted fragment is only tens to hundreds of bp, and the final assembly product is only at the 1-10kb level; and when the assembled gene fragments are long and numerous, conventional backbone vectors are difficult to carry. Summary of the invention

[0007] Based on this, the first object of the present invention is to provide an optimized human IGHV region locus assembly method based on Gibson assembly, which is used to assemble multiple kb-level fragments in one step and can be used for the efficient assembly of complex structure loci.

[0008] The second object of the present invention is to provide a primer combination for specific amplification of human IGH functional V gene fragments for assembly of modified human IGH V region loci.

[0009] The purpose of the present invention can be achieved through the following technical solutions:

[0010] A method for assembling an IGHV region locus based on Gibson assembly comprises the following steps:

[0011] Step 1. Obtain a strain or sequence covering the IGH variable region V region locus (IGHV) as a PCR amplification template;

[0012] Step 2. For the IGHV target gene fragments to be amplified, upstream and downstream specific PCR primers are designed to amplify each target gene fragment, and recognition sequences for Gibson assembly and homology arms for cloning are introduced at both ends of the target sequence of each pair of specific primer sequences. The sequence of the specific PCR primers has the following structure:

[0013] (1) Gibson homology arm sequence upstream of pMIGH;

[0014] (2) Restriction endonuclease recognition sequence a;

[0015] (3) pCC1BAC upstream Gibson homology arm sequence and restriction endonuclease recognition sequence b;

[0016] (4) a target sequence that can bind to the sequence of the target gene fragment and be used to specifically amplify the target gene fragment;

[0017] (5) the Gibson homology arm sequence of the next adjacent target gene fragment to be assembled and the recognition sequence c of the restriction endonuclease;

[0018] (7) Iterate Gibson homology arm sequence, restriction endonuclease recognition sequence d;

[0019] (8) Gibson homology arm sequence downstream of pCC1BAC, recognition sequence of restriction endonuclease e;

[0020] (9) Gibson homology arm sequence downstream of pMIGH;

[0021] Step 3. Perform PCR amplification using the primers and PCR amplification template described in step (2) to obtain the corresponding single target gene fragments, and transform the universal vector pUC19 into a subcloning vector to obtain the subcloning vector fragment pMIGH by amplification; each single target gene fragment is respectively combined with the subcloning vector fragment pMIGH to obtain the corresponding pMIGH-IGHV plasmid by Gibson assembly;

[0022] Step 4. From the pMIGH-IGHV plasmid described in step 3, the pMIGH-IGHV plasmid described in step 3 is digested with a restriction endonuclease and the IGHV target gene fragment is recovered. According to the order of the genes to be assembled, 2-3 adjacent target gene fragments are respectively combined with the linearized assembly vector backbone by Gibson assembly to obtain multiple pCC1BAC-IGHV (V to V+1 to V+2 or V+3) plasmids, where V is the corresponding order of each target gene fragment at the target locus;

[0023] Step 5. Use restriction endonucleases for linearization and double digestion, and assemble the adjacent plasmids obtained in step 4 by Gibson assembly to obtain assembly products.

[0024] In some embodiments, step 4 and step 5 are respectively as follows:

[0025] The steps 4 and 5 are as follows:

[0026] Step 4. From the pMIGH-IGHV plasmid described in step 3, the pMIGH-IGHV plasmid described in step 3 is digested with a restriction endonuclease and the IGHV target gene fragment 1V-15V is recovered, and the linearized assembly vector backbone is assembled by Gibson assembly to obtain pCC1BAC-IGHV (1-3V) plasmid, pCC1BAC-IGHV (4-6V) plasmid, pCC1BAC-IGHV (7-10V), pCC1BAC-IGHV (11-13V), and pCC1BAC-IGHV (14-15V) plasmid;

[0027] Step 5. Linearize pCC1BAC-IGHV (1-3V) with restriction endonuclease NotI, double-digest pCC1BAC-IGHV (4-6V) with restriction endonucleases NheI and I-CeuI, and assemble into pCC1BAC-IGHV (1-6V) by Gibson assembly;

[0028] pCC1BAC-IGHV (1-6V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV (7-10V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV (1-10V) by Gibson to obtain an assembly product;

[0029] pCC1BAC-IGHV (11-13V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV (14-15V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV (11-15V) by Gibson assembly to obtain an assembly product;

[0030] pCC1BAC-IGHV (1-10V) was linearized with restriction endonuclease NotI, and pCC1BAC-IGHV (11-15V) was double-digested with restriction endonucleases SalI and I-CeuI, and assembled into pCC1BAC-IGHV (1-15V) by Gibson to obtain the assembly product.

[0031] In some embodiments, the restriction endonuclease is a type II restriction endonuclease, and the recognition sequence of the restriction endonuclease does not exist in the target gene fragment, preferably one or two of XbaI, XhoI, NotI, NheI and I-CeuI.

[0032] In some preferred embodiments, the recognition sequence a corresponds to restriction endonuclease XbaI or XhoI, the recognition sequence b corresponds to restriction endonuclease NheI, the recognition sequence c corresponds to restriction endonuclease NotI, the recognition sequence d corresponds to restriction endonuclease I-CeuI, and the recognition sequence e corresponds to restriction endonuclease XbaI or XhoI. In some embodiments, the sequences of the specific PCR primers are shown in SEQ ID No.1-SEQ ID No.20,

[0033] The details are as follows:

[0034] For the target gene fragment SEQ ID No.1-SEQ ID No.2 of 1V;

[0035] SEQ ID No.3-SEQ ID No.4 for the target gene fragment 2V;

[0036] SEQ ID No.5-SEQ ID No.6 for the target gene fragment 3V;

[0037] SEQ ID No.7-SEQ ID No.8 for the target gene fragment 4V;

[0038] SEQ ID No.9-SEQ ID No.10 for the target gene fragment of 5V;

[0039] SEQ ID No.11-SEQ ID No.12 for the target gene fragment 6V;

[0040] SEQ ID No.13-SEQ ID No.14 for the target gene fragment 7V;

[0041] SEQ ID No.15-SEQ ID No.16 for the target gene fragment 8V;

[0042] SEQ ID No.17-SEQ ID No.18 for the target gene fragment 9V;

[0043] SEQ ID No.19-SEQ ID No.20 for the target gene fragment 10V;

[0044] SEQ ID No.21-SEQ ID No.22 for the target gene fragment 11V;

[0045] SEQ ID No.23-SEQ ID No.24 for the target gene fragment 12V;

[0046] SEQ ID No.25-SEQ ID No.26 for the target gene fragment 13V;

[0047] SEQ ID No.27-SEQ ID No.28 for the target gene fragment 14V;

[0048] The target gene fragment is SEQ ID No.29-SEQ ID No.30 of 15V.

[0049] In some of the embodiments, the pMIGH vector used for cloning the IGHV gene fragment is modified from the pUC19 cloning vector or other commercial cloning vectors.

[0050] Preferably, the primers used for amplification to obtain the subcloning vector fragment pMIGH are SEQ ID No.31-SEQ ID No.32.

[0051] In some of the embodiments, the Gibson assembly method is: the IGHV gene fragments to be assembled and the subcloning vector are added to the Gibson assembly master mix in a molar ratio of 3:1, the reaction conditions are 49-51°C, 18-22min, and the total volume of the reaction system is 10-30μl, preferably 10μl.

[0052] In some of the embodiments, in step 4, the BAC-grade vector pCC1BAC is linearized using restriction endonuclease SalI.

[0053] In some of the embodiments, in step 4, pMIGH-IGH1V is double-digested with restriction endonucleases XbaI (or XhoI) and NotI, pMIGH-IGH2V is double-digested with NheI and NotI, and pMIGH-IGH3V is double-digested with NheI and XbaI (or XhoI). After the digested fragments are purified and recovered, the obtained digested fragments are added to Gibson assembly master mix at a molar ratio of 3:1, and a Gibson assembly reaction is performed to obtain a pCC1BAC-IGHV (1-3V) plasmid.

[0054] In some preferred embodiments, the Gibson assembly reaction conditions in step 4 are 50° C., 1 h, and the total volume of the reaction system is 10-30 μl, preferably 10 μl.

[0055] In some of these embodiments, the amplified fragments include human IGHV3-53, IGHV5-51, IGHV3-49, IGHV3-48, IGHV1-46, IGHV1-45, IGHV3-43, IGHV4-39, IGHV3-43D, IGHV4-38-2, IGHV4-34, IGHV3-33, IGHV4-31, IGHV3-30-5, and IGHV4-30-4.

[0056] In some of the embodiments, the assembly vector backbone for the modified immunoglobulin variable region locus is a pCC1BAC vector, or other vector backbones that can be used to construct a BAC library.

[0057] The second object of the present invention is to provide a specific PCR primer for IGHV region locus assembly based on Gibson assembly, wherein the specific PCR primer has the following structure:

[0058] (1) pMIGH upstream homology arm sequence;

[0059] (2) Restriction endonuclease recognition sequence a;

[0060] (3) pCC1BAC upstream homology arm sequence and restriction endonuclease recognition sequence b;

[0061] (4) a target sequence that can bind to the sequence of the target gene fragment and be used to specifically amplify the target gene fragment;

[0062] (5) the Gibson homology arm sequence of the next adjacent target gene fragment to be assembled and the recognition sequence c of the restriction endonuclease;

[0063] (7) Iterate Gibson homology arm sequence, restriction endonuclease recognition sequence d;

[0064] (8) pCC1BAC downstream homology arm sequence, restriction endonuclease recognition sequence e;

[0065] (9) Gibson homology arm sequence downstream of pMIGH.

[0066] The fourth object of the present invention is to provide an assembled IGHV region locus obtained by the above preparation method.

[0067] The fourth object of the present invention is to provide the use of the above-mentioned Gibson assembled IGHV region loci in preparing diverse antibodies.

[0068] The fifth object of the present invention is to provide the application of the above-mentioned IGHV region locus assembly method based on Gibson assembly in the assembly of large loci. For example, the large gene contains all human immunoglobulin heavy chain variable region loci, which are assembled into artificial bacterial chromosomes and arranged according to the in vivo sequence, and humanized antibody mice can be prepared by gene manipulation technology (such as microinjection).

[0069] The present invention provides a unique primer design for a gene locus assembly method. Although the IGHV sequence structure is complex and has a considerable number of repeated sequences, it can still be efficiently assembled by the specific primers designed by the present invention, and multiple target gene fragments up to 3.5 kb can be assembled in sequence according to the design order, and the assembly product can reach hundreds of kb or even Mb levels. According to the assembly method of the present invention, the human IGHV region gene locus can be simply and effectively prepared, and the assembly method of the present invention and the gene locus obtained by assembly can be applied to the assembly of a larger gene locus. According to conventional needs, the human IGHV region gene locus can be applied to the preparation of diverse antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 .Schematic diagram of primer design (top) and Gibson assembly (bottom) of pMIGH-IGHV recombinant plasmid.

[0071] Figure 2 .Schematic diagram of pMIGH-IGHV(1V) recombinant plasmid.

[0072] Figure 3 .Schematic diagram of pCC1BAC-IGHV(1-3V) recombinant plasmid.

[0073] Figure 4 .Schematic diagram of pCC1BAC-IGHV(1-6V) recombinant plasmid.

[0074] Figure 5 .Schematic diagram of pCC1BAC-IGHV(1-10V) recombinant plasmid.

[0075] Figure 6 .Results of PCR identification (A) and restriction enzyme digestion identification (B, C) of pCC1BAC-IGHV(1-10V) recombinant plasmid.

[0076] Figure 7 .Schematic diagram of the design of primer sequences for pMIGH-IGHV recombinant plasmid.

[0077] Figure 8 .PCR identification (A) and restriction enzyme digestion identification (B) results of pCC1BAC-IGHV(1-15V) recombinant plasmid.

[0078] Fig. 9 .Schematic diagram of pCC1BAC-IGHV(1-15V) recombinant plasmid. DETAILED DESCRIPTION

[0079] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0080] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0081] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.

[0082] Germ line genes: all genes contained in haploid germ cells and stem cells that have not undergone rearrangement.

[0083] Locus (locus, loci): The position of a gene on a chromosome. At the molecular level, it is a DNA sequence that has a genetic effect.

[0084] IGH: immunoglobulin heavy chain gene.

[0085] IGHV: immunoglobulin heavy chain variable region.

[0086] In some embodiments of the present invention, a method for designing, modifying and efficiently assembling immunoglobulin variable region loci based on Gibson assembly is disclosed, comprising the following steps:

[0087] (1) Design specific primers and use a BAC library containing human IGHV as a template to amplify 10 IGHV gene fragments of approximately 3.5 kb in length by high-fidelity PCR;

[0088] (2) Synthesizing five human IGHV gene fragments with complex sequence structures, each of which is approximately 3.5 kb long;

[0089] (3) The universal vector pUC19 was transformed into a subcloning vector and named pMIGH (plasmid Modified Immunoglobin Heavy); the above-mentioned single IGHV gene fragment was cloned into pMIGH, and DNA sequencing was performed to verify that the sequence of the IGHV gene fragment was correct;

[0090] (4) Using the Gibson seamless cloning technique, multiple IGHV genes were sequentially assembled into a BAC-grade vector to obtain an artificial chromosome containing 15 functional human immunoglobulin heavy chain variable region loci.

[0091] The amplified or synthesized functional IGHV gene fragments have the following characteristics: each IGHV gene is about 3.5 kb long, including a coding region, a rearrangement signal sequence (RSS) and a regulatory element region (including a promoter element and polyadenylation).

[0092] Among them, the optimized Gibson seamless cloning technology is used to assemble multiple long gene fragments at the same time. The specific implementation steps are:

[0093] (1) First, a single IGHV gene fragment was cloned into the subcloning vector pMIGH. The correct recombinant plasmid was identified by sequencing and named pMIGH-IGHV.

[0094] (2) Efficient assembly of three IGHV fragments: The BAC-grade vector pCC1BAC

[0095] Linearization, the preferred restriction endonuclease is SalI; double restriction endonucleases are used to digest pMIGH-IGHV1, pMIGH-IGHV2 and pMIGH-IGHV3 respectively, and the preferred restriction endonuclease combinations are XbaI (or XhoI)-NotI, NheI-NotI, NheI-XbaI (or XhoI).

[0096] The assembly obtained pCC1BAC-IGHV1-V3, pCC1BAC-IGHV4-V6, pCC1BAC-IGHV7-V9, and pCC1BAC-IGHV10-V12, which were arranged in the order of the in vivo IGHV loci. (3) Efficient assembly of 6 IGHV fragments: pCC1BAC-IGHV1-V3 was linearized using restriction endonucleases, and the preferred restriction endonuclease was NotI; at the same time, pCC1BAC-IGHV4-V6 was digested with two restriction endonucleases, and the preferred restriction endonuclease combination was NheI and I-CeuI. pCC1BAC-IGHV1-V6, which was arranged in the order of the in vivo IGHV loci, was obtained by Gibson assembly. Similarly, pCC1BAC-IGHV7-V12 and pCC1BAC-IGHV13-V15 were obtained.

[0097] According to any combination of the four enzymes, 1, 2, 3 or 4 IGHVs can be installed at a time, so 7-10V and 7-12V are assembled according to the above method.

[0098] (4) Efficient assembly of 12 IGHV fragments: Based on (3), the same method was used to obtain pCC1BAC-IGHV1-V15 arranged in the order of the in vivo IGHV loci.

[0099] The present invention designs upstream and downstream specific PCR primers for the IGHV target gene fragment to be amplified:

[0100] (1) Design of primers for high-fidelity amplification of IGHV gene fragments, including at least: pMIGH vector Gibson

[0101] Assembly homology arms (length not less than 15 bp), pCC1BAC vector Gibson assembly homology arms (length not less than 15 bp), restriction endonuclease sequences, preferably restriction endonucleases and combinations thereof are XbaI, XhoI, NotI, NheI and I-CeuI, iterative Gibson assembly homology arms and a second IGHV gene fragment homology sequence (length not less than 15 bp), such as Figure 1 shown.

[0102] (2) The specific primer design of the present invention can achieve seamless connection between IGHV fragments without the presence of scar sequences.

[0103] (3) Sequence characteristics: Each functional IGHV gene fragment is approximately 3.5 kb long and is transcribed from

[0104] The fragment from 2kb upstream of the transcription start site (TSS) to 1kb downstream of the transcription end site (TES) includes the necessary elements required for IGHV gene transcription and rearrangement, such as coding regions, regulatory elements and rearrangement signals.

[0105] See also Figure 1 The designed specific primers have the following structure: recognition sequences for Gibson assembly and homology arms for cloning are introduced at both ends of the target sequence of each pair of specific primer sequences. Specifically, the sequence of the specific PCR primers has the following structure:

[0106] (1) Gibson homology arm sequence upstream of pMIGH;

[0107] (2) Recognition sequence a of restriction endonuclease;

[0108] (3) pCC1BAC upstream Gibson homology arm sequence and restriction endonuclease recognition sequence b;

[0109] (4) a target sequence that can bind to the sequence of the target gene fragment and be used to specifically amplify the target gene fragment;

[0110] (5) Gibson homology arm sequence of the next target gene fragment and the recognition sequence c of the restriction endonuclease;

[0111] (7) Iterate Gibson homology arm sequence, restriction endonuclease recognition sequence d;

[0112] (8) Gibson homology arm sequence downstream of pCC1BAC, recognition sequence of restriction endonuclease e;

[0113] (9) Gibson homology arm sequence downstream of pMIGH.

[0114] In some embodiments, the sequences of the specific PCR primers are shown as SEQ ID No.1-SEQ ID No.30.

[0115] Both ends of these IGHV gene fragment sequences contain pUC19 homology arm sequences (no less than 15 bp in length) and the next homology sequence of the assembled IGHV gene (no less than 15 bp in length).

[0116] The pMIGH vector used for cloning IGHV gene fragments is modified from the pUC19 cloning vector or other commercial cloning vectors.

[0117] The assembly vector backbone of the modified immunoglobulin variable region gene locus is pCC1BAC, or other vector backbones that can be used to construct a BAC library.

[0118] The application of the optimized Gibson seamless assembly technology described in the present invention in the assembly of large loci, such as artificial chromosomes, contains all human immunoglobulin heavy chain variable region loci, and is arranged according to the in vivo sequence, and humanized antibody mice can be prepared through gene manipulation technology (such as microinjection).

[0119] The present invention discloses a method for rapidly assembling a modified immunoglobulin variable region locus. Those skilled in the art can refer to the content of the present invention, appropriately adjust or improve the process parameters, and realize the rapid assembly of large loci such as immunoglobulin variable region loci.

[0120] Below by preferred embodiment, content of the invention is described in detail, it is particularly noted that protection scope of the present invention is more than following embodiment content.For those skilled in the art, can replace and change such as type II restriction enzyme selected, carrier backbone selected, specific assembled gene etc., but all belong to content of the present invention.Below in conjunction with specific embodiment, the present invention is further described in detail.

[0121] Example 1 Amplification of 10 functional V gene segments of human IGH variable region by high-fidelity PCR technology

[0122] Obtain strains of BACs with clone numbers CH17-212P11 and CH17-268I9. These two BACs cover the human IGH variable region V region loci, including IGHV3-53, IGHV5-51, IGHV3-49, IGHV3-48, IGHV1-46, IGHV1-45, IGHV3-43, IGHV4-39, IGHV4-34, and IGHV3-33.

[0123] In addition, five 3.5 kb IGHV fragments (IGHV3-43D, IGHV4-38-2, IGHV4-31, IGHV3-30-5, and IGHV4-30-4) were artificially synthesized by chemical synthesis and inserted into the BamHI site of pUC19, respectively. The sequences of the synthetic IGHV fragments were verified by Sanger sequencing.

[0124] Using the above two BAC overnight bacteria or the synthesized IGHV fragments as templates, PrimeSTAR MaxDNAPolymerase (high-fidelity DNA polymerase) was used for PCR amplification. Different primer sequences were used at different annealing temperatures to obtain the following fragments:

[0125] 1V: IGHV3-53, using primers SEQ ID No. 1-2, annealing temperature of 53°C, product length of 3590 bp;

[0126] 2V: IGHV5-51, using primers SEQ ID No. 3-4, PCR annealing temperature was 52°C, and the product length was 3574 bp;

[0127] 3V: IGHV3-49, using primers SEQ ID No. 5-6, PCR annealing temperature was 44°C, and the product length was 3843 bp;

[0128] 4V: IGHV3-48, using primers SEQ ID No. 7-8, PCR annealing temperature was 51°C, and the product length was 3601 bp;

[0129] 5V: IGHV1-46, using primers SEQ ID No. 9-10, PCR annealing temperature was 51°C, and the product length was 3593 bp;

[0130] 6V: IGHV1-45, using primers SEQ ID No. 11-12, PCR annealing temperature was 56°C, and the product length was 3575 bp;

[0131] 7V: IGHV3-43, using primers SEQ ID No. 13-14, PCR annealing temperature was 51°C, and the product length was 3575 bp;

[0132] 8V: IGHV4-39, using primers SEQ ID No. 15-16, PCR annealing temperature was 53°C, and the product length was 3577 bp;

[0133] 9V: IGHV3-43D, using primers SEQ ID No. 17-18, PCR annealing temperature was 52°C, and the product length was 3595 bp;

[0134] 10V: IGHV4-38-2, using primers SEQ ID No. 19-20, PCR annealing temperature was 55°C, and the product length was 3570 bp;

[0135] 11V: IGHV4-34, using primers SEQ ID No. 21-22, PCR annealing temperature was 49°C, and the product length was 3570 bp;

[0136] 12V: IGHV3-33, using primers SEQ ID No. 23-24, PCR annealing temperature was 52°C, and the product length was 3589 bp;

[0137] 13V: IGHV4-31, using primers SEQ ID No. 25-26, PCR annealing temperature was 53°C, and the product length was 3575 bp;

[0138] 14V: IGHV3-30-5, using primers SEQ ID No. 27-28, PCR annealing temperature was 51°C, and the product length was 3588 bp;

[0139] 15V: IGHV4-30-4, using primers SEQ ID No. 29-30, PCR annealing temperature was 53°C, and the product length was 3575 bp;

[0140] Specifically, the PCR reaction system is 25 μl PrimeSTAR Max Premix (2X), 1 μl 10 μM upstream primer, 1 μl 10 μM downstream primer, 1 μl bacterial solution, and 22 μl nuclease-free water. The PCR reaction conditions are 98°C for 5 min; (98°C for 10 s; Tm for 15 s; 72°C for 4 min) for a total of 33 cycles; 72°C for 10 min.

[0141] The specific PCR primer design method of the present invention is as follows Figure 1 , Figure 7 The specific sequence is as follows. Upstream primer IGHV3-53-F (SEQ ID NO.1)

[0142] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCTGGACTTA

[0143] TTTTCCCAAACAAAG

[0144] Downstream primer IGHV3-53-R (SEQ ID NO.2)

[0145] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCT

[0146] ACCTTAGGACCGTTATAGTTACGGCGGCCGCTGTGTGACACCTGCACAGG

[0147] CCACTGAAGCACAGCAT

[0148] Forward primer IGHV5-51-F (SEQ ID NO.3)

[0149] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCTGTGCAGG

[0150] TGTCACACACAT

[0151] Reverse primer IGHV5-51-R (SEQ ID NO.4)

[0152] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCT

[0153] ACCTTAGGACCGTTATAGTTACGGCGGCCGCAAAGGAATATGGACCTTTT

[0154] CTTTGATTTGAGATGTTTG

[0155] Forward primer IGHV3-49-F (SEQ ID NO.5)

[0156] TCCGCGCACATTTCCTCTAGAGCAAGTGTGTCGCTGGCTAGCAGGTCCAT

[0157] ATTCCTTTTTCCA

[0158] Reverse primer IGHV3-49-R (SEQ ID NO.6)

[0159] GAAAAACGCCAGCAACGCTCTAGACTGTCAAACATGAGAATTGGTCGCT

[0160] ACCTTAGGACCGTTATAGTTACGGCGGCCGCTCCGGCTGTTTTTTCTTTAA

[0161] ATGAACAAATAGAAATAA

[0162] Upstream primer IGHV3-48-F (SEQ ID NO.7)

[0163] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCAAGAAAAA

[0164] ACAGCCGGACC

[0165] Downstream primer IGHV3-48-R (SEQ ID NO.8)

[0166] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCT

[0167] ACCTTAGGACCGTTATAGTTACGGCGGCCGCCAGAGCCTGTGCATTCTTA

[0168] CAAATGAAGGAGCCAAAT

[0169] Upstream primer IGHV1-46-F (SEQ ID NO.9)

[0170] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCAATGCACA

[0171] GGCTCTGTCA

[0172] Downstream primer IGHV1-46-R (SEQ ID NO.10)

[0173] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCT

[0174] ACCTTAGGACCGTTATAGTTACGGCGGCCGCCCTCCAGATGCCCACAGAA

[0175] CAAGAATCTATAAACTCATATC

[0176] Upstream primer IGHV1-45-F (SEQ ID NO.11)

[0177] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCGTGGGCAT

[0178] CTGGAGGG

[0179] Downstream primer IGHV1-45-R (SEQ ID NO.12)

[0180] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCT

[0181] ACCTTAGGACCGTTATAGTTACGGCGGCCGCGATTGCCCCACTGCATGGT

[0182] TGTGCCTGGAACTCATG

[0183] Upstream primer IGHV3-43-F (SEQ ID NO.13)

[0184] TCCGCGCACATTTCCGTCGACGCAAGTGTGTCGCTGGCTAGCTGCAGTGG

[0185] GGCAATCAATCT

[0186] Downstream primer IGHV3-43-R (SEQ ID NO.14)

[0187] GAAAAACGCCAGCAACGCGTCGACCTGTCAAACATGAGAATTGGTCGCT

[0188] ACCTTAGGACCGTTATAGTTACGGCGGCCGCGAAGATGCAGGTAACATGG

[0189] AAGTTTAGGAAAGTTCCACCC

[0190] Upstream primer IGHV4-39-F (SEQ ID NO.15)

[0191] TCCGCGCACATTTCCTCTAGAGCAAGTGTGTCGCTGGCTAGCCATGTTACC

[0192] TGCATCTTCAC

[0193] Downstream primer IGHV4-39-R (SEQ ID NO.16)

[0194] GAAAAACGCCAGCAACGCTCTAGACTGTCAAACATGAGAATTGGTCGCT

[0195] ACCTTAGGACCGTTATAGTTACGGCGGCCCGCTGCAGTCCAAGCTACTATT

[0196] AATTAAGTCCTAATAAAGGATAAAATGC

[0197] Upstream primer IGHV3-43D-F (SEQ ID NO.17)

[0198] TCCGCGCACATTTCCTCTAGAGCAAGTGTGTCGCTGGCTAGCAGTAGCTT

[0199] GGACTGCAGGC

[0200] Downstream primer IGHV3-43D-R (SEQ ID NO.18)

[0201] GAAAAACGCCAGCAACGCTCTAGACTGTCAAACATGAGAATTGGTCGCT

[0202] ACCTTAGGACCGTTATAGTTACGGCGGCCGCAACATGTGGGTGTAAAGAT

[0203] GAAC

[0204] Upstream primer IGHV4-38-2-F (SEQ ID NO.19)

[0205] TCCGCGCACATTTCCTCTAGAGCAAGTGTGTCGCTGGCTAGCTTACACCC

[0206] ACATGTTACCTCCATCTT

[0207] Downstream primer IGHV4-38-2-R (SEQ ID NO.20)

[0208] GAAAAACGCCAGCAACGCTCTAGACTGTCAAACATGAGAATTGGTCGCT

[0209] ACCTTAGGACCGTTATAGTTACGGCGGCCGCCTAGGAACTTTTCAGATTA

[0210] GTTAAGTCCTAATAAA

[0211] Upstream primer IGHV4-34-F (SEQ ID NO.21)

[0212] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGTCGACCTGAAAAG

[0213] TTCCTAGTTATGT

[0214] Downstream primer IGHV4-34-R (SEQ ID NO.22)

[0215] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCT

[0216] ACCTTAGGACCGTTATAGTTACGGCGGCCGCCTTTCAAGCTGTCCTGTACC TATCGTCTATTTGTTAT Upstream primer IGHV3-33-F (SEQ ID NO.23)

[0217] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCAGGACAGC

[0218] TTGAAAGAAAAT

[0219] Downstream primer IGHV3-33-R (SEQ ID NO.24)

[0220] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCTA

[0221] CCTTAGGACCGTTATAGTTACGGCGGCCGCCAGAGGTAAAGCCCCTTTAAC

[0222] ACTGTAAGAA

[0223] Upstream primer IGHV4-31-F (SEQ ID NO.25)

[0224] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCGGCTTTACC

[0225] TCTGCAGATAA

[0226] Downstream primer IGHV4-31-R (SEQ ID NO.26)

[0227] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCTA

[0228] CCTTAGGACCGTTATAGTTACGGCGGCCGCCTTTCAAGCTGTCCTACCCAG

[0229] GAGA

[0230] Forward primer IGHV3-30-5-F (SEQ ID NO.27)

[0231] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCAGGACAGC

[0232] TTGAAAGAAA

[0233] Reverse primer IGHV3-30-5-R (SEQ ID NO.28)

[0234] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCTA

[0235] CCTTAGGACCGTTATAGTTACGGCGGCCGCGCCACCAAAACCCCTTTAACA

[0236] CTGTAAGAACCTA

[0237] Forward primer IGHV4-30-4-F (SEQ ID NO.29)

[0238] TCCGCGCACATTTCCCTCGAGGCAAGTGTGTCGCTGGCTAGCGGTTTTGGT

[0239] GGCTTTACC

[0240] Reverse primer IGHV4-30-4-R (SEQ ID NO.30)

[0241] GAAAAACGCCAGCAACGCCTCGAGCTGTCAAACATGAGAATTGGTCGCTA

[0242] CCTTAGGACCGTTATAGTTACGGCGGCCGCCTTTCAAGCTGTCCTACCCAG

[0243] GA

[0244] Upstream primer pMIGH-F (SEQ ID NO.31)

[0245] GGAAATGTGCGCGGAACC

[0246] Downstream primer pMIGH-R (SEQ ID NO.32)

[0247] GCGTTGCTGGCGTTTTTCC

[0248] Upstream primer P1F (SEQ ID NO.33)

[0249] CTTCCCAGACGGTAAGCTTC

[0250] Downstream primer P1R (SEQ ID NO.34)

[0251] AAGTCTCTTCACTGTGTCTT

[0252] Upstream primer P2F (SEQ ID NO.35)

[0253] GTTGTTTAAGCCACCCA

[0254] Downstream primer P2R (SEQ ID NO.36)

[0255] CTTAGGGCAAACAGAGGC.

[0256] Example 2 Gibson assembly of pMIGH-IGHV (IV) recombinant plasmid

[0257] Using the vector pUC19 plasmid as a template, PrimeSTARMax DNA Polymerase (high-fidelity DNA polymerase) was used for PCR amplification, primers SEQ ID No. 31-32 were used, and the PCR annealing temperature was 55° C. to obtain a subcloning vector pMIGH with a product length of 1748 bp.

[0258] The single IGHV gene fragment and the subcloning vector pMIGH obtained by the above PCR amplification were added to the Gibson assembly master mix at a molar ratio of 3:1. The reaction conditions were 50°C, 20 min, and the total volume of the reaction system was 10-30 μl, preferably 10 μl. The single IGHV gene fragment and the subcloning vector pMIGH were assembled into pMIGH-IGHV by Gibson, with a total of 10 pMIGH-IGHV (1V-10V), and sequencing verified that the amplified sequence was correct. Among them, pMIGH-IGHV (1V) is taken as an example, and its recombinant plasmid schematic diagram is shown in Figure 2.

[0259] Example 3 Gibson assembly of pCC1BAC-IGHV (1-3V) recombinant plasmid

[0260] The BAC-grade vector pCC1BAC was linearized with restriction endonuclease SalI, and the upstream pMIGH-IGH1V was double-digested with restriction endonucleases XbaI (or XhoI) and NotI, the intermediate pMIGH-IGH2V was double-digested with NheI and NotI, and the downstream pMIGH-IGH3V was double-digested with NheI and XbaI (or XhoI). After the digested fragments were purified and recovered, the corresponding three digested fragments were added to Gibson assembly master mix at a molar ratio of 3:1 (the molar ratio between each digested fragment was 1:1:1), and the reaction conditions were 50°C, 1h, and the total volume of the reaction system was 10-30μl, preferably 10μl. pCC1BAC-IGHV (4-6V) and pCC1BAC-IGHV (7-10V) were prepared in a similar manner.

[0261] Take 10 μl of the reaction product and transform 100 μl of competent cells according to the standard method.

[0262] The competent cells transformed in step 7 were evenly spread on LB agar plates containing the corresponding antibiotics and cultured at 37°C for 12-16 hours. The single colonies grown on the plates were identified by PCR, and the plasmids were extracted and sequenced to verify that the correct assembly products were obtained.

[0263] Through chloramphenicol resistance screening, according to the above method, five assembly products pCC1BAC-IGHV (1-3V), pCC1BAC-IGHV (4-6V), pCC1BAC-IGHV (7-10V), pCC1BAC-IGHV (11-13V), and pCC1BAC-IGHV (14-15V) were obtained respectively. Among them, the schematic diagram of the pCC1BAC-IGHV (1-3V) recombinant plasmid is shown in Figure 3 , other construction methods are similar.

[0264] Example 4 Gibson assembly of pCC1BAC-IGHV (1-15V) recombinant plasmid

[0265] Specifically, pCC1BAC-IGHV (1-3V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV (4-6V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV (1-6V) by Gibson. The schematic diagram of the recombinant plasmid is shown in Figure 4 .

[0266] Specifically, pCC1BAC-IGHV (11-13V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV (14-15V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV (11-15V) by Gibson assembly.

[0267] Specifically, pCC1BAC-IGHV (1-6V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV (7-10V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV (1-10V) by Gibson. The schematic diagram of the recombinant plasmid is shown in Figure 5 The results of PCR identification and restriction enzyme digestion identification of the pCC1BAC-IGHV (1-10V) recombinant plasmid are shown in Figure 6 . After pCC1BAC-IGHV(1-10V) was recombined, 9 single clone colonies were selected for PCR identification. The amplified fragment was the sequence at the junction of IGHV(6V) and IGHV(7V). Primers SEQ ID No.33-34 were used, the PCR annealing temperature was 53°C, and the product length was 533bp; specifically, the PCR reaction system was 10μl TaqPCR StarMix with Loading Dye-Blue(2X), 0.4μl 10μM upstream primer, 0.4μl 10μM downstream primer, 1μl bacterial solution, and 8.2μl nuclease-free water. The PCR reaction conditions were 94℃2min; (94℃30s; Tm 30s; 72℃1min) for a total of 33 cycles; 72℃10min. The gel electrophoresis results of the PCR products are as follows. Figure 6 As shown in A, the 2nd and 7th single colonies were positive, and the rest were negative. Figure 6 B is the restriction enzyme cutting simulation diagram of pCC1BAC-IGHV(1-6V), pCC1BAC-IGHV(7-10V), and pCC1BAC-IGHV(1-10V) recombinant plasmids at the restriction enzyme XhoI site (SnapGene software (Version 5.2.3)). The pCC1BAC-IGHV(1-10V) recombinant plasmid was digested with restriction enzyme XhoI. The reaction conditions were 37°C water bath. The fragments after digestion were 14797bp, 14213bp, 6776bp, and 5742bp. The bands of electrophoresis after digestion were correct. The results are as follows Figure 6 As shown in C.

[0268] Specifically, pCC1BAC-IGHV (1-10V) was linearized using restriction endonuclease NotI, pCC1BAC-IGHV (11-15V) was double-digested with restriction endonucleases SalI and I-CeuI, and assembled into pCC1BAC-IGHV (1-15V) by Gibson assembly. The schematic diagram of the pCC1BAC-IGHV (1-15V) recombinant plasmid is shown in Fig. 9 The results of PCR identification and enzyme digestion are shown in Figure 8 . After pCC1BAC-IGHV(1-15V) was recombined, 10 single colonies were selected for PCR identification. The amplified fragment was the sequence at the junction of IGHV(10V) and IGHV(11V). Primers SEQ ID No.35-36 were used, the PCR annealing temperature was 50°C, and the product length was 498bp; specifically, the PCR reaction system was 10μl TaqPCR StarMix with Loading Dye-Blue(2X), 0.4μl 10μM upstream primer, 0.4μl 10μM downstream primer, 1μl bacterial solution, and 8.2μl nuclease-free water. The PCR reaction conditions were 94℃2min; (94℃30s; Tm 30s; 72℃1min) for a total of 33 cycles; 72℃10min. The gel electrophoresis results of the PCR products are as follows. Figure 8 As shown in A, from left to right, the 1st, 2nd, 3rd, 5th, 7th, 9th, and 10th colonies were positive, and the rest were negative. The pCC1BAC-IGHV (1-15V) recombinant plasmid was digested with restriction enzyme XhoI. The reaction conditions were 37°C water bath. The fragments after digestion were 22959bp, 14797bp, 14213bp, and 6776bp. The bands of electrophoresis after digestion were correct. The results are as follows Figure 8 As shown in B.

[0269] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for assembling IGHV region loci based on Gibson assembly, characterized in that: The following steps are involved: Step 1. Obtain a strain or sequence covering the IGH variable region V region locus as a PCR amplification template; Step 2. Design upstream and downstream specific PCR primers for amplifying each target gene fragment. The sequence of the specific PCR primer has the following structure: (1) Gibson homology arm sequence upstream of pMIGH; (2) Recognition sequence a of restriction endonuclease; (3) pCC1BAC upstream Gibson homology arm sequence and restriction endonuclease recognition sequence b; (4) a target sequence that can bind to the sequence of the target gene fragment and be used to specifically amplify the target gene fragment; (5) the Gibson homology arm sequence of the next adjacent target gene fragment to be assembled and the recognition sequence c of the restriction endonuclease; (7) Iterate Gibson homology arm sequence, restriction endonuclease recognition sequence d; (8) Gibson homology arm sequence downstream of pCC1BAC, recognition sequence of restriction endonuclease e; (9) Gibson homology arm sequence downstream of pMIGH; Step 3. Perform PCR amplification using the primers and PCR amplification template described in step (2) to obtain the corresponding single target gene fragments, and transform the universal vector pUC19 into a subcloning vector to obtain the subcloning vector fragment pMIGH by amplification; each single target gene fragment is respectively combined with the subcloning vector fragment pMIGH to obtain the corresponding pMIGH-IGHV plasmid by Gibson assembly; Step 4. From the pMIGH-IGHV plasmid described in step 3, the pMIGH-IGHV plasmid described in step 3 is digested with a restriction endonuclease and the IGHV target gene fragment is recovered. According to the order of the genes to be assembled, 2-3 adjacent target gene fragments are respectively combined with the linearized assembly vector backbone by Gibson assembly to obtain multiple pCC1BAC-IGHV (V to V+1 or V+2 or V+3) plasmids, wherein V is the corresponding order of each target gene fragment at the target locus; Step 5. Use restriction endonucleases for linearization and double digestion, and assemble the adjacent plasmids obtained in step 4 by Gibson assembly to obtain assembly products.

2. The method for assembling IGHV region loci based on Gibson assembly according to claim 1, characterized in that: The steps 4 and 5 are as follows: Step 4. From the pMIGH-IGHV plasmid described in step 3, the pMIGH-IGHV plasmid described in step 3 is digested with a restriction endonuclease and the IGHV target gene fragment 1V-15V is recovered, and the linearized assembly vector backbone is assembled by Gibson assembly to obtain pCC1BAC-IGHV (1-3V) plasmid, pCC1BAC-IGHV (4-6V) plasmid, pCC1BAC-IGHV (7-10V), pCC1BAC-IGHV (11-13V), and pCC1BAC-IGHV (14-15V) plasmid; Step 5. Linearize pCC1BAC-IGHV (1-3V) with restriction endonuclease NotI, double-digest pCC1BAC-IGHV (4-6V) with restriction endonucleases NheI and I-CeuI, and assemble into pCC1BAC-IGHV (1-6V) by Gibson assembly; pCC1BAC-IGHV(11-13V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV(14-15V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV(11-15V) by Gibson assembly; pCC1BAC-IGHV (1-6V) was linearized with restriction endonuclease NotI, pCC1BAC-IGHV (7-10V) was double-digested with restriction endonucleases NheI and I-CeuI, and assembled into pCC1BAC-IGHV (1-10V) by Gibson to obtain an assembly product; pCC1BAC-IGHV (1-10V) was linearized with restriction endonuclease NotI, and pCC1BAC-IGHV (11-15V) was double-digested with restriction endonucleases SalI and I-CeuI, and assembled into pCC1BAC-IGHV (1-15V) by Gibson to obtain the assembly product.

3. The method for assembling IGHV region loci based on Gibson assembly according to claim 1, characterized in that: The restriction endonuclease is selected from one or two of XbaI, XhoI, NotI, NheI and I-CeuI. More preferably, the recognition sequence a corresponds to the restriction endonuclease XbaI or XhoI, the recognition sequence b corresponds to the restriction endonuclease NheI or SalI, the recognition sequence c corresponds to the restriction endonuclease NotI, the recognition sequence d corresponds to the restriction endonuclease I-CeuI, and the recognition sequence e corresponds to the restriction endonuclease XbaI or XhoI.

4. The method for assembling IGHV region loci based on Gibson assembly according to claim 1, characterized in that: The sequences of the specific PCR primers are as follows: For the target gene fragment SEQ ID No.1-SEQ ID No.2 of 1V; SEQ ID No.3-SEQ ID No.4 for the target gene fragment 2V; SEQ ID No.5-SEQ ID No.6 for the target gene fragment 3V; SEQ ID No.7-SEQ ID No.8 for the target gene fragment 4V; SEQ ID No.9-SEQ ID No.10 for the target gene fragment of 5V; SEQ ID No.11-SEQ ID No.12 for the target gene fragment 6V; SEQ ID No.13-SEQ ID No.14 for the target gene fragment 7V; SEQ ID No.15-SEQ ID No.16 for the target gene fragment 8V; SEQ ID No.17-SEQ ID No.18 for the target gene fragment 9V; SEQ ID No.19-SEQ ID No.20 for the target gene fragment 10V; SEQ ID No.21-SEQ ID No.22 for the target gene fragment 11V; SEQ ID No.23-SEQ ID No.24 for the target gene fragment 12V; SEQ ID No.25-SEQ ID No.26 for the target gene fragment 13V; SEQ ID No.27-SEQ ID No.28 for the target gene fragment 14V; SEQ ID No.29-SEQ ID No.30 for the target gene fragment 15V; And / or the amplified target gene fragments include the following: The target gene fragment is 1V: IGHV3-53, The target gene fragment is 2V: IGHV5-51, The target gene fragment is 3V: IGHV3-49, The target gene fragment is 4V: IGHV3-48, The target gene fragment is 5V: IGHV1-46, The target gene fragment is 6V: IGHV1-45, The target gene fragment is 7V: IGHV3-43, The target gene fragment is 8V: IGHV4-39, The target gene fragment is 9V: IGHV3-43D, The target gene fragment is 10V: IGHV4-38-2, The target gene fragment is 11V: IGHV4-34, The target gene fragment is 12V: IGHV3-33, The target gene fragment is 13V: IGHV4-31, The target gene fragment is 14V: IGHV3-30-5, The target gene fragment is 15V:IGHV4-30-4.

5. The method for assembling IGHV region loci based on Gibson assembly according to claim 1, characterized in that: The pMIGH vector used for cloning the IGHV gene fragment is modified from the pUC19 cloning vector or other commercial cloning vectors; preferably, the primers used for amplification to obtain the subcloning vector fragment pMIGH are SEQ ID No.31-SEQ ID No.

32.

6. The method for assembling IGHV region loci based on Gibson assembly according to claim 1, characterized in that: In step 4, the BAC-grade vector pCC1BAC is linearized using the restriction endonuclease SalI; and / or pMIGH-IGH1V is double-digested with restriction endonucleases XbaI (or XhoI) and NotI, pMIGH-IGH2V is double-digested with NheI and NotI, and pMIGH-IGH3V is double-digested with NheI and XbaI or XhoI. After the digested fragments are purified and recovered, the obtained digested fragments are added to Gibson assembly mastermix at a molar ratio of 3:1, and a Gibson assembly reaction is performed to obtain a pCC1BAC-IGHV (1-3V) plasmid; and / or the assembly vector skeleton of the immunoglobulin variable region locus used for the transformation is a pCC1BAC vector, or other vector skeletons that can be used to construct a BAC library.

7. A specific PCR primer for assembly of IGHV region loci based on Gibson assembly, characterized in that, The specific PCR primer has the following structure from 5' to 3': (1) pMIGH upstream homology arm sequence; (2) Recognition sequence a of restriction endonuclease; (3) pCC1BAC upstream homology arm sequence and restriction endonuclease recognition sequence b; (4) a target sequence that can bind to the sequence of the target gene fragment and be used to specifically amplify the target gene fragment; (5) the Gibson homology arm sequence of the next adjacent target gene fragment to be assembled and the recognition sequence c of the restriction endonuclease; (7) Iterate Gibson homology arm sequence, restriction endonuclease recognition sequence d; (8) pCC1BAC downstream homology arm sequence, restriction endonuclease recognition sequence e; (9) Gibson homology arm sequence downstream of pMIGH.

8. The specific PCR primer according to claim 8, characterized in that The sequences of the specific PCR primers are shown as SEQ ID No.1-SEQ ID No.

30.

9. The IGHV region locus obtained according to the preparation method of claims 1-6.

10. Use of the IGHV region locus according to claim 9 in preparing diverse antibodies.

Images