Application of rice GIF4 gene in regulation and control of grain filling and grain weight

Abstract

The invention belongs to the field of gene engineering, and relates to a rice grain filling regulation gene GIF4 and application thereof. The cDNA sequence of the rice GIF4 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the encoding protein of the rice GIF4 gene is as shown in SEQ ID NO.2. The invention discloses a rice GIF4 gene and a protein sequence coded by the rice GIF4 gene. Overexpression of the rice GIF4 gene can significantly promote rice grain filling and increase the grain weight, which indicates that the gene is expected to be introduced into a rice variety as a target gene to improve the grain filling characteristic of the rice and is beneficial to increase the yield of the rice grains.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and relates to a rice gene GIF4 and application thereof in regulating rice grain filling and grain weight. Background Art

[0002] Rice grain shape and grain filling jointly affect grain weight (grain weight). Many genes that affect rice grain shape have been identified and cloned, but genes that affect grain filling have been less discovered and studied. TGW6 is a quantitative trait locus related to rice grain weight, which encodes indoleacetic acid-glucose hydrolase, which affects the transformation of endosperm from syncytium to cellularization stage by controlling the content of auxin in endosperm; its functional loss promotes grain filling, thereby affecting grain weight. The grain filling rate-related locus GFR1 encodes a membrane protein that interacts with the small subunit of ribulose bisphosphate carboxylase, which affects grain weight by participating in the Calvin cycle. By studying the grain incomplete filling (GIF) mutant, two genes that positively regulate grain filling, GIF1 and GIF2, were identified; the former encodes the cell wall invertase OsCIN2, which is involved in the unloading of sucrose in the endosperm tissue in the early stage of filling; the latter encodes the large subunit of ADP-glucose pyrophosphorylase OsAGPL2, which catalyzes the production of starch precursor ADP-glucose. The study of another grain filling defective mutant Ospho1;2 found that the plasma membrane phosphorus transporter OsPHO1;2 affects the activity of ADP-glucose pyrophosphorylase through grain phosphorus homeostasis, thereby regulating grain starch synthesis.

[0003] Discovering the regulatory genes of rice grain filling is of great significance for promoting rice grain filling and improving rice yield and quality. Summary of the invention

[0004] The present invention has found through research that the rice GIF4 gene encodes a protein of unknown function containing a DUF4408 domain and a DUF761 domain, and the grain filling rate of the mutant is reduced, resulting in a decrease in grain weight. However, the overexpression of GIF4 significantly increases the grain weight, which is of great significance for increasing rice yield.

[0005] The first object of the present invention is to provide a rice GIF4 gene, wherein the cDNA nucleotide sequence of the rice GIF4 gene is shown in SEQ ID NO.1:

[0006] ATGCTGGAGGCCGTGATCCCGGCGGTGTGGAGCGCCGTCCACGGGTGGTTCACCCCCGCGGTGCTCTTCCTCGTCCTCAACATCGTCATCGGCACCATCGCGGTTACTTCCAAGGTCACCGCCTCCTCCTCGACGGCGGGCGGCGGCGGCGAGGGGGTTGGGTATGGAGCGTGGGCGGGTGGTGGTGGTGGTGGTGGAGGGGAGCAGAGGAGGTTCTCCCGCGTGCCGTCCATG GCGCTCGACCGGCTCCGGTCGTTTAATCTCTCCGGCCGGTTCTCCGCAGCCGCCTCTGCCCCTGCTGCTCCCGAGGCGGCCGCGGTGGTGGGCGGGGTGCTGGATCTGGGCGCCCGCGATGAGGCGACGACGGCGGCGGTGGTGAAGGATGTGGGGGGCGGGAGAGAGCGCGAGGAGGAGGTGGAGGATGAGCAGGAGCGCGCGCAGGCGGCGCATGTGGTGGAGAGGAGCAAGTCGGAGGCGACGGCGGCGGCGGCGGACCTCCCGCGGCTGCCGGCGCGGCTGCGCAAGTCGGCCAGCGACCAGTCGGCGTTCGCGCACTTCGAGGCCGAGAAGAAGGCGGCGGCGGCGGAGGTGGAACGCGAGGCGGTGGAGGCGCGGCGCCCCGCGACGACGAGGGAGCCGCCGCGCGTGTGGCTCCGCGTGGCCGACGAGGACCCGGAGCCGGAGGAGTTCGACGACGAGGCGGATGATGATGAGCCGGAGATGGACGACGACGACGCCGACGTCGGCGCCGGCGAGGTGGACGCGCGCGCCGACGACTTCATCAACAACTTCCGCCACCAGCTCAAGCTGCAGCGCATCGACTCCTACCTCCGCCACCGCGACATGCTCCGCCGCGGCCACGCCGCCGCCGCCGCCGCCGCGGTGGGCAGCGACTTGTGA

[0007] The second object of the present invention is to provide the encoded protein of the aforementioned rice GIF4 gene, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2:

[0008] MLEAVIPAVWSAVHGWFTPAVLFLVLNIVIGTIAVTSKVTASSSTAGGGGEGVGYGAWAGGGGGGGGEQRRFSRVPSMALDRLRSFNLSGRFSAAASAPAAPEAAAVVGGVLDLGARDEATTAAVVKDVGGGREREEEVEDEQERAQAAH VVERSKSEATAAAADLPRLPARLRKSASDQSAFAHFEAEKKAAAAEVEREAVEARRPATTREPPRVWLRVADEDPEPEEFDDEADDDEPEMDDDDADVGAGEVDARADDFINNFRHQLKLQRIDSYLRHRDMLRRGHAAAAAAAVGSDL*

[0009] The third object of the present invention is to provide a recombinant expression vector and an expression cassette comprising the aforementioned rice GIF4 gene.

[0010] The rice GIF4 gene is used to cultivate fast-filling rice varieties through genetic engineering. Usually, the GIF4 gene of the present invention is first used as a target gene to construct a plant expression vector, and then the recombinant expression vector containing the gene is transformed into the target rice variety.

[0011] The GIF4 gene of the present invention is used as the target gene to construct a plant expression vector, wherein any strong expression promoter can be used, such as cauliflower mosaic virus (CaMV) 35S promoter, Ubiquitin promoter or Actin promoter, etc., and the expression vector can include an enhancer when necessary, whether it is a transcription enhancer or a translation enhancer. In order to simplify the identification of transformants, selective markers can be used, including enzymes with antibiotic resistance, and enzymes of compounds that can be identified by color change (such as β-glucuronidase GUS) or luminescence (such as luciferase). The expression vector used can use Ti plasmids, Ri plasmids, plant virus vectors, etc. The transformation method can be Agrobacterium-mediated method, gene gun method or other methods to transform rice plants.

[0012] In a specific embodiment, the recombinant expression vector of rice GIF4 gene is obtained by ligating the cDNA sequence of GIF4 gene between the restriction endonuclease sites KpnⅠ and BamHI of the expression vector pCAMBIA1300s.

[0013] The fourth object of the present invention is to provide or contain the recombinant bacteria of the aforementioned rice GIF4 gene.

[0014] The fifth object of the present invention is to provide primers for amplifying the aforementioned rice GIF4 gene.

[0015] Furthermore, the primers are primers P1 and P2 for amplifying the full-length cDNA of the GIF4 gene, or primers P3 and P4 for amplifying the complete coding reading frame of the GIF4 gene; the nucleotide sequences of P1 and P2 are shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of P3 and P4 are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0016] SEQ ID NO.3: ATGCTGGAGGCCGTGATCCCGGC;

[0017] SEQ ID NO. 4: TCACAAGTCGCTGCCCACCGCGG.

[0018] SEQ ID NO.5: CTTTCGCGAGCTCGGTACCATGCTGGAGGCCGTGATCCCGGC;

[0019] SEQ ID NO. 6: AGGTCGACTCTAGAGGATCCTCACAAGTCGCTGCCCACCGCG.

[0020] The sixth object of the present invention is to provide the use of the aforementioned rice GIF4 gene, or the aforementioned encoded protein, or the aforementioned recombinant expression vector, expression cassette, or the aforementioned recombinant bacteria, or the aforementioned primers in regulating rice grain filling and / or rice grain weight.

[0021] Furthermore, overexpression of the rice GIF4 gene can promote grain filling and / or increase rice grain weight.

[0022] Furthermore, increasing the expression level of the aforementioned encoded protein in rice, or introducing the aforementioned recombinant expression vector or expression cassette into rice, or introducing the aforementioned recombinant bacteria into rice can promote grain filling and / or increase rice grain weight.

[0023] Furthermore, mutation or knockout of the rice GIF4 gene can slow down rice grain filling and / or reduce rice grain weight.

[0024] Furthermore, reducing the expression level of the aforementioned encoded protein in rice can slow down the filling of rice grains and / or reduce the weight of rice grains.

[0025] The application comprises the following steps:

[0026] 1) Cloning of Rice GIF4 Gene:

[0027] Design primers P1 and P2 at both ends of the full-length cDNA of the GIF4 gene, perform PCR amplification from rice cDNA, and connect the PCR product to the pEASY-T1 Blunt vector; after sequencing verification, obtain the cDNA sequence vector of the GIF4 gene;

[0028] 2) Construction of plant expression vector:

[0029] Primers P3 and P4 were designed to encode the complete reading frame of the GIF4 gene, and restriction endonuclease sites KpnⅠ and BamHI were introduced; using P3 and P4 as primers, the cDNA sequence vector of the GIF4 gene described in 1) was amplified by PCR, and the PCR product was connected to the expression vector pCAMBIA1300s, and sequenced and verified to obtain the plant expression vector of the GIF4 gene;

[0030] 3) The expression vector is transformed into rice, and plants with high expression of GIF4 are screened. After breeding and multiple generations, homozygous strains with overexpression of GIF4 are obtained.

[0031] Beneficial Effects

[0032] The present invention provides a rice grain filling regulating gene GIF4 and a protein sequence encoded by it. The rice GIF4 gene is reported in rice for the first time. By enhancing the expression of the GIF4 gene, rice grain filling can be promoted and rice grain weight can be increased. Therefore, GIF4 is expected to be introduced into rice varieties as a target gene through a strong promoter to genetically improve grain filling, thereby increasing grain yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 , mutation of gif4 knockout lines (A), appearance of caryopsis at filling stage (B), grain filling rate (C), thousand-grain weight of grains and thousand-grain mass of brown rice (D), relative contents of starch and protein (E). Scale bar is 5 mm, ** indicates P < 0.01.

[0034] Figure 2 , GIF4 overexpression transgenic lines, grain appearance (A) and thousand-grain weight of grains and brown rice (B). Scale bar is 5 mm, ** indicates P < 0.01. DETAILED DESCRIPTION

[0035] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0036] Example 1 Gene cloning

[0037] (I) Extraction of total RNA:

[0038] Germinated seeds of japonica rice variety Zhonghua 11 were selected, frozen with liquid nitrogen and stored in a -80°C refrigerator. Some samples were taken, ground with a mortar, transferred into a 1.5 mL EP tube containing Trizol lysis solution, and after sufficient shaking, total RNA was extracted and the quality of total RNA was identified by electrophoresis.

[0039] (II) Cloning of rice GIF4 gene:

[0040] The primers P1 and P2 at both ends of the full-length cDNA of the GIF4 gene were designed, and the primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4. The total RNA obtained in step (i) was reverse transcribed to synthesize the first chain of cDNA and used as a template, P1 and P2 were used as primers, and PCR amplification was performed with a high-fidelity enzyme. The PCR program was as follows: 95°C pre-denaturation for 5min, 95°C denaturation for 20sec, 56°C renaturation for 20sec, 72°C extension for 30sec, after 35 cycles, 72°C extension for 5min, and then connected to the pEASY-T1 Blunt vector, and the cDNA sequence of GIF4 was obtained by entrusting Nanjing Sipujin Company for sequencing. SEQ ID NO.1.

[0041] Example 2 Construction of GIF4 knockout mutant

[0042] (I) Determination of mutation targets:

[0043] Log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html, screen the GIF4 gene editing targets, and select two 19 bp specific targets on exon 2 and exon 3. The corresponding two target sequences are: sgRNA1 is CTGGAGGCCGTGATCCCGG (SEQ ID NO. 7), and sgRNA2 is TGGGCGGGGTGCTGGATCT (SEQID NO. 8). Four specific primers were designed for the specific targets of the two selected target fragments, with primer sequences: AATAATGGTCTCAGGCGCTGGAGGCCGTGATCCCGG (SEQ ID NO.9), GCTGGAGGCCGTGATCCCGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.10), AGATCCAGCACCCCGCCCACGCTTCTTGGTGCC (SEQ ID NO.11), ATTATTGGTCTCTAAACAGATCCAGCACCCCGCCCA (SEQ ID NO.12).

[0044] The pCBC-MT1T2 vector was used as a template for PCR amplification with four primers. The amplified product was purified and recovered, and the specific target sequence of the mutant target fragment of the GIF4 gene was cloned.

[0045] (II) Enzyme Digestion and Ligation Reaction System:

[0046] Reaction system for enzyme digestion and ligation: target DNA fragment, 2 μL; pBUE411 vector, 2 μL; 10x T4 Buffer, 1.5 μL; 10x BSA, 1.5 μL; BsaⅠ, 1 μL; T4 Ligase, 1 μL; ddH2O, 6 μL. Reaction procedure: 37°C, 5 hours; 50°C, 5 minutes; 80°C, 10 minutes.

[0047] (III) Creation of mutant strains:

[0048] The target sequence sgRNA of the GIF4 gene was connected to the pHUE411 vector by the enzyme cutting and ligation system described in (ii). The obtained vector was transformed into Agrobacterium, and the Agrobacterium carrying the transformation plasmid was transformed into the callus of the japonica rice variety Zhonghua 11 by Agrobacterium-mediated rice transgenic technology. According to the target fragment sequence of the two specific target sites of the GIF4 gene, the mutant material PCR verification primers CATTCCCATCACCACACCTCTCA (SEQ ID NO.13) and

[0049] ACTTGCTCCTCTCCACCACATGC (SEQ ID NO. 14), amplify the GIF4 target sequence in the mutant and sequence it, and screen the homozygous mutant plants. Finally, the mutant strains gif4-1, gif4-2 and gif4-3 were obtained. The mutation of the GIF4 gene in these mutants is as described in the attached Figure 1 shown.

[0050] (IV) Grain phenotype of mutant strains:

[0051] Grain-related phenotypes were measured for wild-type, gif4-1, gif4-2, and gif4-3 mutant lines.

[0052] As mentioned in the attached Figure 1 As shown in the figure: Compared with the wild type, the three mutant lines had a significantly reduced caryopsis filling rate during the grain filling period; the thousand-grain weight of the grains at maturity was significantly reduced, and the thousand-grain weight of brown rice was also significantly reduced; the relative content of total starch in the grains was significantly reduced, but the relative protein content in the grains was significantly increased. This indicates that the rice GIF4 gene positively regulates grain filling and grain weight, and the mutant GIF4 gene negatively affects rice grain filling and grain weight.

[0053] Example 3 Construction of GIF4 overexpression strain

[0054] (I) Construction of plant expression vector:

[0055] According to the cDNA sequence SEQ ID NO.1 of rice GIF4 gene, primers for amplifying the complete coding reading frame were designed, and restriction endonuclease sites KpnⅠ and BamHI were introduced into the upstream primer P3 and the downstream primer P4. The sequences of primers P3 and P4 are shown in SEQ ID NO.5 and SEQ ID NO.6. The vector obtained in Example 1 (ii) was used as a template, and P3 and P4 were used as primers. After PCR amplification, the cDNA of GIF4 gene was connected to the expression vector pCAMBIA1300s by recombination method, and sequencing was performed to ensure that the reading frame of the coding region in the expression vector was correct, and the overexpression vector pCAMBIA1300s-GIF4 was obtained.

[0056] (II) Creation of overexpression strains:

[0057] The expression vector pCAMBIA1300s-GIF4 obtained in step (i) was transferred into Agrobacterium, and then further transferred into rice variety Zhonghua 11. The expression level of the GIF4 gene in the obtained transgenic plants was verified by real-time qPCR, and the plants with high expression of GIF4 were selected. Through breeding and multiplication, the homozygous strains GIF4-OE-1 and GIF4-OE-2 with overexpression of GIF4 were obtained.

[0058] (III) Grain phenotype of overexpression lines:

[0059] Grain-related phenotypes of wild-type, GIF4-OE-1 and GIF4-OE-2 overexpressing lines were measured as described in Figure 2 As shown in the figure: compared with the wild type, the thousand-grain weight of the mature grains of the two overexpression lines increased significantly, and the thousand-grain weight of brown rice also increased significantly, indicating that overexpressing GIF4 to increase its expression level can increase the rice grain weight.

[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Rice GIF4 gene, characterized in that The cDNA nucleotide sequence of the rice GIF4 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the rice GIF4 gene according to claim 1, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant expression vector or expression cassette comprising the rice GIF4 gene according to claim 1.

4. A recombinant bacterium comprising the rice GIF4 gene according to claim 1.

5. Primers for amplifying the rice GIF4 gene according to claim 1.

6. The primer according to claim 5, characterized in that The primers are primers P1 and P2 for amplifying the full-length cDNA of GIF4 gene, or primers P3 and P4 for amplifying the complete coding reading frame of GIF4 gene; the nucleotide sequences of P1 and P2 are shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of P3 and P4 are shown in SEQ ID NO.5 and SEQ ID NO.

6.

7. Use of the rice GIF4 gene according to claim 1, or the encoded protein according to claim 2, or the recombinant expression vector or expression cassette according to claim 3, or the recombinant bacteria according to claim 4, or the primers according to claim 5 in regulating rice grain filling and / or rice grain weight.

8. The use according to claim 6, characterized in that: Overexpressing the rice GIF4 gene, or increasing the expression level of the encoded protein according to claim 2 in rice, or introducing the recombinant expression vector or expression cassette according to claim 3 into rice, or introducing the recombinant bacteria according to claim 4 into rice can promote grain filling and / or increase rice grain weight.

9. The use according to claim 6, characterized in that: Mutating or knocking out the rice GIF4 gene, or reducing the expression of the encoded protein according to claim 2 in rice can slow down the filling of rice grains and / or reduce the weight of rice grains.

10. The use according to claim 6, characterized in that: The application comprises the following steps: 1) Cloning of Rice GIF4 Gene: Design primers P1 and P2 at both ends of the full-length cDNA of the GIF4 gene, perform PCR amplification from rice cDNA, and connect the PCR product to the pEASY-T1 Blunt vector; after sequencing verification, obtain the cDNA sequence vector of the GIF4 gene; 2) Construction of plant expression vector: Primers P3 and P4 were designed to encode the complete reading frame of the GIF4 gene, and restriction endonuclease sites KpnⅠ and BamHI were introduced; using P3 and P4 as primers, the cDNA sequence vector of the GIF4 gene described in 1) was amplified by PCR, and the PCR product was connected to the expression vector pCAMBIA1300s, and sequenced and verified to obtain the plant expression vector of the GIF4 gene; 3) The expression vector is transformed into rice, and plants with high expression of GIF4 are screened. After breeding and multiple generations, homozygous strains with overexpression of GIF4 are obtained.

Images