Application of brassica juncea BjuTPR2 gene in regulation and control of flowering period of plants

Abstract

The invention discloses application of a brassica juncea BjuTPR2 gene in regulation and control of a plant flowering period, and relates to the technical field of plant biology.The technical key points are as follows: the BjuTPR2 gene is cloned in brassica juncea by utilizing a homologous cloning method, and the BjuTPR2 gene is connected to a plant expression vector or an interference vector and is transformed into a plant through agrobacterium tumefaciens mediation, so that the brassica juncea BjuTPR2 gene is obtained. Through cultivation, a BjuTPR2 overexpression plant and a BjuTPR2 interference plant can be obtained. Phenotype observation shows that compared with a wild type, the flowering time of an interference plant is earlier than that of the wild type, and the flowering time of an overexpression plant is obviously later than that of the wild type. Meanwhile, the relative expression quantity of BjuTPR2 in an overexpressed plant is obviously higher than that of a wild type; and the relative expression quantity of the flowering integron BjuSOC1 and BjuFT genes is obviously lower than that of the wild type. On the contrary, the expression quantity of BjuTPR2 in an interference plant is obviously lower than that of a control group; and the expression quantity of BjuSOC1 and BjuFT is obviously higher than that of a control group. Therefore, the BjuTPR2 gene can advance / delay bolting and flowering time of brassica juncea, and has an application prospect in the aspect of improving high-quality brassica juncea varieties.

Description

Technical Field

[0001] The invention relates to the field of plant biotechnology, and in particular to application of Brassica juncea BjuTPR2 gene in regulating bolting and flowering. Background Art

[0002] Mustard (Brassica juncea) is a crop of the genus Brassica in the family Cruciferae, widely planted around the world. Mustard contains a large amount of dietary fiber and vitamins, as well as rich glucosinolates. Therefore, mustard is widely used in pickling and processing, and is a specialty vegetable with important economic value. Bolting and flowering are important agronomic traits of mustard, which marks the transition of the plant from vegetative growth to reproductive growth. Too early or too late transition to flowering is not conducive to plant growth and development. Timely bolting and flowering can ensure mustard yield and quality without affecting plant reproduction and breeding.

[0003] During plant growth and development, each period is strictly regulated by related genes. Transcriptional activation or inhibition are two ways to achieve gene control, among which corepressors play an important role in inhibiting the expression of downstream genes.

[0004] To this end, the present invention cloned the BjuTPR2 gene in mustard tuber by homologous cloning, obtained BjuTPR2 overexpression and BjuTPR2 interference in mustard plants through genetic transformation, and clarified the mechanism of BjuTPR2-based regulation of mustard bolting and flowering, exploring a new method for regulating the flowering period of mustard, providing a reference for the innovation of mustard bolting-resistant germplasm and the breeding of new varieties. Summary of the invention

[0005] To solve the above technical problems, the present invention provides an application of the mustard BjuTPR2 gene in regulating the flowering period of plants. To solve the problem of how to regulate the bolting and flowering of mustard, the present invention clones the BjuTPR2 gene in mustard using a homologous cloning method, obtains BjuTPR2 overexpression and BjuTPR2 interference plants through genetic transformation, finds that BjuTPR2 can regulate the bolting and flowering time, clarifies the function of BjuTPR2 in bolting and flowering, and establishes a new method for regulating the flowering period of mustard.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] The invention discloses an application of the mustard BjuTPR2 gene in regulating the flowering period of a plant. The open reading frame of the BjuTPR2 gene has a sequence as shown in SEQ ID NO.1. The expression level of the BjuTPR2 gene is increased in the plant to inhibit the flowering of the plant; the expression level of the BjuTPR2 gene is reduced in the plant to promote the flowering of the plant. The plant is mustard.

[0008] Preferably, the amino acid sequence of the protein encoded by the BjuTPR2 gene is shown in SEQ ID NO.2.

[0009] Preferably, the method for increasing the expression level of the BjuTPR2 gene in the plant is: increasing the expression of the endogenous BjuTPR2 gene in the plant, or overexpressing the exogenous BjuTPR2 gene in the plant.

[0010] Preferably, the overexpression of the exogenous BjuTPR2 gene refers to connecting the BjuTPR2 gene to a plant expression vector and transforming it into the plant via Agrobacterium-mediated transformation.

[0011] Preferably, the plant expression vector is overexpression pCAMBIA1300-525-bar.

[0012] Preferably, the method for reducing the expression level of the BjuTPR2 gene in plants is: constructing an interference expression vector to reduce the expression of the BjuTPR2 gene.

[0013] Preferably, the construction of the interference expression vector refers to connecting the BjuTPR2 gene to the interference vector and transforming it into the plant via Agrobacterium-mediated transformation.

[0014] Preferably, the interference vector is RNAi-zice.

[0015] Preferably, the BjuTPR2 gene is introduced into plant cells, tissues or organs by constructing an interference expression vector to produce interfering RNA to inhibit the expression of the BjuTPR2 gene.

[0016] Preferably, the transformation into plants mediated by Agrobacterium is specifically to introduce a plant overexpression vector or interference vector of the BjuTPR2 gene into cells, tissues or organs of the plant.

[0017] The present invention also provides a recombinant vector, a transgenic cell line or a recombinant bacterium containing the gene.

[0018] Preferably, the above-mentioned recombinant bacteria are recombinant bacteria obtained by inserting the above-mentioned gene into an expression vector.

[0019] The present invention also provides a method for advancing / delaying plant flowering, which comprises introducing the BjuTPR2 gene into plant cells, tissues or organs to obtain transgenic plants.

[0020] Compared with the prior art, this solution has the following beneficial effects:

[0021] The present invention provides an application of the mustard BjuTPR2 gene in regulating plant flowering. BjuTPR2 overexpression and BjuTPR2 interference plants are obtained through genetic transformation. The application of the mustard BjuTPR2 gene sequence can change the flowering time of mustard, affect the relative expression levels of BjuTPR2, BjuSOC1, and BjuFT, and regulate the growth, development and quality of mustard plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the electrophoresis diagram of the B. juncea TPR2 gene cloned in Example 1;

[0023] Figure 2 Phenotypic observation of BjuTPR2 overexpressing Brassica juncea (WT represents wild-type control, OE#1 and OE#4 represent Brassica juncea overexpressing strains);

[0024] Figure 3 The expression changes of different genes in BjuTPR2 overexpressed mustard (A is the expression change of BjuTPR2, B is the expression change of BjuFT, C is the expression change of BjuSOC1; WT is the control, OE#1 and OE#4 are both mustard overexpression lines, * is P<0.05; ** is P<0.01, **** is P<0.0001);

[0025] Figure 4 Observation of BjuTPR2 interference phenotype in mustard (A indicates BjuTPR2 interference phenotype in mustard; B indicates statistics of BjuTPR2 interference in flowering time in mustard; WT is the control, Ri#11 and Ri#13 both indicate BjuTPR2 interference in mustard lines, * is P<0.05; ** is P<0.01, **** is P<0.0001);

[0026] Figure 5 The expression changes of different genes in mustard caused by BjuTPR2 interference (A is the expression change of BjuTPR2, B is the expression change of BjuFT, C is the expression change of BjuSOC1; WT is the control, Ri#11 and Ri#13 both represent BjuTPR2 interference mustard lines, * is P<0.05; ** is P<0.01, **** is P<0.0001). DETAILED DESCRIPTION

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0029] In order to make the purpose, technical solution and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] Example 1 Cloning of the cDNA sequence of the mustard BjuTPR2 gene

[0031] 1. Extraction of total RNA from Brassica juncea

[0032] use The total RNA of Brassica juncea was extracted using the Sμper kit, which was ordered from Promega (Beijing) Biotechnology Co., Ltd. The operating steps were referred to the kit manual.

[0033] 2. First-strand cDNA Synthesis

[0034] The kit used for reverse transcription is the Evo M-MLV reverse transcription premix kit. The specific steps are as follows:

[0035] (1) Removal of gDNA: The reaction system is 2 μL of gDNA Clean Reaction Mix solution, 2 μL of Total RNA, and 16 μL of RNase free water. The reaction procedure is 42°C / 2 min, 4°C / ∞.

[0036] (2) Reverse transcription: The reaction system is 16 μL of the reaction solution in step (1) and 4 μL of 5×Evo M-MLV RT ReactionMix Ver.2, for a total of 20 μL. The reaction procedure is 37°C / 5 min, 85°C / 5 sec, and 4°C / ∞; all the above operations are performed on ice.

[0037] 3. Cloning of B. juncea BjuTPR2 gene

[0038] (1) Primer 3Plus was used for primer design. The designed primers were as follows: upstream primer BjuActin-F: ATGTCGTCTCTGAGCAGAGAG, downstream primer BjuActin-R: TCACCTTTGAATCTGATGATCTGA.

[0039] (2) Amplification system and procedures

[0040] The total PCR amplification reaction system was 20 μL, including: 12.5 μL PrimerSTAR, 1 μL mustard cDNA, 1 μL BjuActin-F, 1 μL BjuActin-R and 9.5 μL ddH2O.

[0041] PCR amplification reaction program: a) 98°C for 2 min; b) 98°C for 30 sec, 58°C for 30 sec, 72°C for 3 min 30 sec, 34 cycles in total; c) 72°C for 10 min; d) incubation at 4°C.

[0042] After PCR amplification, agarose gel electrophoresis was performed (see Figure 1 ), recover the target band and clone the vector Simple ligation, transformation to E. coli DH-5α competent cells, picking single clone plaques for detection, sending the correct plaques to the company for sequencing, and obtaining the CDS sequence of the BjuTPR2 gene (SEQ ID NO: 1):

[0043]

[0044] The amino acid sequence of the protein encoded by the BjuTPR2 gene is (SEQ ID NO: 2):

[0045]

[0046] Example 2 Construction of B. juncea TPR2 overexpression / interference vector

[0047] 1. Primer design of B. juncea BjuTPR2 overexpression / interference vector

[0048] Genetic transformation of mustard mainly uses the plant overexpression vector pCAMBIA1300-525-bar and the RNA interference vector RNAi-zice. The primers used are as follows:

[0049]

[0050] 2. Use homologous recombination method to connect vectors

[0051] (1) Select homologous recombination for vector construction, and cut the vector plasmid with a cutting enzyme. The specific enzyme cutting system is: 15 μL of vector plasmid, 5 μL of 10× Quickcut Green Buffer, 1.5 μL of Quickcut enzyme I, 1.5 μL of Quickcut enzyme II, and add ddH2O to 50 μL.

[0052] (2) The homologous recombination ligation system is: MonClone Single Assembly Clong Mix 5 μL, linearized vector 50-200 ng, insert fragment 10-200 ng, add ddH2O to 10 μL.

[0053] (3) Conversion:

[0054] a. On a clean bench, pipette 5 μL of the homologous recombination system mixture from step (2) into a new centrifuge tube, then add 50 μL of DH5α competent cells and place on ice for 20-30 minutes.

[0055] b. Heat shock at 42°C for 45 seconds and place on ice for 2 minutes; add 500 μL of LB liquid medium without antibiotics and incubate on a shaking incubator at 37°C / 220 rpm for 1 hour.

[0056] c. Centrifuge at 4000 rpm for 5 min. Pour off most of the supernatant in a clean bench. Use a pipette to mix the supernatant and the precipitate.

[0057] d. Pipette the mixed solution onto a solid culture plate containing LB resistance (kanamycin) and culture overnight in a 37°C incubator for 12-16 hours.

[0058] e. Pick up colonies with normal growth status on the clean bench, amplify them in the PCR amplification system, perform agarose gel electrophoresis after amplification, and select colonies with correct bands for sequencing.

[0059] 3. Agrobacterium Transformation

[0060] (1) Extract the E. coli plasmid that has been successfully constructed, and according to the concentration of the extracted plasmid, take an appropriate amount of plasmid and add it to 33 μL of Agrobacterium competent cells, and use a pipette to mix.

[0061] (2) Ice bath for 5 min, liquid nitrogen for 5 min, 37°C constant temperature water bath for 5 min, ice bath for 5 min.

[0062] (3) Add 700 μL of LB liquid culture medium without antibiotics to the centrifuge tube containing the mixed solution and culture on a shaker at 28°C and 220 rpm for 1 h 30 min.

[0063] (4) Prepare LB solid culture plates containing rifampicin and kanamycin resistance in advance. After the shaking culture is completed, take 80 μL of the bacterial solution and apply it to the LB solid culture plate, and culture it upside down in a 28°C oven for 2-3 days.

[0064] (5) Select colonies with normal growth status for spot detection.

[0065] (6) Select the colony with the correct band and use LB liquid medium containing rifampicin and kanamycin resistance to expand and preserve it, and obtain the bacterial liquid containing the B. juncea BjuTPR2 overexpression / interference recombinant plasmid. When storing, 300 μL of glycerol and 600 μL of bacterial liquid are placed in a -80°C refrigerator.

[0066] Example 3 Obtaining transgenic plants of Brassica juncea BjuTPR2 overexpression / interference vector

[0067] A method for obtaining a transgenic plant of Brassica juncea BjuTPR2 overexpression / interference vector comprises the following steps:

[0068] (1) Sowing: In a clean bench, wash mustard seeds 2-3 times with sterile water, disinfect with 75% alcohol for 30 seconds, and rinse the seeds 2 more times with sterile water. Then soak them in 10% NaClO for 15 minutes, and rinse them 3 more times with sterile water. Sow the sterilized seeds in the sowing medium at an appropriate distance.

[0069] (2) Seedling cutting: 6-7 days after sowing, cut the hypocotyls of the mustard seedlings into pieces of about 1 cm in size, place them in the pre-culture medium, and culture them upside down for 2-3 days.

[0070] (3) Propagation: The bacterial solution containing the B. juncea BjuTPR2 overexpression / interference recombinant plasmid in Example 2 was activated. On the day of infection, the activated bacterial solution was poured into 50 mL of antibiotic-free LB liquid culture medium and propagated until OD 600 The value is about 0.8-1.0, and centrifuge at 4000rpm at 4℃ for 10min.

[0071] (4) Infection: Resuspend the cells in MS buffer to a value of OD 600 The value is about 0.8-1.0. Pour the mustard hypocotyls into the bacterial solution and soak for 8-10 minutes, then take them out and drain them. During this period, shake the bacterial solution continuously. Place the hypocotyls in the pre-culture medium and invert them for dark culture for 2 days.

[0072] (5) Screening: The hypocotyls processed in step (4) are placed on a screening medium (containing a certain concentration of the herbicide glufosinate ammonium) for culture, and the differentiation medium is replaced every 10 days until the hypocotyls differentiate into adventitious buds.

[0073] (6) Rooting: The plants that survived the screening medium were placed in a rooting medium to induce rooting.

[0074] (7) Transplantation: The rooted plants were transferred to culture pots to obtain B. juncea BjuTPR2 overexpression / interference vector transgenic plants.

[0075] Example 4 Screening and phenotypic identification of transgenic Brassica juncea positive plants

[0076] After the plants grow true leaves, the DNA and RNA of the BjuTPR2 overexpression transgenic plants and BjuTPR2 interference transgenic plants in Example 3 are extracted respectively; the wild type (WT) is used as a control, and PCR and qRT-PCR tests are performed to detect whether it is a positive plant. If it is a positive plant, it continues to grow until its seeds are harvested. OE#1 and OE#4 are overexpression positive plants, and Ri#11 and Ri#13 are interference positive plants, which are used for subsequent experiments.

[0077] Phenotypic observations revealed that the flowering time of the interference plants was earlier than that of the wild type, while the flowering time of the overexpression plants was significantly later than that of the wild type (see Figure 2 and Figure 4 ).

[0078] Example 5 Quantitative detection of transgenic mustard positive plants

[0079] 1) Extract RNA from the positive plants in Example 4 and convert it into cDNA.

[0080] 2) Design primers for RT-qPCR. The primers are as follows:

[0081]

[0082] 3) Quantitative reaction system and procedure

[0083] The total qRT-PCR reaction system is 20 μL, including 10 μL SYBR qPCR SuperMixPlus, 0.5 μL upstream primer, 0.5 μL downstream primer, 1 μL template cDNA and 8 μL RNase Free Water.

[0084] The qRT-PCR reaction program was: a) 95°C for 1 min; b) 95°C for 20 sec, optimal temperature for 1 min, and 35-45 cycles.

[0085] The relative expression levels of BjuTPR2, BjuSOC1, and BjuFT genes in the transgenic T1 plants were detected. It was found that the relative expression level of BjuTPR2 in the overexpression plants was significantly higher than that in the wild type, while the relative expression levels of the flowering integrons BjuSOC1 and BjuFT genes were significantly lower than those in the wild type (see Figure 3 ). In contrast, the expression of BjuTPR2 in the interference plants was significantly lower than that in the control, while the expression of BjuSOC1 and BjuFT was significantly higher than that in the control (see Figure 5 ).

[0086] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. Application of B. juncea BjuTPR2 gene in regulating the flowering period of plants, characterized in that: The open reading frame of the BjuTPR2 gene has a sequence as shown in SEQ ID NO.1, and the expression level of the BjuTPR2 gene is increased in plants to promote plant flowering; the expression level of the BjuTPR2 gene is reduced in plants to delay plant flowering, and the plant is mustard.

2. The use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the BjuTPR2 gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The method for increasing the expression level of the BjuTPR2 gene in plants is: increasing the expression of the endogenous BjuTPR2 gene in the plant, or overexpressing the exogenous BjuTPR2 gene in the plant.

4. The use according to claim 1, characterized in that: The overexpression of the exogenous BjuTPR2 gene refers to connecting the BjuTPR2 gene to a plant expression vector and transforming it into the plant through Agrobacterium-mediated transformation.

5. The use according to claim 1, characterized in that: The method for reducing the expression level of the BjuTPR2 gene in plants is: constructing an interference expression vector to reduce the expression of the BjuTPR2 gene.

6. The use according to claim 5, characterized in that: The construction of the interference expression vector refers to connecting the BjuTPR2 gene to the interference vector and transforming it into the plant through Agrobacterium-mediated transformation.

7. The use according to claim 6, characterized in that: The BjuTPR2 gene is introduced into plant cells, tissues or organs by constructing an interference expression vector to produce interference RNA to inhibit the expression of the BjuTPR2 gene.

8. The use according to claim 5 or 7, characterized in that: The transformation into plants mediated by Agrobacterium specifically involves introducing a plant overexpression vector or an interference vector of the BjuTPR2 gene into cells, tissues or organs of the plant.

9. A recombinant vector, transgenic cell line or recombinant bacterium containing the gene according to claim 1.

10. A method for advancing / delaying plant bolting and flowering, characterized in that: The method comprises introducing the BjuTPR2 gene of claim 1 into plant cells, tissues or organs to obtain transgenic plants.

Images