Method for improving photosynthesis capacity of plants

Abstract

The invention discloses a method for improving photosynthesis capacity of plants. By respectively constructing a PMI1 protein overexpression transgenic rice line and a PMI1 protein function deletion mutant rice line and measuring the net photosynthetic rate, stomatal conductance and the like of the obtained lines under a normal illumination condition, the invention finds that the photosynthesis capability of the rice can be improved by promoting the expression of the PMI1 protein in the rice; the net photosynthetic rate, stomatal conductance and chlorophyll content of the rice are improved, and meanwhile, the rice yield is not affected. Therefore, the invention provides a method for improving the photosynthesis capacity of the plant, namely the photosynthesis capacity of the plant is improved by overexpressing the PMI1 protein in the plant. The method is beneficial to cultivation of plant varieties with improved photosynthesis capability.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and more specifically relates to a method for improving the photosynthesis capacity of plants. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world, supplying the staple food needs of 50% of the world's population. In recent years, with the continuous decline in rice planting area and the continuous growth of population, food security issues have gradually become prominent, and increasing rice yield has become an important way to solve the problem of food security.

[0003] At present, the harvest index of gramineous crops such as rice and wheat is close to the theoretical upper limit. Photosynthesis is the basis of plant growth and yield formation. Improving the efficiency of leaf light energy conversion can increase the efficiency of crop utilization of light energy and carbon dioxide on the one hand, and on the other hand, it can also increase the biomass and yield of crops. Leaf light energy conversion efficiency refers to the proportion of light energy absorbed by leaves converted into chemical energy through photosynthesis. The level of leaf light energy conversion efficiency depends to a large extent on the photosynthetic capacity of leaves, including the photosynthetic rate and stomatal conductance of leaves. Increasing the photosynthetic rate of leaves is an important goal of high-yield and high-efficiency breeding. In addition, stomata are the main channel for carbon dioxide to enter and exit plants, and are a major goal of improving photosynthetic efficiency. Improving plant stomatal characteristics, such as stomatal conductance, is the main measure to reduce the limitation of stomatal on photosynthetic efficiency.

[0004] In summary, it is necessary to continuously explore the proteins involved in regulating the photosynthesis capacity of plants, in order to cultivate crop varieties with improved photosynthesis capacity through molecular breeding, increase crop yields, and ensure food security. Summary of the invention

[0005] The present invention provides a method for improving the photosynthesis capacity of plants by utilizing PMI1 protein in order to enrich the protein library involved in regulating the photosynthesis capacity of plants and improve the photosynthesis capacity of plants.

[0006] The first object of the present invention is to provide a method for improving the photosynthetic capacity of plants.

[0007] The second object of the present invention is to provide the use of PMI1 protein in regulating the photosynthesis ability of plants.

[0008] The third object of the present invention is to provide an application of an expression promoter of PMI1 protein in improving the photosynthesis capacity of plants.

[0009] The fourth object of the present invention is to provide the use of an expression promoter of PMI1 protein in the preparation of a product for improving the photosynthesis capacity of plants.

[0010] A fifth object of the present invention is to provide an application of an expression promoter of PMI1 protein in constructing a plant strain with improved photosynthesis ability.

[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0012] The present invention constructs a PMI1 protein overexpression transgenic rice strain and a PMI1 protein function-deficient mutant rice strain respectively and measures the net photosynthetic rate, stomatal conductance, etc. of the obtained strains under normal light conditions, and finds that promoting the expression of PMI1 protein in rice can improve the photosynthetic capacity of rice, the net photosynthetic rate, stomatal conductance and chlorophyll content of rice, and does not affect the rice yield. Therefore, the present invention provides a method for improving the photosynthetic capacity of plants.

[0013] Specifically, the method for improving the photosynthesis capacity of plants is: over-expressing PMI1 protein in plants.

[0014] Specifically, the amino acid sequence of the PMI1 protein is shown in SEQ ID NO.1.

[0015] Specifically, the overexpression of PMI1 protein in plants is achieved by constructing a recombinant expression vector containing a gene encoding PMI1 protein and transforming the plant. Specifically, the cDNA sequence of the gene encoding PMI1 protein is shown in SEQ ID NO.2.

[0016] Specifically, the promoter region and gDNA sequence of the gene encoding the PMI1 protein are shown in SEQ ID NO.3.

[0017] Specifically, the recombinant expression vector contains a constitutive strong promoter, which can overexpress the target gene.

[0018] Optionally, the constitutive strong promoter is a maize ubiquitin gene promoter (P ubi ).

[0019] In a specific embodiment of the present invention, the vector used to construct the recombinant expression vector is the pCambia1300-pOX vector, which is based on the pCambia1300 vector and has a maize ubiquitin gene promoter (P ubi ) can be transformed.

[0020] Specifically, the transformation is achieved using Agrobacterium-mediated genetic transformation methods.

[0021] Optionally, the Agrobacterium is Agrobacterium EHA105.

[0022] Specifically, the photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

[0023] Specifically, the plant is a grass plant.

[0024] Specifically, the grass plant is rice.

[0025] At the same time, the present invention seeks to protect the use of PMI1 protein in regulating the photosynthesis ability of plants.

[0026] Specifically, the amino acid sequence of the PMI1 protein is shown in SEQ ID NO.1.

[0027] Specifically, the photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

[0028] Specifically, the plant is a grass plant.

[0029] Specifically, the grass plant is rice.

[0030] Since overexpression of the PMI1 protein with an amino acid sequence such as that shown in SEQ ID NO. 1 in plants can improve the photosynthesis capacity of plants, the present invention also seeks to protect the use of an expression promoter of the PMI1 protein in improving the photosynthesis capacity of plants.

[0031] The present invention also claims to protect the use of the expression promoter of PMI1 protein in preparing a product for improving the photosynthesis capacity of plants.

[0032] The present invention also claims to protect the use of an expression promoter of PMI1 protein in constructing a plant strain with improved photosynthesis ability.

[0033] Specifically, the photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

[0034] Specifically, the plant is a grass plant.

[0035] Specifically, the grass plant is rice.

[0036] Optionally, the expression promoter is a recombinant expression vector containing a gene encoding the PMI1 protein or a genetically engineered bacterium containing a recombinant expression vector containing a gene encoding the PMI1 protein.

[0037] Specifically, the recombinant expression vector contains a constitutive strong promoter, which can overexpress the target gene.

[0038] Optionally, the constitutive strong promoter is a maize ubiquitin gene promoter.

[0039] In a specific embodiment of the present invention, the vector used to construct the recombinant expression vector is pCambia1300-pOX vector, which is obtained by inserting the maize ubiquitin gene promoter after the promoter P35s on the basis of the pCambia1300 vector.

[0040] The present invention has the following beneficial effects:

[0041] The present invention constructs a transgenic rice strain with overexpression of PMI1 protein and a mutant rice strain with loss of function of PMI1 protein respectively and measures the net photosynthetic rate, stomatal conductance, etc. of the obtained strains under normal light conditions, and finds that promoting the expression of PMI1 protein in rice can improve the photosynthetic capacity of rice, improve the net photosynthetic rate, stomatal conductance and chlorophyll content of rice, and will not affect the rice yield. Therefore, the present invention provides a method for improving the photosynthetic capacity of plants, that is, improving the photosynthetic capacity of plants by overexpressing PMI1 protein in plants. The present invention is conducive to the cultivation of plant varieties with improved photosynthetic capacity. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the electrophoresis detection result of the PCR amplification product of the OsPMI1 gene cDNA sequence.

[0043] Figure 2 Schematic diagram of the structure of the pCambia1300-pOX vector.

[0044] Figure 3 This is the PCR test result of the T0 generation transformed plants described in Example 1.

[0045] Figure 4 The expression level of OsPMI1 gene in the T2 homozygous strains OEPMI1-32 and OEPMI1-33 described in Example 1 was detected.

[0046] Figure 5 The results of photosynthesis analysis of PMI1 protein overexpression transgenic rice lines, PMI1 protein function loss mutant rice lines and wild-type rice lines under clear and cloudless conditions. Figure 5 A to E in the figure are the analysis results of the net photosynthetic rate (Net Photosynthetic net), stomatal conductance (Cond), light saturation phenomenon (lightsaturation), light compensation point (light compensation point) and light saturation point (Amax) of each strain respectively; in the figure, *p<0.05; **p<0.01; ***p<0.001.

[0047] Figure 6These are the stomatal scanning results of PMI1 protein overexpressing transgenic rice lines, PMI1 protein loss-of-function mutant rice lines, and wild-type rice lines under clear and cloudless conditions; ***p<0.001.

[0048] Figure 7 is the total chlorophyll content of PMI1 protein overexpressing transgenic rice lines, PMI1 protein function-deficient mutant rice lines and wild-type rice lines; A in the figure is the total chlorophyll content of each line at the flowering stage; B in the figure is the total chlorophyll content of each line at the maturity stage; **p<0.01; ***p<0.001.

[0049] Figure 8 These are the results of leaf starch staining of PMI1 protein overexpressing transgenic rice lines, PMI1 protein loss-of-function mutant rice lines, and wild-type rice lines at the flowering stage.

[0050] Fig. 9 The results of yield trait analysis of PMI1 protein overexpressing transgenic rice lines, PMI1 protein function-deficient mutant rice lines and wild-type rice lines; A to D in the figure respectively represent the grain width, plant height, tiller number and plot yield of the lines; ***p<0.001 in the figure. DETAILED DESCRIPTION

[0051] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0052] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0053] The PMI1 protein described in the embodiment of the present invention is rice PMI1 protein (OsPMI1), whose amino acid sequence is shown in SEQ ID NO.1; the cDNA sequence of the OsPMI1 gene encoding the protein is shown in SEQ ID NO.2; the promoter region and gDNA sequence of the OsPMI1 gene are shown in SEQ ID NO.3.

[0054] Example 1 Construction of PMI1 protein overexpressing transgenic rice lines

[0055] 1. Cloning of OsPMI1 gene cDNA sequence

[0056] In order to amplify the cDNA sequence of the rice PMI1 gene (OsPMI1) (shown in SEQ ID NO.2), the present invention designed corresponding PCR amplification primers, and the nucleotide sequences (5'-3') of the designed primers are as follows:

[0057] OsPMI1F:AAGCTTACTAGTACGATGGCGGACGACGGCAAGAG

[0058] OsPMI1R: TGATAGGATCCATAACGCTTGAGAGGGATCTTCACGT

[0059] The cloning process of the OsPMI1 gene cDNA sequence is as follows:

[0060] Total RNA from the seedling leaves of the rice variety Nanguizhan was extracted using TriZol Reagent (Invitrogen, catalog number: 15596026), and the purity and concentration of the extracted total RNA were detected using an ultraviolet spectrophotometer. 1 μg of total RNA with purity and concentration that met the experimental requirements was taken for reverse transcription reaction; the enzyme used in the reverse transcription reaction was AMV reverse transcriptase from TAKARA, and the operating steps of the reverse transcription reaction referred to the instruction manual of the reverse transcriptase used; the product obtained from the reverse transcription reaction was used as a template, and PCR amplification was performed using primers OsPMI1F and OsPMI1R; the polymerase used in the PCR reaction was KOD FX from Toyobo, and the PCR reaction system was prepared according to the instruction manual of KOD FX; the PCR reaction conditions were: 94°C for 3 min; 94°C for 30 sec, 60°C for 30 sec, 68°C for 150 sec, 35 cycles; 68°C for 5 min; the PCR amplification products were detected by electrophoresis and transformed and sequenced.

[0061] The electrophoresis results of the PCR amplification products of the OsPMI1 gene cDNA sequence are as follows Figure 1 As shown. Figure 1 It can be seen that the present invention amplified a single band of the same size. At the same time, from the sequencing results, it can be seen that the present invention successfully amplified the OsPMI1 gene cDNA sequence shown in SEQ ID NO.2.

[0062] 2. Construction of recombinant expression vector

[0063] The PCR amplification product of the OsPMI1 gene cDNA sequence recovered from the gel was used to separate the PCR amplification product and the pCambia1300-pOX vector (based on the pCambia1300 vector, the maize ubiquitin gene promoter (P ubi ) is transformed, and its structural diagram is shown in Figure 2The enzyme digestion product was recovered by enzyme digestion with homologous recombination enzyme, and the fragments after enzyme digestion and the linearized vector were connected. The connection system was: 5 μL of homologous recombination enzyme, 3 μL (200 ng) of cDNA fragments after enzyme digestion, and 2 μL (50 ng) of linearized pCambia1300-poX vector. The connection conditions were: 50°C connection for 5 min; 10 μL of the connection product was taken and transformed into Escherichia coli DH5α competent cells by heat shock transformation method, and the transformation product was spread on LB solid culture medium containing kanamycin resistance; after culturing at 37°C overnight, 10 single clones were selected to extract plasmids, and enzyme digestion and sequencing were performed for identification.

[0064] The nucleotide sequences (5'-3') of the primers used for sequencing identification are as follows:

[0065] OsPMI1 TF:ACTTCGAGGAGACGCTCTTC

[0066] R2: CGATCTAGTAACATAGATGACAC

[0067] The results of enzyme digestion and sequencing identification show that the present invention successfully constructed a recombinant expression vector containing the OsPMI1 gene cDNA sequence shown in SEQ ID NO.2, which can be used to construct a PMI1 protein overexpressing transgenic rice strain.

[0068] 3. Construction of PMI1 protein overexpressing transgenic rice lines

[0069] In this example, the genetic transformation method mediated by Agrobacterium EHA105 was used to transfer the constructed recombinant expression vector into the callus tissue of the wild-type indica rice variety Nanguizhan (NGZ). The specific method was carried out with reference to the literature (Zhou Lingyan, Jiang Dagang, Wu Hao, et al. Establishment of rice transformation system based on TAC vector [J]. Journal of Genetics, 2005, 32(005): 514-518.). After screening, pre-differentiation and differentiation, this example obtained 6 T0 generation transformed plants, and PCR detection was performed on the T0 generation transformed plants to identify whether they were positive transformed plants at the DNA level.

[0070] The nucleotide sequences (5'-3') of the primers used for PCR detection are as follows:

[0071] Primer 1: GACAGCGTCTCCGACCTGAT

[0072] Primer 2: CATCGCCTCGCTCCAGTCAAT

[0073] The reaction system used for PCR detection is shown in Table 1 below:

[0074] Table 1

[0075]

[0076] The reaction conditions used for PCR detection were: 94°C for 2 min; 94°C for 20 sec, 58°C for 20 sec, 72°C for 30 sec, 30 cycles; 72°C for 5 min.

[0077] After the PCR reaction is completed, the PCR amplification product is detected by 1% agarose gel electrophoresis. If the sample is a positive transformed plant, a single band of about 600 bp can be amplified. The PCR detection results of the T0 generation transformed plants are as follows: Figure 3 As shown. Figure 3 It can be seen that the T0 generation transformed plants obtained in this example are all positive transformed plants.

[0078] The obtained T0 generation positive transformed plants were self-pollinated to obtain transgenic 1 (T1) generation strains. Ten plants that tested positive by PCR were selected from each strain for self-pollination to obtain T2 generation strains. The T2 generation strains were further subjected to PCR testing to obtain two T2 generation homozygous strains derived from different T0 generation plants, which were named OEPMI1-32 and OEPMI1-33 respectively.

[0079] Total RNA was extracted from the flag leaves of the T2 homozygous lines OEPMI1-32 and OEPMI1-33 at the flowering stage and reverse transcribed to obtain cDNA. The obtained cDNA was used as a template for qPCR detection to detect the expression changes of the target gene OsPMI1. The detection results of the wild-type NGZ plants were used as a control, and the internal reference gene was Actin.

[0080] The nucleotide sequences (5'-3') of the primers used for qPCR detection are as follows:

[0081] Primer F: TTGCGAGGCATTGACGACTT

[0082] Primer R: GGAACTCCGAGTCATCGACC

[0083] Internal reference primer F: CACATTCCAGCAGATGTGGA

[0084] Internal reference primer R: GCGATAACAGCTCCTCTTGG

[0085] The reaction system and conditions used for qPCR are shown in Tables 2 and 3 respectively:

[0086] Table 2 Reaction system used for qPCR

[0087]

[0088] Table 3 qPCR reaction conditions

[0089]

[0090] The expression results of OsPMI1 gene in T2 homozygous lines OEPMI1-32 and OEPMI1-33 are shown in Figure 4 As shown. Figure 4 It can be seen that the OsPMI1 gene is highly expressed in strains OEPMI1-32 and OEPMI1-33, and is lowly expressed in the wild-type strain, indicating that the present invention successfully constructed a transgenic rice strain overexpressing PMI1 protein.

[0091] Example 2 Construction of PMI1 protein function loss mutant rice lines

[0092] In this example, the method in the reference document (Ma X, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot Plants. Mol Plant [J], 2015, 8 (8): 1274-1284) was used to construct a PMI1 protein function-deficient mutant rice strain using the CRISPR / Cas9 gene editing system.

[0093] For the OsPMI1 gene, the adapter primers designed by the present invention are shown below. After the designed adapter primers are synthesized, they are connected to the gRNA expression cassette to the pYLCRISPR / Cas9 vector, and the obtained vector is transferred into the callus tissue of the wild-type indica rice variety Nanguizhan (NGZ). After screening, differentiation and rooting into seedlings, the PMI1 protein function-deficient mutant rice strains are screened by sequencing identification.

[0094] Designed adapter primers:

[0095] CasPMI1U3T1F:ggcaGCCCCGGCCGTTCCTCCTGT

[0096] CasPMI1U3T1R:aaacACAGGAGGAACGCCGGGGGC

[0097] CasPMI1U6bT2F:gttgCTGTTCCAGCAGCTGTGCGC

[0098] CasPMI1U6bT2R:aaacGCGCACAGCTGCTGGAACAG

[0099] Through sequencing and identification, the present invention successfully constructed two PMI1 protein function-deficient mutant rice strains, which were named Caspmi-1 and Caspmi-6 respectively.

[0100] Example 3 Photosynthesis Capacity Analysis and Yield Trait Identification

[0101] 1. Analysis of photosynthesis capacity

[0102] In order to analyze the effect of OsPMI1 gene on the photosynthesis capacity of rice, this example used PMI1 protein overexpression transgenic rice lines OEPMI1-32 and OEPMI1-33, PMI1 protein function loss mutant rice lines Caspmi-1 and Caspmi-6, and wild-type NGZ rice plants at the flowering stage, and analyzed the photosynthesis efficiency of each plant under clear and cloudless conditions using Li-cor6400 XT portable photosynthesis instrument. Among them, the following light intensity gradients were set from high to low: 1500, 1200, 1000, 800, 600, 400, 200, 150, 100, 50, 20 and 0; Minimum wait time (secs) was set to 120; Maximum wait time (secs) was set to 200; Match if |ΔCO2| less than (ppm) was set to 20 or 15, and automatic measurement was entered, and the measurement was waited for to end.

[0103] According to the above steps, the Pn-PAR response curve was measured using a Li-cor6400 XT portable photosynthetic instrument from 8:00 to 12:00, using a Li-6400-02B red and blue light source. The measurement was carried out continuously for one day on a sunny day, and three replicates were measured for each strain to measure the net photosynthetic rate (Pn, μmol·m -2 ·s -1 ), stomatal conductance (Gs, mmol·m -2 ·s -1 ), intercellular CO2 concentration (Ci, μmol / mol) and other photosynthetic parameters. In addition, under clear and cloudless conditions, the stomata of PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33, PMI1 protein function loss mutant rice lines Caspmi-1 and Caspmi-6, and wild type NGZ were scanned and observed after photosynthesis.

[0104] Under clear and cloudless conditions, the results of photosynthesis analysis of PMI1 protein overexpression transgenic rice lines, PMI1 protein function loss mutant rice lines and wild-type rice lines are shown in the figure. Figure 5 As shown, Figure 5A to E in the figure are the analysis results of net photosynthetic rate (Net Photosynthetic net), stomatal conductance (Cond), light saturation phenomenon (light saturation), light compensation point (light compensation point) and light saturation point (Amax). Figure 5 It can be seen that the photosynthesis efficiency, stomatal conductance, intercellular carbon dioxide concentration and photosynthesis saturation point of PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 are all higher than those of the wild type.

[0105] Under clear and cloudless conditions, the stomatal scanning results of PMI1 protein overexpressing transgenic rice lines, PMI1 protein function loss mutant rice lines and wild-type rice lines are shown in the figure. Figure 6 As shown. Figure 6 It can be seen that the number of stomata in the leaves of the PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 is greater, and the reason for their higher stomatal conductance may be the increase in the number of stomata.

[0106] The total chlorophyll contents of PMI1 protein overexpressing transgenic rice lines, PMI1 protein function-deficient mutant rice lines and wild-type rice lines at flowering stage and maturity stage were shown in Figure 2 Figure 7 As shown in A and B. Figure 7 It can be seen that the total chlorophyll content of PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 at the flowering stage and maturity stage was higher than that of the wild type, while the total chlorophyll content of PMI1 protein function-deficient mutant rice lines Caspmi-1 and Caspmi-6 was not significantly different from that of the wild type, indicating that the leaves of the overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 have better photosynthesis potential.

[0107] The present invention simultaneously performs starch staining on leaves of PMI1 protein overexpressing transgenic rice lines, PMI1 protein function-deficient mutant rice lines and wild-type rice lines at the flowering stage to observe the accumulation of photosynthesis products in the leaves.

[0108] Leaf starch staining: Take leaves that have been breathing overnight at 6 am, and take leaves that have completed photosynthesis for a day at 6 pm, and stain them with starch to detect the accumulated products of leaf photosynthesis. Add 8.8g of potassium iodide to 30mL of preheated double distilled water, stir slowly, and add 2.2g of crystalline iodine after dissolving, shake thoroughly until completely dissolved, and then use double distilled water to make up to 1L to obtain iodine-potassium iodide (I2-KI). The materials retrieved from the field are placed in 95% ethanol for 24 to 48 hours. After complete decolorization, stain with I2-KI, take out after about 20 minutes, observe and take pictures.

[0109] The starch staining results of leaves of PMI1 protein overexpressing transgenic rice lines, PMI1 protein function-deficient mutant rice lines and wild-type rice lines at the flowering stage are shown in Figure 2. Figure 8 As shown. Figure 8 It can be seen that after one day of photosynthesis, the leaves of the PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33 accumulated more products (using starch as a reference).

[0110] The above results indicate that overexpression of PMI1 protein can improve the photosynthesis capacity of rice leaves and increase the accumulation of photosynthesis products.

[0111] 2. Identification of yield traits

[0112] Several plump seeds of PMI1 protein overexpressing transgenic rice lines OEPMI1-32 and OEPMI1-33, PMI1 protein function loss mutant rice lines Caspmi-1 and Caspmi-6, and wild type NGZ were taken and water-soaked. After the seeds germinated, they were clamped on 96-well plates for hydroponics. After the seedlings formed, they were planted in field net houses and cultured to maturity. During this period, phenotypic observations and yield trait analysis (counting the tillering number of rice plants, plot yield, plant height and seed width) were carried out.

[0113] The yield trait analysis results of PMI1 protein overexpression transgenic rice lines, PMI1 protein function loss mutant rice lines and wild-type rice lines are shown in Figure 2. Fig. 9 As shown, Fig. 9 A to D in the figure are the grain width, plant height, tillering number and plot yield of each strain. Fig. 9 It can be seen that overexpression of PMI1 protein can maintain the plot yield and tiller number of rice while improving photosynthesis, thereby maintaining the stability of rice yield, while functional knockout of OsPMI1 gene will significantly reduce the grain width of rice.

[0114] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for improving the photosynthesis capacity of plants, characterized in that: The method is to over-express the PMI1 protein with an amino acid sequence as shown in SEQ ID NO.1 in plants.

2. The method according to claim 1, characterized in that: The overexpression of PMI1 protein in plants is achieved by constructing a recombinant expression vector containing a gene encoding PMI1 protein and transforming the plant.

3. The method according to claim 2, characterized in that: The cDNA sequence of the gene encoding the PMI1 protein is shown as SEQ ID NO.

2.

4. Application of the PMI1 protein with the amino acid sequence shown in SEQ ID NO.1 in regulating the photosynthesis capacity of plants.

5. Use of an expression promoter of the PMI1 protein with an amino acid sequence as shown in SEQ ID NO.1 in improving the photosynthesis capacity of plants.

6. Use of an expression promoter of the PMI1 protein having an amino acid sequence as shown in SEQ ID NO. 1 in the preparation of a product for improving the photosynthesis capacity of plants.

7. Use of an expression promoter of the PMI1 protein having an amino acid sequence as shown in SEQ ID NO.1 in constructing a plant strain with improved photosynthesis ability.

8. The method according to any one of claims 1 to 3 or the use according to any one of claims 4 to 7, characterized in that: The photosynthetic capacity includes net photosynthetic rate, stomatal conductance and / or chlorophyll content.

9. The method according to any one of claims 1 to 3 or the use according to any one of claims 4 to 7, characterized in that: The plant is a grass plant.

10. The use according to any one of claims 4 to 7, characterized in that: The expression promoter is a recombinant expression vector containing a gene encoding the PMI1 protein or a genetically engineered bacterium containing a recombinant expression vector containing a gene encoding the PMI1 protein.

Images