LOCOs01g65850 gene for regulating and controlling rice panicle extraction length as well as encoding protein and application of LOCOs01g65850 gene

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a gene LOCOs01g65850 for regulating and controlling the rice panicle extraction length as well as a protein coded by the gene and application of the gene. The gene and the encoded protein thereof participate in elongation regulation and control of the uppermost internode of rice, and the rice seed production yield is further influenced by influencing the outcrossing setting rate; the LOCOs01g65850 is subjected to gene editing and overexpression by adopting a conventional method, the elongation of the uppermost internode of rice is remarkably influenced, and the outcrossing maturing rate of a sterile line female parent is improved, so that the seed production yield of hybrid rice F1 is improved, a useful gene resource is provided for genetic improvement of the sterile line, and the LOCOs01g65850 has important breeding utilization value.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and specifically designs a LOC_Os01g65850 gene for regulating the length of rice panicle extraction, a protein encoded by the gene, and an application thereof. Background Art

[0002] Utilizing hybrid vigor is one of the most effective ways to increase yield per unit area. Large-scale cultivation of hybrid rice requires the production of F1 hybrid seeds every year. The panicle neck length (also known as the panicle extension length, which refers to the distance between the flag leaf pulvinus and the panicle neck node) is one of the main factors affecting the hybrid rice seed production yield. In the hybrid rice production process, both the three-line cytoplasmic male sterile line and the two-line nuclear sterile line will have a "neck-enclosing" phenomenon in the late growth period (that is, some rice panicles cannot be completely pulled out of the flag leaf sheath), thus affecting the seed production and breeding yield. In production, the "neck-enclosing" problem is usually solved by the chemical method of spraying plant gibberellins (GA3), but this not only increases the cost of seed production, but also aggravates the occurrence of smut, thus affecting the seed quality.

[0003] Scholars first discovered a long panicle neck mutant in the hybrid offspring of japonica rice, and used eui (elongated uppermost internode) to represent the recessive gene for the long panicle neck that controls this trait. Others believed through allelic analysis that the long panicle neck gene in Xieqingzao eB1 is allelic to the eui gene in IR50, and named it eui1. Xieqingzao eB2 is not allelic to eui, and named it eui2. So far, 60 QTLs related to panicle neck length have been identified, distributed on 12 rice chromosomes. Five genes that control panicle neck length have been cloned, namely Eui2, Eui1, Hox12, OsPK1 and SUI1. Some of them participate in the dehydrogenation reaction of active GA, making it inactive, thus affecting the elongation of the uppermost internode; some catalyze the 16α,17-epoxidation of non-13-hydroxylated GAs, reduce the activity of GA4 in rice, and thus regulate the elongation of the uppermost internode; some enzymes regulate exocytosis, thereby controlling the elongation of cells in rice, especially the neck internode, while Hox12 regulates the elongation of the rice panicle by regulating the expression of Eui1. However, practice has shown that the Eui1 and Eui2 genes cannot completely eliminate the necking of the sterile line. Some scholars have also used the hybrid rice bred by the Xieqingzao eA sterile line carrying the eui 1 gene to produce undesirable traits such as excessive growth, high plants, and large leaf area. Therefore, discovering and cloning some new panicle length regulatory genes and further exploring their breeding application potential have important theoretical and practical significance for the current breeding application to increase the yield of hybrid rice seed production. Summary of the invention

[0004] In order to solve the ear wrapping problem existing in the existing sterile seed production process, the present invention provides a LOC_Os01g65850 gene for regulating the rice ear length and its encoded protein and application, which provides a new gene resource for the genetic improvement of the rice ear length.

[0005] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is:

[0006] In a first aspect, the present invention provides a LOC_Os01g65850 gene for regulating rice panicle length, wherein the nucleotide sequence of the rice panicle length LOC_Os01g65850 gene is as shown in SEQ ID NO.1, or the nucleotide sequence of the rice panicle length LOC_Os01g65850 gene is at least 90% homologous to the sequence shown in SEQ ID NO.1.

[0007] The amino acid sequence encoded by LOC_Os01g65850 is as shown in SEQ ID NO.2, or the amino acid sequence encoded by LOC_Os01g65850 is at least 90% homologous to the sequence shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides an application of the LOC_Os01g65850 gene for regulating the panicle length of rice in increasing the panicle length, improving the outcrossing fruit setting rate of the sterile line, and thus improving the seed production yield of hybrid rice F1.

[0009] The application method is as follows: the rice panicle length LOC_Os01g65850 gene is edited and knocked out, so that the expression level of the LOC_Os01g65850 gene in the target rice variety is over-expressed, thereby obtaining rice plants with different phenotypes.

[0010] Preferably, the vector used in the gene encoding process is pC1300-Cas9-D850, comprising the LOC_Os01g65850 gene; the vector system is CRISPR / Csa9; and the system comprises an intermediate vector SK-gRNA and a final vector pC1300-Cas9.

[0011] The preparation method of the vector pC1300-Cas9-D850 is as follows: the primer is mixed with the linear intermediate vector SK-gRNA cut by AarI restriction endonuclease, and connected with T4 DNA ligase to obtain a plasmid SK-gRNA-LOC_Os01g65850, and then the SK-gRNA-LOC_Os01g65850 plasmid is cut with restriction endonucleases Kpn I and Bgl II, and a 300 bp fragment is recovered and mixed with a pC1300-Cas9 vector double-cut with Kpn I and BamH I, and connected with T4 DNA ligase.

[0012] Preferably, the nucleotide sequence of the primer is as shown in SEQ ID NO.5 and SEQ ID NO.6

[0013] Preferably, the overexpression vector pBWA(V)HS-D850 used in the gene overexpression process comprises the LOC_Os01g65850 gene, and the vector is a plant expression vector pBWA(V)HS, which includes the promoter of the rice's own constitutively highly expressed gene Actin.

[0014] The preparation method of the overexpression vector pBWA(V)HS-D850 is as follows: the pBWA(V)HS vector carrying the Actin promoter linearized by restriction endonucleases Bsa I and Eco31 I is mixed with the PCR amplification product containing LOC_Os01g65850, and homologous recombination connection is performed using the ClonExpress Ultra One Step Cloning Kit.

[0015] Preferably, the nucleotide sequence of the PCR amplification primer is as shown in SEQ ID NO.9 and SEQ ID NO.10.

[0016] Beneficial effects of the present invention:

[0017] The present invention found that destroying the biological function of the protein encoded by the LOC_Os01g65850 gene can significantly reduce the length of the rice panicle; while overexpressing LOC_Os01g65850 can significantly increase the length of the rice panicle, indicating that the gene plays an important role in improving the length of the rice panicle. The present invention provides useful gene resources and technical routes for the genetic improvement of the length of the rice panicle. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The expression pattern analysis of the LOC_Os01g65850 gene in rice in Example 1 of the present invention;

[0019] Figure 2 This is a schematic diagram of the target site and mutation type of the LOC_Os01g65850 gene editing in Example 2 of the present invention;

[0020] Figure 3 This is the analysis of the rice panicle length of the LOC_Os01g65850 gene knockout strain in Example 3 of the present invention; "**" indicates a very significant difference;

[0021] Figure 4 This is the target gene expression analysis of the LOC_Os01g65850 gene overexpression strain in Example 4 of the present invention; "**" indicates a very significant difference;

[0022] Figure 5 This is an analysis of the ear length of the LOC_Os01g65850 gene overexpression lines in Example 4 of the present invention; "**" indicates a very significant difference. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the methods used in the following examples are all conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent companies.

[0025] Example 1: Analysis of expression pattern of LOC_Os01g65850 gene in rice

[0026] 1. Obtaining the gene sequence of LOC_Os01g65850

[0027] This application focuses on how to solve the panicle encapsulation problem of sterile lines, and identifies a gene that controls panicle length LOC_Os01g65850. The corresponding gene contains 8411 nucleotides (SEQ ID NO.1), and its encoded protein consists of 1151 amino acids (SEQ ID NO.2). The above gene and amino acid sequence are both derived from the genome of rice variety A7444 (http: / / rice.plantbiology.msu.edu).

[0028] SEQ ID NO.1

[0029]

[0030] SEQ ID NO.2

[0031]

[0032] 2. Verification of LOC_Os01g65850 gene expression pattern

[0033] In order to verify the ear length expression characteristics of the LOC_Os01g65850 gene, a pair of exon-spanning quantitative analysis primers were designed in the exon region of the LOC_Os01g65850 gene using the online software QuantPrime (https: / / quantprime.mpimp-golm.mpg.de / ). The primer sequences are shown in Table 1:

[0034] Table 1 Primer sequences for quantitative analysis

[0035] sequence name sequence Sequence number Primer l 5'TGGAACTTCCTCCGACATGC 3' SEQ ID NO.3 Primer 2 5'TTACCAGCTGTGTTCTCTAGTGC 3' SEQ ID NO.4

[0036] Using SSSL6 as the material, different rice tissues (roots, stems, leaves, leaf sheaths and panicles) and the uppermost internodes at different developmental stages (stage 4-8) were taken, and the plant total RNA was extracted using the plant rapid RNA extraction kit (FastPure Universal Plant Total RNA Isolation Kit), and the first-strand cDNA was synthesized using the reverse transcription kit (HiScript IIIRT SuperMix for qPCR). The expression level of LOC_Os01g65850 in different tissues was detected using a quantitative PCR kit (ChamQ Universal SYBR qPCR Master Mix) and the above-mentioned quantitative PCR primers (SEQ ID NO.3 and SEQ ID NO.4). The test results are shown in Figure 2. Figure 1 As shown, the gene is expressed in different tissues, indicating that the gene may have very important biological significance in the development of the uppermost internode.

[0037] Example 2: Construction of LOC_Os01g65850 gene knockout vector and transgenic detection in rice

[0038] 1. Gene editing site design

[0039] This application is based on existing CRISPR / Cas9 related experimental methods.

[0040] Select the knockout target site on exons 22 and 23 of LOC_Os01g65850 (e.g. Figure 2As shown in FIG. 5 , primers Primer 3 and Primer 4 (SEQ ID No. 5 and SEQ ID No. 6) were designed using the online tool targetDesign software (http: / / skl.scau.edu.cn / targetdesign / ) for gene editing vector construction.

[0041] The CRISPR primer sequences are shown in Table 2:

[0042] Table 2 CRISPR primer sequences

[0043] sequence name sequence Sequence number Primer 3 5'TGAGCACAACCAAGGTGAAC 3' SEQ ID NO.5 Primer 4 5'GATCGGTTCTTGATGAGGCT 3' SEQ ID NO.6

[0044] 2. CRISPR / Cas9 vector construction and genetic transformation methods

[0045] The CRISPR / Csa9 vector system used in this application includes an intermediate vector SK-gRNA and a final vector pC1300-Cas9, whose DNA backbones are derived from the pBlueScript (SK+) vector and the pCAMBLA1300 vector, respectively.

[0046] Specific steps: primers 3 and 4 were diluted to 100 μM respectively, 10 μL of each primer was mixed and denatured at 100°C for 5 minutes, and then naturally cooled to obtain a double-stranded sequence containing the knockout target site; 7 μL of the annealed primers were mixed with the linear intermediate vector SK-gRNA (100 ng) cut with Aar I restriction endonuclease, and then the mixture was incubated with T4 DNA ligase ligation; Escherichia coli DH5α competent cells (Nanjing Novozymes Co., Ltd.) were taken out from -80℃ and thawed on ice. After the cells were dissolved, the ligation product of the previous step was quickly added, gently mixed with a pipette, and then allowed to stand on ice for 30 minutes, followed by heat shock at 42℃ for 30 seconds, and then allowed to stand on ice for 2 minutes. Then, 10 times the volume of LB antibiotic-free culture medium was added to the transformation product, and cultured at 37℃ and 200rpm for 50 minutes; the activated bacterial solution was taken out, centrifuged at 4000rpm and most of the supernatant was removed, and the remaining liquid after suspension (about 100μL) was spread on a plate (LB+ampicillin resistance), and cultured at 37℃ overnight; the next day, a single clone colony was picked and expanded to 3mL (LB+ampicillin resistance), and the target site sequence was verified by sequencing using a special sequencing primer for vector construction, and a positive clone was selected and the plasmid was extracted for standby use.

[0047] The SK-gRNA-D850 plasmid was cut with restriction endonucleases Kpn I and Bgl II, and the 300 bp fragment was recovered and mixed with the pC1300-Cas9 vector double-digested with Kpn I and BamH I, and ligated with T4 DNA ligase. The plasmid was transformed into Escherichia coli in the same way as in the previous step, and clones were selected for sequencing. The plasmid with correct sequencing was named pC1300-Cas9-D850. The competent Agrobacterium EHA105 cells (Qingke Biotechnology Co., Ltd.) were taken out from -80°C and thawed on ice. 1 μL of the prepared positive clone plasmid was added, gently mixed and placed on ice for 30 minutes, then frozen in liquid nitrogen for 2 minutes, quickly taken out and placed in a 37°C water bath to dissolve the cells for 2 minutes, and then 10 times the volume of LB antibiotic-free culture medium was added to the transformation product, and cultured at 28°C and 250rpm for 2-3 hours; the activated bacterial solution was taken out, centrifuged at 5000 rpm and most of the supernatant was removed, the bacterial solution was resuspended with the remaining liquid (about 100 μL) and then coated on a plate (LB + kanamycin), and cultured at 28°C overnight for 36-48 hours; a single clone colony was picked for sequencing, and the positive strain was named Cas9-D850.

[0048] The positive Cas9-D850 Agrobacterium strain was used to transform rice A7444 callus using the Agrobacterium-mediated rice mature embryo transformation method (Liu Qiaoquan et al., Acta Physiologica Sinica, 1998). Successfully transformed callus cells were screened for hygromycin resistance and then redifferentiated to form positive transgenic rice seedlings. When the seedlings were about 10 cm tall, they were transplanted after detection and identification to obtain T0 generation rice plants.

[0049] Example 3: Phenotypic analysis of LOC_Os01g65850 gene knockout strain

[0050] 1. Detection of genetically modified seedlings

[0051] A total of 38 seedlings were obtained by Agrobacterium infection and transformation. First, positive seedlings were screened with hygromycin detection primers. Then, sequencing primers primer 5 and primer 6 (SEQ ID NO.7 and SEQ ID NO.8) were designed upstream and downstream of the target site genomic sequence to detect mutations near the target site. After sequence amplification and sequencing analysis based on the target site, a total of three gene mutation types CR-1, CR-2 and CR-3 (such as Figure 2 shown).

[0052] The sequencing primer sequences are shown in Table 3:

[0053] Table 3 Sequencing primer sequences

[0054]

[0055]

[0056] Phenotypic analysis of LOC_Os01g65850 gene knockout strains

[0057] In the T0 and T1 generation plantings, the agronomic traits of different strains were investigated and it was found that compared with the wild type A7444, the knockout mutant lines had significantly reduced panicle length, plant height, panicle length, total number of grains, grain length, grain width and 1000-grain weight, while there were no significant differences in the number of tillers and grain thickness. Subsequently, a stably inherited mutant line was obtained in the T2 generation and planted three times in the field, with 2 rows planted in each replicate, to further investigate the panicle length trait of rice. The results showed that compared with the wild type A7444, the panicle length of the knockout mutants CR-1, CR-2 and CR-3 were significantly reduced. This indicates that LOC_Os01g65850 is a rice panicle length regulatory gene (such as Figure 3 shown).

[0058] Example 4: Construction of overexpression strain of LOC_Os01g65850 gene and phenotypic analysis

[0059] 1. Construction of LOC_Os01g65850 overexpression vector and acquisition of transgenic plants

[0060] The plant expression vector used in the present application is pBWA(V)HS (purchased from Shanghai Lianmai Company), which includes the promoter of rice's own constitutively highly expressed gene Actin.

[0061] The primer sequences for amplifying the coding sequence of LOC_Os01g65850 are shown in Table 4:

[0062] Table 4 Primer sequences for amplification of the coding sequence of LOC_Os01g65850

[0063] sequence name sequence Sequence number Primer 7 5'aacacgggggactttgcaacatgccgccggcgagaggc 3' SEQ ID NO.9 Primer 8 5'tgaagacaggctagttacactaatctgcatcaatgtccggtactgtaac 3' SEQ ID NO.10

[0064] The specific steps include using SSSL6 cDNA as a template, using primers primer 7 and primer 8 to amplify the coding region sequence of LOC_Os01g65850 (without a stop codon), using high-fidelity DNA polymerase Phanta Master (Novagene) to perform gene amplification on a PCR instrument, performing 1% agarose gel electrophoresis on the PCR product, cutting out the gel containing the target gene fragment, and using a gel recovery kit (DP209 Tiangen) to recover the target fragment. Subsequently, the recovered product was mixed with the pBWA(V)HS vector carrying the Actin promoter linearized by restriction endonucleases Bsa I and Eco31 I and the PCR amplification product containing LOC_Os01g65850, and homologous recombination was performed using ClonExpress Ultra One Step Cloning Kit. The ligation product was transformed into Escherichia coli DH5α competent cells (Novagene Nanjing) using the heat shock method. The transformed cells were plated on LB solid medium containing 100 mg / L ampicillin for culture, and clones were selected for sequencing. The plasmid with correct sequencing was named pBWA(V)HS-D850. The vector pBWA(V)HS-D850 was transformed into SSSL6 using Agrobacterium-mediated method to obtain transgenic seedlings. The transformation of Agrobacterium and the genetic transformation of rice were as described in Examples 2 and 3.

[0065] Phenotypic analysis of LOC_Os01g65850 overexpressing transgenic plants

[0066] For the transgenic rice carrying the pBWA(V)HS-D850 construct, homozygous lines were obtained in the T2 generation transgenic lines by hygromycin resistance screening. Subsequently, the uppermost internode of the homozygous lines at the 8th stage of development was collected, total RNA was extracted and reversely transcribed into cDNA, and the expression level of the LOC_Os01g65850 gene in the homozygous lines was analyzed using the above primers primer 1 (SEQ ID NO.3) and primer 2 (SEQ ID NO.4), and two lines with significantly upregulated expression were obtained for subsequent plant phenotypic analysis (such as Figure 4 shown).

[0067] The analysis of basic agronomic traits showed that during the growth and development of LOC_Os01g65850 overexpressing transgenic rice, there were no significant differences in the tiller number, growth period, panicle length and grain shape compared with the parental control (data omitted), indicating that LOC_Os01g65850 overexpression had no significant effect on the growth and development of rice.

[0068] The panicle length of LOC_Os01g65850 overexpression lines was analyzed in detail. Compared with the wild type, the panicle length of LOC_Os01g65850 overexpression lines was significantly increased (e.g. Figure 5 This indicates that the panicle packaging of the sterile line can be improved by overexpressing LOC_Os01g65850, which has important breeding value for improving the seed production yield of hybrid rice F1.

Claims

1. A LOC_Os01g65850 gene for regulating rice panicle length, characterized in that: The nucleotide sequence of the rice panicle length LOC_Os01g65850 gene is as shown in SEQ ID NO.1; or the nucleotide sequence of the rice panicle length LOC_Os01g65850 gene is at least 90% homologous to the sequence shown in SEQ ID NO.

1.

2. A LOC_Os01g65850 protein encoded by the LOC_Os01g65850 gene for regulating the length of rice panicle extraction according to claim 1, characterized in that: The amino acid sequence of the LOC_Os01g65850 protein is shown in SEQ ID NO.2; or the amino acid sequence of the LOC_Os01g65850 protein is at least 90% homologous to the sequence shown in SEQ ID NO.

2.

3. A use of the LOC_Os01g65850 gene for regulating rice panicle length as claimed in claim 1 or the LOC_Os01g65850 protein as claimed in claim 2 in increasing panicle length, improving the outcrossing fruiting rate of sterile lines, or improving the seed production yield of hybrid rice F1.

4. The use according to claim 3, characterized in that: The application method is as follows: gene editing, knocking out or over-expressing the LOC_Os01g65850 gene, so that the LOC_Os01g65850 gene in the target rice variety is over-expressed.

5. The use according to claim 4, characterized in that: The vector pC1300-Cas9-D850 used in the gene editing process contains the LOC_Os01g65850 gene; the vector system is CRISPR / Cas9; the CRISPR / Cas9 system contains the intermediate vector SK-gRNA and the final vector pC1300-Cas9.

6. The use according to claim 5, characterized in that: The preparation method of the vector pC1300-Cas9-D850 is as follows: the primers are mixed with the linear intermediate vector SK-gRNA cut by AarI restriction endonuclease, and connected with T4 DNA ligase to obtain a plasmid SK-gRNA-LOC_Os01g65850, and then the SK-gRNA-LOC_Os01g65850 plasmid is cut with restriction endonucleases Kpn I and BglII, and a 300 bp fragment is recovered and mixed with the pC1300-Cas9 vector double-cut with Kpn I and BamH I, and then connected with T4 DNA ligase to obtain the pC1300-Cas9-D850.

7. The use according to claim 6, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.5 and SEQ ID NO.

6.

8. The use according to claim 4, characterized in that: The overexpression vector used in the process of overexpression of the gene is pBWA(V)HS-D850, and the overexpression vector is pBWA(V)HS-D850 containing the LOC_Os01g65850 gene. The vector is a plant expression vector pBWA(V)HS, which includes the promoter of the rice's own constitutively highly expressed gene Actin.

9. The use according to claim 8, characterized in that: The preparation method of the overexpression vector pBWA(V)HS-D850 is as follows: the pBWA(V)HS vector carrying the Actin promoter linearized by restriction endonucleases Bsa I and Eco31 I is mixed with the PCR amplification product containing LOC_Os01g65850, and homologous recombination connection is performed using ClonExpress Ultra One Step Cloning Kit.

10. The use according to claim 9, characterized in that: The nucleotide sequences of the PCR amplification primers are shown in SEQ ID NO.9 and SEQ ID NO.10.

Images