FeuC gene for enhancing biosynthesis of 1-deoxynojirimycin, method and application

Abstract

The invention belongs to the technical field of industrial biology, and discloses a feuC gene for enhancing biosynthesis of 1-deoxynojirimycin, a method and application, and the nucleotide sequence of the feuC gene is as shown in SEQ ID No.1. The invention aims to disclose a specific action mechanism of the feuC gene in a DNJ biosynthesis process, the feuC gene can be used for improving the biosynthesis efficiency of 1-deoxynojirimycin, and theoretical support is provided for developing a more efficient DNJ production strategy. Meanwhile, the technical problem of increasing the yield of the DNJ can be solved through the research, a new thought and a new method are brought to the research in the field of industrial biotechnology, and large-scale production and application of the DNJ are promoted.

Description

Technical Field

[0001] The present invention belongs to the field of industrial biotechnology, and in particular to a feuC gene, method and application for enhancing the biosynthesis of 1-deoxynojirimycin. The core of the present invention is to overexpress or regulate the feuC gene to promote the biosynthesis of DNJ, and involves related biological materials, strain construction, specific implementation steps and application directions, aiming to enhance the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin (DNJ for short). Background Art

[0002] 1-Deoxynojirimycin (DNJ) is a naturally occurring polyhydroxypiperidinyl iminosugar alkaloid with the chemical formula C6H 13 NO4, due to the rich hydroxyl groups in the molecule, has good water solubility, especially in acidic conditions. The molecular structure of DNJ is highly similar to glucose, and this similarity enables it to effectively bind to the active center of α-glucosidase, thereby inhibiting the activity of the enzyme, showing multiple biological activities such as regulating blood sugar, anti-tumor, and anti-virus, and has broad application prospects.

[0003] However, although a variety of microorganisms such as Streptomyces lilacinus, Monascus purpureus, Bacillus subtilis, Escherichia coli and Bacillus amyloliquefaciens can synthesize DNJ, the problems of low yield and long fermentation cycle have always troubled researchers, seriously limiting the large-scale production and application of DNJ. Therefore, breeding microbial strains with high DNJ production, increasing DNJ production and reducing production costs have become the focus of current research. In Bacillus amyloliquefaciens, part of the DNJ synthesis pathway has been elucidated, among which the three genes gabT1, yktC1 and gutB1 play a key role in the DNJ synthesis process. However, the current strain modification work mainly focuses on these three genes, and this single modification strategy has to some extent limited the further improvement of DNJ production. In order to break through this bottleneck, researchers began to look for more potential modification targets. As a candidate gene in Bacillus amyloliquefaciens, the feuC gene is located near the key gene for DNJ synthesis and may play an important role in the DNJ synthesis process. However, the specific mechanism of action of the feuC gene in DNJ synthesis is not yet fully understood. In order to further explore the function of the feuC gene, the present invention adopts gene knockout and overexpression technology to conduct a comprehensive functional analysis of the feuC gene in Bacillus amyloliquefaciens.

[0004] This invention aims to reveal the specific mechanism of action of the feuC gene in the biosynthesis of DNJ, and provide theoretical support for the development of more efficient DNJ production strategies. At the same time, we also hope that through this study, we can break through the technical difficulties of increasing DNJ production, bring new ideas and methods to the research in the field of industrial biotechnology, and promote the large-scale production and application of DNJ. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a feuC gene, method and application for enhancing the biosynthesis of 1-deoxynojirimycin.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A feuC gene for enhancing the biosynthesis of 1-deoxynojirimycin, characterized in that the nucleotide sequence of the feuC gene is shown in SEQ ID No.1.

[0008] A protein for enhancing the biosynthesis of 1-deoxynojirimycin, encoded by the feuC gene as described above, wherein the amino acid sequence of the protein is shown in SEQ ID No.2.

[0009] An expression cassette for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the expression cassette comprises a promoter, the feuC gene and a terminator.

[0010] A vector for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the vector is selected from a plasmid, a viral vector or an artificial chromosome.

[0011] A method for improving the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin using the feuC gene as described above, the method comprising introducing the feuC gene, an expression cassette containing the feuC gene or a vector containing the feuC gene into Bacillus amyloliquefaciens.

[0012] Furthermore, the amyloliquefaciens is Bacillus amyloliquefaciens LH-2, its name is: LH-2, its classification name is: Bacillus amyloliquefaciens, its preservation number is: CGMCC No.29550, its preservation date is: January 9, 2024, and its preservation unit is: General Microbiology Center of China National Microbiological Culture Collection Administration, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0013] A recombinant strain of Bacillus amyloliquefaciens comprising the feuC gene described above and having enhanced ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin.

[0014] The method for constructing the recombinant strain as described above comprises the following steps:

[0015] Firstly, the plasmid pLH2389 carrying the feuC gene was introduced into the competent cells of Bacillus amyloliquefaciens LH-2 by electroporation, and the preliminary transformants were screened using LB medium containing 5 µg / mL chloramphenicol. The transformants were cultured at 42 ℃, transferred every 12 hours for a total of 3 times, to induce single exchange between the plasmid and the genome, and the integration was confirmed by PCR. Subsequently, the double exchange recombination was promoted by further high-temperature culture, and the double exchange strains were selected by coating LB medium containing 25 µg / mL 5-fluorouracil, and the stable integration of the feuC gene overexpression structure was confirmed by PCR. Finally, the sensitive strains were screened by chloramphenicol sensitivity test, the residual plasmids were excluded, and the accuracy of gene editing was verified by sequencing, and finally the genetically stable feuC overexpression recombinant strain was successfully obtained.

[0016] The use of the recombinant strain as described above in enhancing the fermentation production of 1-deoxynojirimycin.

[0017] The method for producing 1-deoxynojirimycin by fermentation using the recombinant strain as described above comprises the following steps:

[0018] The recombinant strains preserved in the ultra-low temperature refrigerator were taken out, streaked on LB solid medium, and cultured at 37 °C for 12 h to grow a single strain; the single colony of the bacteria was transferred to 5 mL of fresh LB liquid medium, and cultured at 37 °C and 200 r / min for 12 h for seed culture; the seed liquid of the cultured bacteria was inoculated into the fermentation medium at an inoculum rate of 4%, and cultured at 37 °C and 100 r / min for 72 h to ferment 1-deoxynojirimycin;

[0019] The formula of the fermentation medium is: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent is water, pH7.0, and sterilized at 121°C for 20 min.

[0020] The advantages and positive effects achieved by the present invention are:

[0021] 1. The present invention aims to reveal the specific mechanism of action of the feuC gene in the biosynthesis of DNJ. The feuC gene can be used to improve the biosynthesis efficiency of 1-deoxynojirimycin, providing theoretical support for the development of more efficient DNJ production strategies. At the same time, we also hope that through this study, we can break through the technical difficulties of increasing DNJ production, bring new ideas and methods to the research in the field of industrial biotechnology, and promote the large-scale production and application of DNJ.

[0022] 2. Breakthrough discovery of key genes: This invention identified and revealed for the first time the core gene in the DNJ biosynthesis pathway, the feuC gene (nucleotide sequence, see SEQ ID No. 1), whose encoded protein has unique functions (amino acid sequence, see SEQ ID No. 2), which has the function of improving the biosynthesis efficiency of 1-deoxynojirimycin. This discovery fills the key gap in the DNJ anabolic pathway, provides a new perspective for in-depth analysis of the molecular mechanism of microbial synthesis of DNJ, and lays a solid molecular foundation for subsequent genetic engineering transformation.

[0023] 3. Systematic verification of gene function: By using gene knockout and overexpression technology, the present invention clearly confirms the decisive role of the feuC gene in DNJ synthesis. Specifically, the feuC gene knockout strain completely lost the ability to produce DNJ; while the engineered strain with the feuC gene complemented increased its DNJ production by 75% compared with the wild type, which is significantly better than the existing transformation strategy. This experimental data confirmed for the first time from a functional level that the feuC gene is an essential element for DNJ biosynthesis, providing a reliable gene target for the construction of industrial high-yield strains.

[0024] 4. Targeted breakthrough of technical bottlenecks: In view of the core problems of low yield and lack of genetic modification targets in the current DNJ production, this invention proposes innovative solutions. Specifically, an expression cassette (including promoter and terminator) based on the feuC gene and a matching vector system (plasmid vector) were developed. Both the expression cassette and the vector can be used to improve the biosynthesis efficiency of 1-deoxynojirimycin, and a genetic engineering modification method for Bacillus amyloliquefaciens LH-2 (CGMCC No. 29550) was established to achieve targeted enhancement of DNJ synthesis capacity.

[0025] 5. Strategic value of industrial application: The technical solution of the present invention is not only applicable to Bacillus amyloliquefaciens LH-2, but also has wide applicability and can be extended to other Bacillus strains, providing broad application prospects and strategic value for the industrial production of DNJ. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1is a high performance liquid chromatography (HPLC) spectrum (variable wavelength detector, wavelength of 265 nm) of DNJ in the fermentation broth of the present invention;

[0027] Figure 2 A schematic diagram of the relative positions of the DNJ synthesis gene cluster and the genes on both sides in the present invention;

[0028] Figure 3 This is the map of the knockout plasmid pLH2225 in the present invention;

[0029] Figure 4 This is the map of the overexpression plasmid pLH2389 in the present invention;

[0030] Figure 5 The figure is a PCR verification result of electroporation of the knockout plasmid pLH2223 into the LH-2 strain in the present invention; wherein, M represents DNA Marker (molecular weight standard); N is a negative control (used to exclude nonspecific amplification); P is a positive control (confirming the validity of the PCR reaction) using the pLH2225 plasmid vector as a template; 1, 2, 3, and 4 are the products of PCR amplification using the genomes of different transformants obtained after the knockout plasmid pLH2225 was successfully electroporated into the LH-2 strain as templates, and the fragment size is 690 bp, which verifies the successful transfer of the knockout plasmid;

[0031] Figure 6 The figure is a PCR verification result of electroporation of the overexpression plasmid pLH2389 in the present invention into the LH-2 strain; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to exclude interference from non-specific amplification); P is a positive control using the constructed pLH2389 plasmid vector as a template (used to confirm the effectiveness and accuracy of the PCR reaction); and 1, 2, 3, and 4 are PCR amplification products of transformants obtained after the overexpression plasmid pLH2389 is successfully electroporated into the LH-2 strain, and the fragment size is 550 bp, which verifies the successful transfer of the overexpression plasmid;

[0032] Figure 7 The figure is a PCR verification result of the knockout plasmid pLH2225 in the present invention undergoing single exchange in the recombinant bacteria; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to exclude non-specific amplification); 1, 2, and 3 are PCR amplification products of the transformants, and the fragment size is 1421 bp. This result confirms that the knockout plasmid pLH2225 has successfully undergone single exchange in the recombinant bacteria;

[0033] Figure 8The figure is a PCR verification result of the single exchange of the overexpression plasmid pLH2389 in the recombinant bacteria in the present invention; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to exclude the interference of non-specific amplification); 1, 2, and 3 are PCR amplification products of the transformants, and the fragment size is 2567 bp. This result confirms that the overexpression plasmid pLH2389 has successfully undergone a single exchange in the recombinant bacteria;

[0034] Fig. 9 The figure is a PCR verification result of double exchange of the knockout plasmid pLH2225 in the present invention in the recombinant bacteria; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to exclude the interference of non-specific amplification); WT represents the genome of the wild-type Bacillus amyloliquefaciens LH-2, and its fragment size is 2059 bp, which is used as a reference; 1 is the PCR amplification product of the strain with successful knockout, and the fragment size is 1421 bp, which confirms that the knockout plasmid pLH2225 has successfully undergone double exchange in the recombinant bacteria;

[0035] Fig.10 The figure is a PCR verification result of double exchange of the overexpression plasmid pLH2389 in the present invention in the recombinant bacteria; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to exclude the interference of non-specific amplification); WT represents the genome of the wild-type Bacillus amyloliquefaciens LH-2, and its fragment size is 1517bp, which is used as a reference; 1 is the PCR amplification product of the strain with successful knock-in (or overexpression integration), and the fragment size is 2567bp. This result confirms that the overexpression plasmid pLH2389 has successfully undergone double exchange in the recombinant bacteria;

[0036] Fig.11 This is a comparison chart of the DNJ shake flask fermentation yields of strains LH-2, S4279 and S4459 in the present invention.

[0037] A Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, its name is: LH-2, its classification name is: Bacillus amyloliquefaciens, its preservation number is: CGMCC No.29550, its preservation date is: January 9, 2024, and its preservation unit is: General Microbiology Center of China Microbiological Culture Collection Administration, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with examples. It should be noted that the following examples are only narrative examples and are not restrictive descriptions, and the protection scope of the present invention cannot be limited by these examples alone. The various experimental operation steps involved in the specific embodiments are all conventional technical means in the art. For the parts not particularly noted herein, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literature or related specifications, manuals and other materials before the application date of the present invention for implementation.

[0039] A feuC gene for enhancing the biosynthesis of 1-deoxynojirimycin, characterized in that the nucleotide sequence of the feuC gene is shown in SEQ ID No.1.

[0040] A protein for enhancing the biosynthesis of 1-deoxynojirimycin, encoded by the feuC gene as described above, wherein the amino acid sequence of the protein is shown in SEQ ID No.2.

[0041] An expression cassette for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the expression cassette comprises a promoter, the feuC gene and a terminator.

[0042] A vector for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the vector is selected from a plasmid, a viral vector or an artificial chromosome.

[0043] A method for improving the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin using the feuC gene as described above, the method comprising introducing the feuC gene, an expression cassette containing the feuC gene or a vector containing the feuC gene into Bacillus amyloliquefaciens.

[0044] Preferably, the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, whose name is: LH-2, classification name is: Bacillus amyloliquefaciens, preservation number is: CGMCC No.29550, preservation date: January 9, 2024, preservation unit: General Microbiology Center of China Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0045] A recombinant strain of Bacillus amyloliquefaciens comprising the feuC gene described above and having enhanced ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin.

[0046] The method for constructing the recombinant strain as described above comprises the following steps:

[0047] Firstly, the plasmid pLH2389 carrying the feuC gene was introduced into the competent cells of Bacillus amyloliquefaciens LH-2 by electroporation, and the preliminary transformants were screened using LB medium containing 5 µg / mL chloramphenicol. The transformants were cultured at 42 ℃, transferred every 12 hours for a total of 3 times, to induce single exchange between the plasmid and the genome, and the integration was confirmed by PCR. Subsequently, the double exchange recombination was promoted by further high-temperature culture, and the double exchange strains were selected by coating LB medium containing 25 µg / mL 5-fluorouracil, and the stable integration of the feuC gene overexpression structure was confirmed by PCR. Finally, the sensitive strains were screened by chloramphenicol sensitivity test, the residual plasmids were excluded, and the accuracy of gene editing was verified by sequencing, and finally the genetically stable feuC overexpression recombinant strain was successfully obtained.

[0048] The use of the recombinant strain as described above in enhancing the fermentation production of 1-deoxynojirimycin.

[0049] The method for producing 1-deoxynojirimycin by fermentation using the recombinant strain as described above comprises the following steps:

[0050] The recombinant strains preserved in the ultra-low temperature refrigerator were taken out, streaked on LB solid medium, and cultured at 37 °C for 12 h to grow a single strain; the single colony of the bacteria was transferred to 5 mL of fresh LB liquid medium, and cultured at 37 °C and 200 r / min for 12 h for seed culture; the seed liquid of the cultured bacteria was inoculated into the fermentation medium at an inoculum rate of 4%, and cultured at 37 °C and 100 r / min for 72 h to ferment 1-deoxynojirimycin;

[0051] The formula of the fermentation medium is: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent is water, pH7.0, and sterilized at 121°C for 20 min.

[0052] Specifically, the relevant preparation and detection are as follows:

[0053] Example 1 Screening and identification of strain Bacillus amyloliquefaciens LH-2

[0054] (1) Screening of DNJ-producing strains and fermentation testing

[0055] It was isolated from cattle dung in a cattle farm (address: Xiazhuanger Village, Wangcun Township, Laishui County, Baoding City, Hebei Province, China).

[0056] Grind the collected cow dung samples, pass them through a 60-100 mesh sieve, take 1g of the sample and add it to 15-50mL LB liquid culture medium with glass beads, shake it thoroughly in 80-90℃ water for 10-15 min, and then culture it on a 28℃ shaker (120rpm) for 24 h. After the culture is completed, bathe it in 80-90℃ water for 10-15 min again, dilute it appropriately by the 10-fold dilution method, and take the diluted 10 5 , 10 6 and 10 7 Spread 0.1 ml of each of the three dilutions on LB solid medium, invert and culture at 28-37°C for 2-5 days, and observe every day. Select white colonies with irregular, bumpy, and uneven edges, and purify them through 3-5 rounds of streaking and subculture as candidate strains.

[0057] Use an inoculation loop to inoculate the selected strain into the test tube LB liquid medium, and culture at 100-200 rpm and 28-37 ℃ for 8-24 h for seed culture. Inoculate 100-1000 μl of seed liquid into a 500 ml shake flask with baffles (containing 50-200 mL fermentation medium), and culture at 28-37 ℃ and 100-200 rpm for 2-3 days to obtain the primary screening fermentation liquid. Take 1 mL of the fermentation liquid, centrifuge at 10000 rpm for 10 minutes, remove the bacteria, and use the supernatant for 1-deoxynojirimycin detection.

[0058] The sample processing and detection methods refer to the national standard detection method "Detection of 1-deoxynojirimycin in mulberry leaf extract" (GB / T40642-2021), in which the liquid chromatography detection wavelength is set at 265 nm.

[0059] The LB medium formula consists of: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent is water, the pH is adjusted to 7.0, and 2% agar powder needs to be added to the solid culture medium.

[0060] The fermentation medium formula consists of: 0.1~100 g / L starch, 0.1~20 g / L soy peptone, 0.01~ 10.0 g / L (NH4)2SO4, 0.01~20.0 g / L K2HPO4, 0.01~20.0 g / L KH2PO4, 0.01~10 g / L MgSO4·7H2O or MgSO4, 0.01~5 g / L CaCl2, 0.01~100 mg / L MnSO4, 0.01~500 mg / L Fe2(SO4)3, 0.01~100 mg / L ZnCl2, the solvent is water, and the pH is adjusted to 4.0~9.0.

[0061] Experimental results: A total of 600 bacterial strains were isolated in the present invention, and 50 strains producing 1-deoxynojirimycin were isolated, wherein the content of 1-deoxynojirimycin was the highest at 1.5 g / L. The HPLC spectrum thereof is as follows: Figure 1 As shown, the single plant was picked out and numbered as LH-2.

[0062] (2) Strain species identification based on 16S rRNA gene sequencing

[0063] The strain LH-2 was inoculated into LB liquid medium and cultured at 28-37 °C for 24 h. The bacteria were collected by centrifugation (8,000 × g, 10 min). The genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen, DP302), and the 16S rRNA gene was amplified with universal primers 27F and 1492R (as shown in Table 1) (PCR conditions: 94 °C pre-denaturation for 5 min; 94 °C 30 s, 55 °C 30 s, 72 °C 90 s, 30 cycles; 72 °C final extension for 10 min). The amplified product was purified after verification by 1% agarose gel electrophoresis and sent to Jinweizhi Biotechnology Co., Ltd. for bidirectional sequencing. The obtained 16S rDNA sequence (SEQ ID No. 3) was submitted to the NCBI database for BLASTn homology comparison (parameter settings: E-value ≤ 1e-50, coverage ≥ 95%). As shown in Table 2 (only five strains with higher homology are listed in the table), the sequence had 100% similarity with the 16S rRNA gene of different Bacillus amyloliquefaciens strains such as Bacillus amyloliquefaciens strain H, so the strain was identified as Bacillus amyloliquefaciens.

[0064] The Bacillus amyloliquefaciens LH-2 is named LH-2, classified as Bacillus amyloliquefaciens, deposited at CGMCC No. 29550, deposited on January 9, 2024, and deposited at China National Center for the Administration of Microbiological Culture Collection, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0065] Table 1 Sequences of primers used

[0066]

[0067] Table 2 BLASTn homology comparison results of 16S rRNA sequences of strain LH-2

[0068]

[0069] Example 2 Discovery of feuC gene based on genome sequencing of Bacillus amyloliquefaciens strain LH-2

[0070] In B. amyloliquefaciens, the metabolic pathway of DNJ has been partially elucidated, among which the gabT1, yktC1, and gutB1 gene clusters have been clearly confirmed as the core components of DNJ biosynthesis. However, there is currently a lack of systematic and in-depth exploration of the potential role of genes in the flanking regions of the gene cluster in DNJ synthesis. In view of this, this study conducted whole-genome sequencing analysis on the DNJ-producing B. amyloliquefaciens strain LH-2 (CGMCC No.29550) (sequencing work was completed by Suzhou GENEWIZ Biotechnology Co., Ltd. / GENEWIZ). Through this analysis, we first discovered the feuC gene (SEQ ID No. 1) in the flanking region of the gabT1-yktC1-gutB1 gene cluster, which encodes a transporter (amino acid sequence shown in SEQ ID No. 2). Although the specific function of the feuC gene in DNJ synthesis has yet to be elucidated, the present invention has begun to identify its role in DNJ biosynthesis by knocking out and complementing the feuC gene in Bacillus amyloliquefaciens LH-2, aiming to open up new ways to increase DNJ production. Figure 2 .

[0071] Example 3 Construction of feuC gene editing vector

[0072] (1) Construction of feuC gene knockout vector pLH2225

[0073] First, based on the sequenced genome of Bacillus amyloliquefaciens LH-2 (sequencing service provided by Suzhou GENEWIZ Biotechnology Co., Ltd. / GENEWIZ), two pairs of specific primers feuCUP-F / feuCUP-R and feuCDN-F / feuCDN-R were designed (primer sequences are shown in Table 1). Subsequently, the genomic DNA of Bacillus amyloliquefaciens LH-2 (see Example 1 for the extraction step) was used as a template, and high-fidelity Phanta Max Super-Fidelity Polymerase (Nanjing Novozyme Biotechnology Co., Ltd., Product No. P505-d1) was used for PCR to successfully amplify the upstream and downstream homology arm sequences of the feuC gene (sequences are SEQ ID No. 4 and No. 5, respectively). The specific configuration of the PCR reaction system is shown in Table 3. The amplified product was then purified by a common DNA product purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Product No. DP204) to obtain a high-purity DNA fragment. Finally, the purified upstream and downstream homology arm sequences of the feuC gene were precisely ligated to the BamHI restriction site of the pKSU plasmid using the ClonExpress Ultra One Step Cloning Kit V (Nanjing Novogene Biotech Co., Ltd., Cat. No. C117-01), thereby successfully constructing the feuC gene knockout vector pLH2225 (see the vector structure diagram for details). Figure 3 ). The specific configuration of the one-step cloning reaction system of ClonExpress Ultra One Step Cloning Kit V is shown in Table 4.

[0074] Table 3 PCR amplification system of Phanta Max Super-Fidelity Polymerase

[0075]

[0076] Table 4 ClonExpress Ultra One Step Cloning Kit V one-step cloning system

[0077]

[0078] Special note: Plasmid pKSU is the core tool vector for genetic manipulation of Bacillus amyloliquefaciens. It has become the preferred system for gene editing of this species due to its high transformation efficiency, multiple cloning site compatibility and stable replication characteristics. This plasmid was first reported by Zhang et al. in Applied Microbiology and Biotechnology in 2014. The markerless gene replacement technology developed by them was successfully applied to the genome streamlining and optimization of poly-γ-glutamic acid synthesis pathway (Zhang, W., Gao, WX, Feng, J., Zhang, C., He, YL, Cao, MF, et al. (2014) A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production. Appl Microbiol Biotechnol98: 8963–8973.). Currently, the genetic operating system based on pKSU has been included in the Bacillus Genetic Stock Center (BGSC).

[0079] (2) Construction of feuC gene overexpression vector pLH2389

[0080] Using pKSU as the starting vector, the feuC gene overexpression vector pLH2389 integrated into the pksJ gene target site (sequence identification number: SEQ ID No. 6) was designed and constructed. The specific construction process is as follows: First, using the genomic DNA of Bacillus amyloliquefaciens LH-2 (see Example 1 for the extraction step) as a template, high-fidelity Phanta Max Super-Fidelity Polymerase (Nanjing Novogene Biotechnology Co., Ltd., catalog number P505-d1) was used, and PCR was performed using pksJUP-F / pksJUP-R and pksJDN-F / pksJDN-R primers (primer sequences are shown in Table 1 for details), and the upstream and downstream homology arm sequences of the pksJ gene were successfully amplified (sequences are SEQ ID No. 7 and No. 8, respectively). At the same time, the amyS promoter sequence (SEQ ID No. 9) was amplified with amsy-F / asmy-R primers (primer sequences are shown in Table 1), and the feuC gene sequence (SEQ ID No. 1) was amplified with feuC-F / feuC-R primers (primer sequences are shown in Table 1). Subsequently, the PCR amplification product was purified by a common DNA product purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Catalog No. DP204) to obtain a high-purity DNA fragment. Finally, the purified pksJ gene upstream and downstream homology arms, amyS promoter and feuC gene were connected to the BamHI restriction site of the pKSU plasmid using the ClonExpress Ultra One Step Cloning Kit V3 one-step cloning kit (Nanjing Novogene Biotechnology Co., Ltd., Catalog No. C117-01), thereby successfully constructing the feuC gene overexpression vector pLH2389 (vector structure diagram is shown in Figure 4 ).

[0081] Example 4 Construction of feuC gene knockout and overexpression recombinant strains

[0082] (1) Preparation of competent cells of Bacillus amyloliquefaciens LH-2

[0083] 1) Take out the strain LH-2 stored at -80℃, make three-zone lines on LB solid medium, and culture it in a 37°C incubator for 12-24 hours until a clear single colony appears. Pick a single clone and inoculate it into LBS medium (containing 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, 91.0 g / L sorbitol, and the solvent is water) and culture it overnight.

[0084] 2) Transfer the bacterial solution to a sterile centrifuge tube and place on ice for 30 min. Then centrifuge at 8000 r / min and 4 °C for 20 min to collect the bacterial cells.

[0085] 3) Add about 60 mL of elution buffer (containing 91.0 g sorbitol, 91.0 g mannitol, 50 g glycerol, and dilute to 0.5 L with water), mix well, and centrifuge again for 20 min under the same conditions to collect the cells. Repeat this operation twice.

[0086] 4) Add 500 μL of the resuspension prepared for electroporation (containing 0.91 g sorbitol, 0.91 g mannitol, 0.1 g glycerol, 1.4 g PEG6000, and dilute to 10 mL with water), and gently resuspend the cells thoroughly.

[0087] 7) Aliquot the competent cells into sterile EP tubes at 100 μL each and store at -80 °C for later use.

[0088] (2) Electroporation of feuC gene editing vector into Bacillus amyloliquefaciens

[0089] 1) Thaw the competent cells naturally on ice, add appropriate amount of pLH2225 and pLH2389 plasmids (no more than 200 ng), and mix thoroughly.

[0090] 2) Transfer the above system to a pre-cooled sterile electroporation cup (2 mm specification) and place on ice for 2-3 min.

[0091] 3) Perform electroporation at 2500 V, then add 1 mL of pre-cooled electroporation bacterial recovery liquid culture medium (0.38 mol / L mannitol dissolved in LBS culture medium) into the electroporation cup and mix by pipetting.

[0092] 4) Transfer the above bacterial solution to an EP tube and culture at 30 °C and 180 rpm for 3 h.

[0093] 5) Centrifuge at 8000 r / min for 2 min to concentrate the cells, take 100 μL of the bacterial solution and spread it on LB solid medium containing chloramphenicol (5 μg / mL) and culture it statically. Culture it at 30 °C for 48 h, and transformants can be seen growing.

[0094] (3) Screening and verification of feuC gene knockout and overexpression recombinant strains

[0095] 1) Inoculate the transformants obtained by electroporation in the previous step into LB liquid medium containing 5 μg / mL chloramphenicol and culture at 30°C overnight;

[0096] 2) PCR verification was performed on the overnight culture using primers p1 / p2 to ensure that the feuC knockout plasmid pLH2225 and the overexpression plasmid pLH2389 were successfully electroporated into the competent cells of Bacillus amyloliquefaciens LH-2. The enzyme preparation used for PCR amplification verification was 2×Rapid Taq Master Mix from Nanjing Novozyme Biotech Co., Ltd. The specific method is shown in Table 5. The results are shown in Table 5. Figure 5 and Figure 6 As shown, the results showed that pLH2225 and pLH2389 were electroporated into Bacillus amyloliquefaciens LH-2.

[0097] 3) The correct transformants of the two plasmids were transferred to fresh LB liquid medium containing 5 μg / mL chloramphenicol, and subcultured at 42°C, with transfer every 12 hours for a total of 3 times to promote single exchange of plasmids in the strain.

[0098] 4) After diluting the bacterial suspension of the two plasmids in step 3 appropriately, take 100 μL and spread it on LB solid medium containing 5 μg / mL chloramphenicol. Incubate at 30 °C for 48 h. Single colonies can be seen growing. Using primers p3 / p4, PCR detection of single colonies of knockout plasmid pLH2225 is performed. The results are as follows: Figure 7 As shown; primers p5 / p6 were used to perform PCR detection on a single colony of the overexpression plasmid pLH2389, and the results were as follows Figure 8 The results are shown in Figure 7 and Figure 8 As shown, the results showed that pLH2225 and pLH2389 completed single exchange in Bacillus amyloliquefaciens LH-2, respectively, and single exchange transformants of the two plasmids were screened and obtained.

[0099] 5) Transfer the obtained single exchange transformants of the two plasmids to LB liquid culture medium respectively, and subculture at 42°C, transferring once every 12 hours for a total of 3 times to promote double exchange of single exchange transformants.

[0100] 6) Dilute the bacterial suspension of the two plasmids in step 5) appropriately, spread on LB solid medium containing 25 μg / mL 5-fluorouracil, and culture at 30 °C for 48 h. Single colonies can be seen growing. Perform PCR detection on the single colonies of the two plasmids to screen for double exchange strains. Using primers p7 / p8, perform PCR detection on the single colony of the knockout plasmid pLH2225. The results are as follows: Fig. 9 As shown; primers p9 / p10 were used to perform PCR detection on a single colony of the overexpression plasmid pLH2389, and the results were as follows Fig.10 The results are shown in Fig. 9 and Fig.10As shown, it was shown that double exchange transformants of two plasmids were obtained, thereby obtaining feuC gene knockout and overexpression recombinant transformants.

[0101] 7) The feuC gene knockout and overexpression recombinant transformants obtained in 6) were inoculated into LB liquid medium, cultured overnight at 30 °C, and diluted and spread on LB solid medium. After culture at 30 °C for 48 h, single colonies were visible. The single colonies were respectively inoculated on LB solid medium and LB solid medium containing 5 μg / mL chloramphenicol to determine whether the recombinant transformants were sensitive to chloramphenicol. The chloramphenicol-sensitive strains were selected and sent for sequencing verification. Finally, the feuC gene knockout recombinant strain S4279 and the overexpression recombinant strain S4459 were obtained.

[0102] Table 5 PCR verification system

[0103]

[0104] Example 4 DNJ shake flask fermentation of strains LH-2, S4279 and S4459

[0105] (1) DNJ shake flask fermentation

[0106] Take out the preserved strains LH-2, S4279 and S4459 from the ultra-low temperature refrigerator, streak inoculate on LB solid medium, and incubate at 37 °C for 12 h to grow single strains. Transfer the single colonies of the three bacteria to 5 mL fresh LB liquid medium, incubate at 37 °C and 200 r / min for 12 h for seed culture. Inoculate the seed liquid of the three cultured bacteria into 30 mL fermentation medium (250 mL triangular flask) at an inoculation rate of 4% (v / v, volume ratio), incubate at 37 °C and 100 r / min for 72 h, and perform DNJ fermentation. Set up 3 shake flask experiments for each strain fermentation. The fermentation medium used was: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent was water, pH 7.0, and sterilized at 121℃ for 20 min.

[0107] (2) Fermentation broth treatment and DNJ determination

[0108] The fermentation broth was centrifuged at 12000 r / min for 5 min, and the supernatant was then aspirated for later use. Next, 35 µL of the fermentation supernatant or DNJ standard solution was added to a 1.5 mL centrifuge tube. Then, 200 µL of 0.4 mol / L potassium borate buffer (pH 8.5) and 250 µL of 5 mmol / L derivatization reagent fluorenylmethoxycarbonyl chloride solution (FMOC-Cl, dissolved in 50% acetonitrile) were added in sequence. After thorough mixing, the mixture was placed in a constant temperature water bath at 25 °C for 20 minutes. After the reaction was completed, 25 µL of 1 mol / L glycine aqueous solution was added to terminate the reaction, and 100 µL of 1% (V / V) acetic acid aqueous solution was added, and the volume was adjusted to 800 µL with water. Finally, the solution was filtered using a microporous filter membrane with a pore size of 0.22 µm, and the filtrate was collected as a subsequent test sample.

[0109] The samples were determined by high performance liquid chromatography. The chromatographic column was ZORBAX SB-C18 (specification: 5µm, 4.6×150mm), the detector was an ultraviolet detector, and the detection wavelength was 254 nm. The mobile phase was acetonitrile-0.1% acetic acid (1:1, V / V), the flow rate was 1.0 mL / min, and the injection volume was 20 µL.

[0110] (3) Analysis of DNJ shake flask fermentation results

[0111] After 72 hours of shake flask fermentation, the DNJ production of the starting strain Bacillus amyloliquefaciens LH-2 was 1.5 g / L, the recombinant strain S4279 with the feuC gene knocked out almost completely produced no DNJ, and the DNJ production of the strain S4459 overexpressing feuC was 2.7 g / L. Compared with the wild-type Bacillus amyloliquefaciens LH-2, the DNJ production of the strain S4459 overexpressing feuC increased by 80% ( Fig.11 ), verifying the key role of the feuC gene in the biosynthesis of 1-deoxynojirimycin.

[0112] In summary, the present invention has made a breakthrough in identifying and revealing the core gene feuC for DNJ biosynthesis of Bacillus amyloliquefaciens, filling the key gap in the synthetic metabolic pathway; through gene knockout and overexpression technology, it has been systematically verified that feuC is an essential gene for DNJ synthesis, and the yield is significantly improved after complementation; at the same time, an expression cassette and vector system based on feuC has been developed, and a genetic engineering modification method for Bacillus amyloliquefaciens has been established, which directionally enhances the synthesis capacity of DNJ; this technical solution has wide applicability and provides broad application prospects and strategic value for the industrial production of DNJ.

[0113] The sequences used in the present invention are as follows:

[0114] SEQ ID NO.1 feuC fragment:

[0115]

[0116] SEQ ID NO.2 feuC amino acid sequence:

[0117] VRKMAGIYIILIVLILLVSYFSMTSGSFSAKPGELLSTLFHIHPNPQYEILLFQLRLPRIVMAAAIGLGLGIAGTVIQAITKNGLADPGILGINAGAGAGIVAFMLLFQGQSEATALASAMGMPVFGLIGGLMAAVLIYIFAWHRGHLESGRIILVGIAMNSGFSALSLFLSLKMDPQDYEMAMVWKNGSIWSANWMTITAILPWLIVFIPLLMAKMSLLDTIRFDEDTVKSLGVSSNKEKTILLVACIALISACVTAAGSMAFVGLIAPHISRRLAGIEHRYSLPVSGLVGMLLVISADFAGKLFFQPSEVPAGIILAILGVPYFFFLLFKQKKGLDA

[0118] SEQ ID NO:3 16S rDNA sequence:

[0119]

[0120] SEQ ID NO.4 Nucleotide sequence upstream of the feuC gene:

[0121] CGGACATAGTCTGCCGATTTTTCATACCAGAAGGACCCGGAGATACAGCCGATTCTGCCGAATATCTCAGGCTTCTGTAACATCGCGTACATTGAAAACAATCCGCCTAATGACGCGCCGATCAGTCCTCTTGTTTCCGGGTCCGGAGACATGTGATGCATATCTTCAACCGTTGGGATGATGGTATTTGTCAGGTCTTCAAGAAAGAGGCTCCCTTTGCCGCCGAAATCATGAAACGCAGGGCTCAGGGAAGGCGCAGGCCATGGTGTGTACTCATCGAGCCTGTTATCCGGTTTGATGCCGGCGAAAATCAATTCAGGAAGTGTTCCGTTCGCAAATTGGAATTCAAGCTTCTCCATCTGCTCTAAAAACAAAACACCCCCATCAAGTACGTAAACCCAGGGTAAAGCCTTGGTTTGAACCGAATAGGAGGGAGGAAGATACACCGTGCATTCCTTTCCGTTTATCCGGTGTTCTGTGAGTGTGCCTCTCATGCGTCCAATCCCTTTTTTTGTTTAAACAGCAGAAAAAAGAAATAAGGAACGCCGAG

[0122] SEQ ID NO.5 Nucleotide sequence downstream of the feuC gene:

[0123] ATAGCTTACGAGCAATATGAGAACAATCAGTATGATATAAATTCCGGCCATTTTACGCACCGCGCTGATCCCCTCCTTTTCTTTTAATCAAATAAAGAAAGAAAGGAACACCGATGATAGAAGTAACAACTTCAATAGGTGTCTCAAACGGATAATTGATCAATCGGCTGGCAAGATCGCAAAAGGTCAGGAAGACGCCGCCGATGATGCACGCGCAGGGAATCAGCCTGCTGTAGTCTGATCCGACGAGAAAGCGTGTGATGTGCGGAACGACCAAACCGACAAAGGCAATTTTTCCGGCGAGCGCCACCGAGCTTCCGGTCAATATGACAACGGCCGCCATCGCCATGAGTTTGATAGTTCTTTTCTGCTGTCCCAGACTTTTTGAAATGTCGTCTCCTAATGATACGGCTGTAACCTTTTTGCTGAGAATCATGGCCGTGATGATTCCGATAGCGAAAAACGGGACGGCCAGTTTCAAAAAATCAGGGTTCATTTGATGCAGTCTCGCACTGTACCAAAAACTGAGATCCTGCGAGATTTGAAAATA

[0124] SEQ ID No.6 pksJ locus:

[0125]

[0126] SEQ ID No.7 Upstream homologous arm of pksJ:

[0127] CAGAAGACATTCAAAACCGGAAATGGGACTTATCCTCCATGCGTTACATGCTGAACGGAGGGGAGGCCACGGTTGCGAAAGTCGGGCGCAGAATTATGGAGCTTTTAGAGCCGCATGGTCTGCCGGCTAATGCCATCCGTCCCGCATGGGGAATGTCCGAAACATCTTCAGGCGTTATTTTCTCAGATGAGTTTACACTGGAAAACACGAGTGATGATGATCGTTTCGTGGAGATCGGTCTCCCGATTCCGGGGTTTAATATGAGAATTACGGATGACCGCAATCAGGTGGTGGAAGAAGGAGAAATCGGACGTTTCCAAGTGTCGGGTCTGACTGTAACAAGCGGTTATTATGAGCGTCCGGACTTAAACGAGAGTGTCTTTACAGAAGACGGCTGGTTTGAAACGGGAGATCTCGGCTTTCTGCGTGAAGGCCGCCTGACGATAACGGGCCGAACGAAAGATGCCATCATTATCAACGGTGTGAATTATTACAGCCAC

[0128] SEQ ID No.8 Downstream homologous arm of pksJ:

[0129] TCATTACATAATAACAAGCAAGAAGACGGCCGTTCAGAATCGGCTTCTGCGGAGAAAGAGATTGAACGGGATTTTATCCGTTTTCTGAAAGAGGAACTTTCTATCGCGGATGAACTCGTTGATCCGCATACACCGCTTCAAAGTCTTGGCGTCAATTCCATCAAGATGATGAAACTCGCCAGATCGATTGAAAAAACGTATCATATCCGGCTGACGGCGCGAGAGCTGCACAAGAACCCGACCATTGGCGCTTTAGCGGCTTATACCGCTGAAAAAGCGGGTAGCACCTCCGCTGATCATCATCCCGCAAAAGCCGAGCTGCCGGCAGAACGTGAGAAACAGAAAACGGCGCCAGCGCTTTCAGAAGTGCAAAAAGGGCTGTGGACATTGCAGAAAATGTCGCCTGAAACGACTGCATACCATGTCCCGCTCTGTTTCCGATTCACATCAGGAATCAACAAAGAGAAAATGAAGCAGGCGTTTCAGCTCGTATTAACACA

[0130] SEQ ID No.9 amyS promoter:

[0131] GAAATTAAAAAGCTGGCGGATGAAGGACGCATCCGCTGGATTCCCCGGAGAATTGAAATGAAAGATCTCAAGCCCGCTTTTTCATTATTGCCGCGACAAATGACCGAGGCGTGAATCAGGAGATAGCCGCAAACGCTTCTGAAACGCAGCTGGTCAACTGTGTAAGCAAGGCTGAACAAGGCAGCGTATATATGCCGAAGATCATCCGCAAAGGGCGCATTCAAGTATCAGTATCAACAAGCGGGGCAAG CCCCGCACATACGAAAAGACTGGCTGAAAACATTGAGCCTTTGATGACTGATGATTTGGCTGAAGAAGTGGATCGATTGTTTGAGAAAAGAAGAAGACCATAAAAATACCTTGTCTGTCATCAGACAGGGTATTTTTTATGCTGTCCAGACTGTCCGCTGTGTAAAAAATAGGAATAAAGGGGGGTTGTTATTATTTTACTGATATGTAAAATATAATTTGTATAAGAAAATGAGAGGGAGAGGAAACATG

[0132] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A feuC gene for enhancing the biosynthesis of 1-deoxynojirimycin, characterized in that: The nucleotide sequence of the feuC gene is shown in SEQ ID No.

1.

2. A protein that enhances the biosynthesis of 1-deoxynojirimycin encoded by the feuC gene according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID No.

2.

3. An expression cassette for enhancing 1-deoxynojirimycin biosynthesis comprising the feuC gene according to claim 1, characterized in that: The expression cassette comprises a promoter, the feuC gene and a terminator.

4. A vector for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene according to claim 1, characterized in that: The vector is selected from a plasmid, a viral vector or an artificial chromosome.

5. A method for improving the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin using the feuC gene as claimed in claim 1, characterized in that: The method comprises introducing the feuC gene, an expression cassette comprising the feuC gene or a vector comprising the feuC gene into Bacillus amyloliquefaciens.

6. The method according to claim 5, characterized in that: The amyloliquefaciens is Bacillus amyloliquefaciens LH-2, whose name is LH-2, whose classification name is Bacillus amyloliquefaciens, and whose preservation number is CGMCC No.29550. 7 . A recombinant strain of Bacillus amyloliquefaciens comprising the feuC gene of claim 1 and having enhanced ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin.

8. The method for constructing a recombinant strain according to claim 7, characterized in that: The steps include: Firstly, the plasmid pLH2389 carrying the feuC gene was introduced into the competent cells of Bacillus amyloliquefaciens LH-2 by electroporation, and the preliminary transformants were screened using LB medium containing 5 µg / mL chloramphenicol. The transformants were cultured at 42 ℃, transferred every 12 hours for a total of 3 times, to induce single exchange between the plasmid and the genome, and the integration was confirmed by PCR. Subsequently, the double exchange recombination was promoted by further high-temperature culture, and the double exchange strains were selected by coating LB medium containing 25 µg / mL 5-fluorouracil, and the stable integration of the feuC gene overexpression structure was confirmed by PCR. Finally, the sensitive strains were screened by chloramphenicol sensitivity test, the residual plasmids were excluded, and the accuracy of gene editing was verified by sequencing, and finally the genetically stable feuC overexpression recombinant strain was successfully obtained.

9. Use of the recombinant strain according to claim 7 in enhancing the fermentation production of 1-deoxynojirimycin.

10. A method for producing 1-deoxynojirimycin by fermentation using the recombinant strain according to claim 7, characterized in that: The steps include: The recombinant strains preserved in the ultra-low temperature refrigerator were taken out, streaked on LB solid medium, and cultured at 37 °C for 12 h to grow a single strain; the single colony of the bacteria was transferred to 5 mL of fresh LB liquid medium, and cultured at 37 °C and 200 r / min for 12 h for seed culture; the seed liquid of the cultured bacteria was inoculated into the fermentation medium at an inoculum rate of 4%, and cultured at 37 °C and 100 r / min for 72 h to ferment 1-deoxynojirimycin; The formula of the fermentation medium is: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent is water, pH7.0, and sterilized at 121°C for 20 min.

Images