Rice mesocotyl alkali-resistant gene qRMLA-1 and molecular marking method thereof

Abstract

The invention discloses a rice mesocotyl alkali-resistant gene qRMLA-1 and a molecular marking method thereof. A major site qRMLA-1 related to rice mesocotyl alkali resistance is positioned on a No.3 chromosome of a rice genome by constructing a DH population and utilizing a linkage analysis technology. Meanwhile, a molecular marker RM312 closely linked to the site is developed, and the marker is a specific PCR primer pair and can rapidly identify alkali-resistant rice individuals. The molecular marker is used for genotype identification, and alkali-resistant rice carrying a qRMLA-1 favorable allele can be screened out and used for subsequent breeding work. According to the technical scheme, the breeding efficiency is improved, it is ensured that the bred rice variety has excellent alkali resistance, powerful support is provided for solving the saline-alkali soil rice planting problem, remarkable technical innovation and practicability are achieved, and a new thought and method are provided for rice alkali-resistant genetic improvement and molecular breeding.

Description

Technical Field

[0001] The invention specifically relates to a rice mesocotyl alkali-resistance gene qRMLA-1 and a molecular marking method thereof. Background Art

[0002] As one of the most important food crops in the world, the stability of rice production is closely related to food security. However, saline-alkali land, as a widespread land resource, poses a severe challenge to rice production. Such land contains too much salt and alkaline substances, which often hinders rice growth and significantly reduces yield. Therefore, improving the alkaline tolerance of rice so that it can grow normally and obtain high yields on saline-alkali land has become an important research direction in agricultural production.

[0003] As a key tissue formed during the germination of rice seeds, the mesocotyl plays a vital role in the germination speed of seeds and the growth of seedlings. It connects the plumule and the radicle, which not only affects the germination process of seeds, but is also directly related to the survival ability of seedlings in adverse environments such as saline-alkali land. Studies have found that the alkali resistance of rice mesocotyls is closely related to its growth ability and yield in saline-alkali land. When the rice mesocotyl has alkali resistance, it can maintain a longer length in a saline-alkali environment, which helps the seedlings better absorb water and nutrients and improves their survival and growth ability under adverse conditions.

[0004] Alkali tolerance in rice is a quantitative trait regulated by multiple genes. In recent years, with the rapid development of genomics and molecular biology techniques, many genes related to rice alkali tolerance have been gradually identified. For example, genes such as ATL1, OsIDEF1, OsLOL5, OsCu / Zn-SOD and OsAPx2 have been found to be related to rice alkali tolerance. Among them, the ATL1 gene has been successfully cloned and has been proven to play an important role in improving rice alkali tolerance. In addition, researchers have also detected a negatively regulated alkali tolerance major gene AT1 using sorghum genome association analysis, whose mutants can significantly enhance the alkali tolerance of rice, corn and millet, and increase yield.

[0005] Although many alkali-resistant genes have been reported, there are few reports on genes related to alkali resistance in rice mesocotyls. Mesocotyls are key tissues in the germination process of rice, and improving their alkali resistance is of great significance for the growth of rice in saline-alkali soil. Therefore, discovering and utilizing rice mesocotyl alkali-resistant genes is of great value for breeding alkali-resistant rice varieties.

[0006] In order to fill this research gap, the present invention constructed a DH population with Haidao 86 (SR86) and Nipponbare (NIP) as parents, and located a major locus qRMLA-1 related to the alkali resistance of rice mesocotyls on chromosome 3 of the rice genome through linkage analysis. The favorable allele of this locus comes from the japonica rice variety NIP, which can significantly increase the length of the rice mesocotyl under alkaline stress conditions. At the same time, the present invention also obtained a molecular marker RM312 that is closely linked to this locus. This molecular marker can be used to quickly and accurately identify alkali-resistant rice individuals carrying the qRMLA-1 gene, providing a powerful tool for the breeding and screening of alkali-resistant rice varieties. This discovery not only enriches the rice alkali-resistant gene resources, but also provides new ideas and methods for rice stress resistance breeding.

[0007] In order to solve the above problems, the applicant proposed a rice mesocotyl alkali-resistance gene qRMLA-1 and a molecular marker method thereof. Summary of the invention

[0008] The object of the present invention is to provide a rice mesocotyl alkali-resistance gene qRMLA-1 and a molecular marking method thereof, so as to solve the problems in the prior art.

[0009] To achieve the above objectives, the present invention provides the following technical solutions: 1. A rice mesocotyl alkali resistance gene qRMLA-1, characterized in that: the gene is located on chromosome 3 of the rice genome, specifically in the physical interval of 0.21-0.90Mb, which is a site related to the alkali resistance of the rice mesocotyl, and its favorable allele comes from the japonica rice variety Nipponbare, which can significantly increase the length of the rice mesocotyl under alkaline stress conditions.

[0010] The molecular marker method of the rice mesocotyl alkali resistance gene qRMLA-1 as claimed in claim 1 is characterized in that: the method comprises using a pair of specific PCR primers to amplify RM312, wherein the forward primer sequence is CCACTATCTATTGAACCACTACGT, and the reverse primer sequence is GCGCTATGCTTTTACTCGCA, and if the primer pair RM312 can amplify a fragment of about 127 bp identical to NIP, it indicates that the breeding material carries the mesocotyl alkali resistance allele from NIP.

[0011] The use of a rice mesocotyl alkali-resistance gene qRMLA-1 and a molecular marker method thereof as described in claims 1 and 2 in molecular marker-assisted selection breeding of alkali-resistance in rice germination period is characterized in that: using the molecular marker method as described in claim 2, PCR amplification and electrophoresis detection are used to quickly and accurately identify alkali-resistant rice individuals carrying the qRMLA-1 gene, and then used for molecular marker-assisted selection breeding of alkali-resistance in rice germination period.

[0012] The use as claimed in claim 3 is characterized in that: the molecular marker-assisted selection breeding method is to construct a genetic population with rice varieties with different alkali resistance as parents, use the molecular marker RM312 as claimed in claim 2 to identify the genotype of the genetic population, and select individuals with the same genotype as NIP. These individuals have a higher mesocotyl length under alkaline stress conditions, thereby screening out alkali-resistant rice varieties.

[0013] Beneficial effects: First, the present invention successfully located the rice mesocotyl alkali resistance gene qRMLA-1. This gene is located on chromosome 3 of the rice genome and is a major effect site related to rice mesocotyl alkali resistance. Through linkage analysis, the present invention found that the favorable allele of this site originated from the japonica rice variety NIP, which can significantly increase the length of the rice mesocotyl under alkaline stress conditions. This discovery not only reveals the genetic mechanism of rice mesocotyl alkali resistance, but also provides important gene resources for the breeding of alkali-resistant rice varieties.

[0014] Secondly, the present invention obtains a molecular marker RM312 that is closely linked to the rice mesocotyl alkali-resistance gene qRMLA-1. This molecular marker is a pair of specific PCR primers, which can quickly and accurately identify alkali-resistant rice individuals carrying the qRMLA-1 gene through PCR amplification and electrophoresis detection. The application of this molecular marker greatly simplifies the screening process of alkali-resistant rice varieties, improves screening efficiency and accuracy, and provides strong support for the rapid breeding and commercial production of alkali-resistant rice varieties.

[0015] In addition, the rice mesocotyl alkali-resistant gene qRMLA-1 and its molecular marker method provided by the present invention have important applications in rice germination period alkali-resistant molecular marker-assisted selection breeding. By using the molecular marker for genotype identification, alkali-resistant rice individuals carrying the qRMLA-1 gene can be selected and then used for subsequent breeding work. This method not only improves breeding efficiency, but also ensures that the selected rice varieties have excellent alkali-resistant traits, providing a more reliable choice for rice cultivation in saline-alkali land. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The alkaline tolerance performance of mesocotyls of the DH population constructed for the indica rice variety SR86 and the japonica rice variety NIP and the genotype map of the RM312 marker, the band pattern map of the PCR amplification products of the SSR marker RM312 on 8% polyacrylamide gel electrophoresis and its corresponding phenotype (1-57 are randomly selected DH population plants; M is DNA Ladder; P1 is NIP; P2 is SR86);

[0017] Figure 2 This is the mesocotyl length phenotype of japonica rice variety NIP and indica rice variety SR86 under alkaline stress. DETAILED DESCRIPTION

[0018] The following describes the preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0019] In the drawings, components with the same structure are indicated by the same numerical reference numerals, and components with similar structures or functions are indicated by similar numerical reference numerals. The size and thickness of each component shown in the drawings are arbitrarily shown, and the present invention does not limit the size and thickness of each component. In order to make the illustration clearer, the thickness of the components is appropriately exaggerated in some places in the drawings.

[0020] Example 1

[0021] The present invention relates to a rice mesocotyl alkali-resistance gene qRMLA-1 and a molecular marker method thereof. The technical solution has far-reaching significance in the fields of crop genetic improvement and molecular breeding. The specific technical implementation details and background considerations are described as follows.

[0022] The core of the present invention is to successfully locate a gene locus qRMLA-1 that is closely related to the alkali tolerance of rice mesocotyls, and develop a molecular marker RM312 that is closely linked to it. This achievement not only deepens our understanding of the genetic mechanism of rice alkali tolerance, but also provides strong technical support for the rapid breeding and commercial production of alkali-tolerant rice varieties.

[0023] Construction of DH population and gene mapping

[0024] The first step of the present invention is to construct a DH (Double Haploid) population with Haidao 86 (SR86) and Nipponbare (NIP) as parents. The DH population is a special genetic population, and its individuals are all homozygous, which can eliminate the influence of heterozygosity on gene positioning and improve the accuracy of positioning. Through field planting and alkaline stress treatment, we collected the mesocotyl length data of the DH population, and used linkage analysis technology to locate a major effect site qRMLA-1 related to the alkali resistance of rice mesocotyls on chromosome 3 of the rice genome.

[0025] Development and validation of molecular markers

[0026] After locating the qRMLA-1 locus, the present invention further developed a molecular marker RM312 that is closely linked to it. This is a pair of specific PCR primers, the forward primer sequence of which is CCACTATCTATTGAACCACTACGT (SEQ ID No. 1), and the reverse primer sequence is GCGCTATGCTTTTACTCGCA (SEQ ID No. 2). Through PCR amplification and electrophoresis detection, we can quickly and accurately identify alkali-tolerant rice individuals carrying the qRMLA-1 gene.

[0027] In order to verify the reliability and accuracy of the RM312 marker, we conducted a large number of field trials and data analysis. The results showed that the RM312 marker was closely linked to the qRMLA-1 locus, and the size of its amplified product was closely related to the alkali tolerance trait. Under alkaline stress conditions, the length of the mesocotyl of rice individuals carrying the favorable allele of qRMLA-1 increased significantly, while individuals carrying the unfavorable allele showed a lower mesocotyl length. This result further confirmed the role of the qRMLA-1 gene in the alkali tolerance of rice mesocotyls and verified the practicality of the RM312 marker.

[0028] Application and prospects of technical solutions

[0029] The rice mesocotyl alkali-resistance gene qRMLA-1 and the molecular marker method thereof provided by the present invention have important applications in the molecular marker-assisted selection breeding of alkali-resistance in rice germination period. By using the RM312 marker for genotype identification, we can quickly screen out alkali-resistant rice individuals carrying the favorable allele of qRMLA-1, and then use them for subsequent breeding work. This method not only improves the breeding efficiency, but also ensures that the selected rice varieties have excellent alkali-resistance traits.

[0030] In practical applications, we can combine the RM312 marker with other alkali-resistant genes or genes with excellent traits, and cultivate new alkali-resistant rice varieties with multiple genes through molecular marker-assisted selection breeding technology. These new varieties will have stronger alkali resistance and higher yield potential, providing strong support for solving the problem of rice cultivation in saline-alkali land.

[0031] In addition, the technical solution developed by the present invention can also provide reference and reference for the genetic improvement of stress tolerance of other crops. Through similar research methods and ideas, we can explore and utilize the stress tolerance gene resources in other crops and contribute to the sustainable development of agricultural production.

[0032] The technical solution of the present invention has significant innovation and practicality. First, we successfully located the rice mesocotyl alkali resistance gene qRMLA-1 and developed a molecular marker RM312 closely linked to it. This achievement fills the gap in the research of rice mesocotyl alkali resistance genes and provides strong technical support for the rapid breeding and commercial production of alkali-resistant rice varieties.

[0033] Secondly, the technical solution of the present invention has broad application prospects. By using the RM312 marker to identify genotypes and screen alkali-resistant rice individuals, we can quickly cultivate new alkali-resistant rice varieties with multi-gene aggregation. These new varieties will have stronger alkali resistance and higher yield potential, providing strong support for solving the problem of rice cultivation in saline-alkali land. At the same time, the technical solution can also provide reference and reference for the genetic improvement of stress tolerance of other crops.

[0034] Finally, the technical solution of the present invention has high practicality and operability. The RM312 marker is a pair of specific PCR primers, and the size of its amplified product is closely related to the alkali resistance trait. Genotype identification and screening of alkali-resistant rice individuals can be achieved through simple PCR amplification and electrophoresis detection. This method is not only simple to operate and low in cost, but also accurate and reliable in results and has high practical value.

[0035] By implementing the technical solution of the present invention, we have achieved remarkable results. First, we successfully located the rice mesocotyl alkali resistance gene qRMLA-1 and developed a molecular marker RM312 closely linked to it. This achievement provides strong technical support for the rapid breeding and commercial production of alkali-resistant rice varieties. Secondly, we used the RM312 marker to conduct a large number of field trials and data analysis to verify its reliability and accuracy. These results provide an important reference for subsequent breeding work.

[0036] In summary, the rice mesocotyl alkali-tolerance gene qRMLA-1 and its molecular marker method provided by the present invention have significant technical innovation and practicality. The implementation of this technical solution will help promote the rapid breeding and commercial production of alkali-tolerant rice varieties, and provide strong support for solving the problem of rice cultivation in saline-alkali land. At the same time, this technical solution also has broad application prospects and high practicality and operability, and can provide reference and reference for the genetic improvement of stress tolerance of other crops, making greater contributions to global food security and sustainable agricultural development.

[0037] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the attached claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims are included in the present invention. Any figure mark in the claims should not be regarded as limiting the claims involved.

[0038] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A rice mesocotyl alkali-tolerance gene qRMLA-1, characterized in that: This gene is located on chromosome 3 of the rice genome, specifically in the physical interval of 0.21-0.90Mb. It is a site related to the alkali resistance of rice mesocotyls. Its favorable allele comes from the japonica rice variety Nipponbare, which can significantly increase the length of rice mesocotyls under alkaline stress conditions.

2. The molecular marker method for rice mesocotyl alkali-tolerance gene qRMLA-1 according to claim 1, characterized in that: The method includes using a pair of specific PCR primers to amplify RM312, wherein the forward primer sequence is CCACTATCTATTGAACCACTACGT and the reverse primer sequence is GCGCTATGCTTTTACTCGCA. If the primer pair RM312 can amplify a fragment of about 127 bp identical to NIP, it indicates that the breeding material carries the mesocotyl alkali-resistant allele from NIP.

3. Application of the rice mesocotyl alkali-tolerance gene qRMLA-1 and its molecular marker method in rice germination alkali-tolerance molecular marker-assisted selection breeding as claimed in claims 1 and 2, characterized in that: The molecular marker method of claim 2 is used to quickly and accurately identify alkali-resistant rice individuals carrying the qRMLA-1 gene through PCR amplification and electrophoresis detection, and then used for molecular marker-assisted selection breeding of alkali resistance in rice germination period.

4. The use according to claim 3, characterized in that: The molecular marker-assisted selection breeding method constructs a genetic population with rice varieties with different alkali resistance as parents, uses the molecular marker RM312 described in claim 2 to identify the genotype of the genetic population, selects individuals with the same genotype as NIP, and these individuals have a higher mesocotyl length under alkali stress conditions, thereby screening out alkali-resistant rice varieties.

Images